A ZmWRKY60 gene mutant and its application in regulating the plant height of maize

Abstract

The present invention discloses a ZmWRKY60 gene mutant and its application in regulating the plant height of maize, which relates to the technical fields of functional genes and plant gene breeding. The ZmWRKY60 gene mutant is obtained by a nonsense mutation caused by the substitution of base C with base T at the 736th position in the coding region of the wild-type ZmWRKY60 gene. The nucleotide sequence of the mutant is shown in SEQ ID NO.3. The gene-edited plant KOwryk60 uses a single-gene double-target method to inactivate the ZmWRKY60 gene. The results show that both the mutant Zmwrky60 and the gene-edited plant KOwryk60 can reduce the plant height of maize, indicating that the ZmWRKY60 gene is involved in the regulation of maize plant height. This provides important theoretical significance and application value for creating new maize germplasms and cultivating ideal maize plant types.

Description

Technical Field

[0001] The present invention relates to the technical fields of functional genes and plant genetic breeding, and particularly relates to a ZmWRKY60 gene mutant and its application in regulating the plant height of maize. Background Art

[0002] Maize is not only an important feed source for the breeding industry, but also one of the main raw materials for industries such as food processing, medical and health, light industry, and chemical industry. Research and production practices have proved that increasing the planting density is one of the effective measures to improve maize yield. Maize plant height is closely related to planting density, biomass, lodging resistance, and grain yield, and is an important trait concerned in maize breeding. Therefore, exploring maize dwarf gene resources and cultivating new maize varieties with ideal plant height is an effective way to further improve maize yield.

[0003] In addition to being closely related to the hormone levels in the body, the plant height of maize is also sometimes reported to be regulated by some transcription factors. Among them, the WRKY transcription factor is one of the largest transcription factor families in higher plants. The WRKY protein can bind to the W-box (TTGACC / T) in the promoter of its target gene to inhibit or activate the expression of downstream genes, thereby regulating the growth and development of plants.

[0004] In recent years, some WRKY transcription factors regulating plant height have been reported in crops such as rice and Arabidopsis. For example, RNA interference of OsWRKY78 causes plant dwarfing; overexpression of OsWRKY89 can cause an increase in the lignin content of rice stems and a decrease in plant height; overexpression of Arabidopsis AtWRKY12 will inhibit the lignification level of stems, resulting in plant dwarfing and a phenotype of partial plant sterility. However, there are still few reported WRKY transcription factors related to plant height in maize. Summary of the Invention

[0005] The purpose of the present invention is to provide a ZmWRKY60 gene mutant for regulating maize plant height, and secondly to provide the application of the ZmWRKY60 gene mutant in maize breeding.

[0006] The present invention achieves the above purpose through the following technical solutions:

[0007] The present invention provides a ZmWRKY60 gene mutant, which is obtained by a point mutation in which the base C at the 736th position in the coding region of the wild-type ZmWRKY60 gene is replaced by the base T, and the nucleotide sequence is as shown in SEQ ID NO.3.

[0008] A further improvement lies in that the amino acid sequence encoded by the ZmWRKY60 gene mutant is as shown in SEQ ID NO.4.

[0009] A further improvement is that the mutant can reduce the plant height of maize.

[0010] The present invention provides an application of the above ZmWRKY60 gene mutant in regulating the plant height of maize, which is achieved by using gene editing technology or traditional genetic breeding technology. The gene editing technology refers to editing the ZmWRKY60 gene in wild-type maize into the above ZmWRKY60 gene mutant to obtain maize with reduced plant height; the traditional genetic breeding technology refers to hybridizing, backcrossing, and self-crossing and separating a maize plant containing the ZmWRKY60 gene mutant with a maize inbred line to be improved to obtain a dwarf maize inbred line with a clear genetic background and containing the ZmWRKY60 gene mutant.

[0011] The present invention has the following beneficial effects:

[0012] The ZmWRKY60 gene mutant provided by the present invention can reduce the plant height of maize, providing important theoretical significance and application value for creating new germplasms and cultivating ideal plant types of maize. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 It is an evolutionary tree analysis diagram after amino acid sequence alignment of ZmWRKY60 and other WRKY transcription factors;

[0014] Figure 2 It is a schematic diagram of maize protoplasts for subcellular localization of the ZmWRKY60 protein, used for subcellular localization of the ZmWRKY60 protein. In the figure, the nuclear localization signal mCherry is used as a nuclear marker;

[0015] Figure 3 It is the tissue expression pattern of the ZmWRKY60 gene;

[0016] Figure 4 It is a gene mutation pattern diagram of ZmWRKY60 and a sequencing peak diagram of the mutant line;

[0017] Figure 5 It is the plant height phenotype (whole plant) of the ZmWRKY60 gene mutant;

[0018] Figure 6 It is a statistical chart of the plant height of the ZmWRKY60 gene mutant and the wild type (in the figure: WT is the wild type; Zmwrky60 is the ZmWRKY60 gene mutant).

[0019] Figure 7 It is the plant height phenotype (whole plant) of the ZmWRKY60 gene-edited plant;

[0020] Figure 8Statistical chart of plant height of ZmWRKY60 gene - edited plants and wild - type plants (In the figure: WT is the wild - type; KOwryk60 is the ZmWRKY60 gene - edited plant). Detailed implementation manners

[0021] The following further describes the present application in conjunction with the attached drawings. It is necessary to point out here that the following detailed implementation manners are only used to further explain the present application and cannot be understood as limiting the protection scope of the present application. Those skilled in the art can make some non - essential improvements and adjustments to the present application based on the above application content.

[0022] 1. Materials and reagents

[0023] The maize inbred line B73 is the wild - type WT, provided by the National and Local Joint Engineering Laboratory of Crop Stress - resistant Breeding and Disaster Reduction, College of Life Sciences, Anhui Agricultural University.

[0024] The ZmWRKY60 gene, the nucleotide sequence is as shown in SEQ ID NO.1, and the amino - acid sequence is as shown in SEQ ID NO.2.

[0025] The maize plant height dwarf mutant Zmwrky60 plant contains the mutated ZmWRKY60 gene. There is a mutant EMS3 - 055a7a in the maize EMS mutant library (http: / / elabcaas.cn / memd / public / index.html# / pages / search / geneid). Through genome re - sequencing and Mutmap mapping, it is found that the ZmWRKY60 gene of this mutant EMS3 - 055a7a has a nonsense mutation from C to T at the 736th position in the coding region. After field planting, it is observed that the plant height of this mutant is shorter than that of the wild - type, namely the maize inbred line B73. Through back - crossing with the wild - type B73 for six generations and then self - crossing, a dwarf mutant plant Zmwrky60 with a clearer genetic background is isolated.

[0026] In order to determine the function of the ZmWRKY60 gene in maize plant height, in addition to investigating the plant height traits of the dwarf mutant plant Zmwrky60, gene - edited lines were also created. For non - coding proteins, the Huazhong Agricultural University CRISPR - P website (http: / / crispr.hzau.edu.cn / CRISPR2 / ) was used for design, and targets with high target scores, low off - target rates, and appropriate positions were selected. For the ZmWRKY60 gene, a single - gene double - target design was adopted, and the sequences of target 1 and target 2 are as shown in SEQ ID NO.5 and SEQ ID NO.6 respectively. The constructed pCXB053 vector was sent to Weimi Biotechnology Co., Ltd. for the creation of gene - edited plants KOwrky60.

[0027] SEQ ID NO.5: Target 1: GCCGGAGCATTGGATACGGAGGG

[0028] SEQ ID NO.6: Target 2: TTAGCAGAAGACAGAATCCAGGG

[0029] The primers used were synthesized and the sequencing was completed by Sangon Biotech (Shanghai) Co., Ltd.; various restriction endonucleases, DNA Marker, Taq DNA polymerase, etc. used in the experiment were purchased from Takara; the reverse transcription kit was purchased from Promega; the plasmid extraction kit and the gel extraction kit were both purchased from TransGen Biotech Co., Ltd.

[0030] The methods used in this example are all conventional methods known to those skilled in the art without special instructions, and the reagents without special instructions are all commercially available products.

[0031] 2. Method

[0032] 2.1 Construction and functional analysis of the phylogenetic tree of maize ZmWRKY60 gene

[0033] The predicted nucleotide sequence and protein sequence of the ZmWRKY60 gene were obtained by searching the MAIZEGENOME and NCBI databases, as shown in SEQ ID NO.1 and SEQ ID NO.2 respectively. Subsequently, the phylogenetic relationships of WRKY protein sequences from different plants were analyzed with the amino acid sequence of ZmWRKY60, and the results are as Figure 1 shown.

[0034] 2.2 Subcellular localization of ZmWRKY60

[0035] 2.2.1 Construction of the subcellular localization fusion vector of ZmWRKY60

[0036] Using pCAMBIA1305 (p1305) as the vector backbone and GFP green fluorescent protein as the reporter gene, the p1305-ZmWRKY60-GFP fusion expression vector was constructed. When designing the gene primers this time, the stop codon of the ZmWRKY60 gene should be removed. The upstream restriction enzyme site is XbaI, and the downstream restriction enzyme site is BamHI. The primers were synthesized by Sangon Biotech. The primer sequences are as follows:

[0037] SEQ ID NO.7: 60-1305F: TCCGGAGCTAGCTCTAGAATGGAGGAAGTGGAGGA GGCGA

[0038] SEQ ID NO.8: 60-1305R: CTTGCTCACCATGGATCCCACCTGTGCTGCTGCTGCTGC

[0039] 2.2.2 Protoplast Transformation

[0040] (1) Grow B73 maize seeds in the dark for about 2 weeks. Take 1.5 g of etiolated seedling leaves with good growth conditions, remove the leaf veins, and cut them into 0.2 mm thin leaf strips with a scalpel in a relatively dark environment.

[0041] (2) Put the cut thin leaf strips into the pre-prepared enzyme solution (15 mL), and use forceps (pipette tips) to completely immerse them.

[0042] (3) Extract with a vacuum pump in the dark for 30 min to accelerate the full contact between the enzyme solution and the cell wall.

[0043] (4) Incubate with a horizontal shaker at 40 rpm at room temperature and enzymolyze for 6 h in the dark.

[0044] (5) Pre-cool a certain amount of W5 solution and an empty sterile 50 mL round-bottom centrifuge tube (ice bath).

[0045] (6) Rinse a 100-mesh metal sieve with W5 and filter and dilute the enzyme solution containing protoplasts.

[0046] (7) Lower the acceleration and deceleration of the refrigerated centrifuge, centrifuge at 100 g at 4 °C for 2 min, aspirate the supernatant, then add 5 mL of pre-cooled W5 solution on ice, and slowly tilt and rotate the centrifuge tube to mix it evenly.

[0047] (8) Incubate in the dark on ice for 30 min and centrifuge again at 100 g at 4 °C for 2 min.

[0048] (9) Try to remove the W5 solution in the dark. Add an appropriate amount of MMG solution (such as 300 μL) according to the amount of the precipitate, and resuspend the protoplasts in the same way. Check the state and quantity of the protoplasts in the solution under a microscope on a hemocytometer to make its final concentration not less than 1×10 6 cells / mL.

[0049] (10) Add 5 μg of recombinant plasmid DNA (the concentration is preferably above 500 ng / μL) into a 2 mL round-bottom EP tube.

[0050] (11) Add 100 μL of protoplasts (2×10 4 cells), and gently mix.

[0051] (12) Add 120 μL (the volume is the sum of the volumes of step 11 + step 12) of PEG4000 solution, and gently mix.

[0052] (13)Induce under ice in the dark, select the transformation time according to the expression level, generally 1 h is sufficient.

[0053] (14)Dilute the transformation mixture with 480 μL (four times the volume added in step 12) of W5 solution at room temperature, and gently mix to terminate the transformation reaction.

[0054] (15)Centrifuge at room temperature for 2 min, try to remove the supernatant as much as possible, then wash once with W5 solution, and centrifuge to remove the supernatant in the same way.

[0055] (16)Gently resuspend the cells with W1 / W5 solution, then transfer them to a multi-well tissue culture dish and wrap with tin foil.

[0056] (17)Cultivate the protoplasts at room temperature for 24 - 36 h, and then observe with a laser confocal microscope.

[0057] The results are as Figure 2 shown. The ZmWRKY60-GFP fusion protein is localized in the nucleus, which is consistent with the characteristics of transcription factors.

[0058] 2.3 Analysis of ZmWRKY60 gene expression pattern

[0059] 2.3.1 Obtaining maize materials

[0060] For tissue expression pattern analysis, when B73 grows to the four-leaf stage, take the whole plant out of the seedling pot, wash the soil from the roots, take three samples each of roots, stems, and leaves and put them in tin foil, make marks, quickly freeze them in liquid nitrogen and then place them in an ultra-low temperature freezer for later use. Take another three samples each of husks, anthers, pollen, growing silk of maize at the silking stage, ears, and embryos in the field, quickly freeze them and use later.

[0061] 2.3.2 Extract total RNA from maize by Trizol method

[0062] Prepare 2 mL RNase Eppendorf tubes and 1 mL RNase pipette tips in advance and pre-cool them in liquid nitrogen. Turn on the refrigerated centrifuge and pre-cool it at 4 °C; pre-cool a mortar (dried in an oven at 180 °C for 6 h) with liquid nitrogen. Take about 1 g of leaves, grind them thoroughly and quickly, add liquid nitrogen repeatedly during grinding until the sample powder turns slightly white, quickly transfer it into an Eppendorf tube with a pipette tip (the inner parts of the pre-cooled pipette tip and Eppendorf tube will not adhere to the sample powder), add an appropriate amount of Trizol reagent for lysis, vortex and place it in the dark on ice for 10 min; then add 0.25 mL of chloroform isoamyl alcohol (24:1) to each tube, tightly close the lid and shake quickly for 15 s in the fume hood, then place it in the dark on ice for 3 min, centrifuge the mixture at 12,000 g at 4 °C for 5 min; carefully take the supernatant and transfer it to a new 1.5 mL RNase Eppendorf tube, mix it with an equal volume of isopropanol, let it stand on ice for 10 min, and centrifuge at high speed again for 10 min; discard the supernatant. The ideal RNA precipitate of young plant leaves should be white. Add 1 mL of newly prepared 75% alcohol for washing (note that the precipitate should not be dispersed); centrifuge at 12,000 g at 4 °C for 5 min and discard the supernatant; add 1 mL of newly prepared 75% alcohol for washing again and then centrifuge. Try to remove the residual alcohol and dissolve the RNA precipitate with an appropriate amount of DEPC water for standby.

[0063] 2.3.3 RNA Reverse Transcription

[0064] Use the Takara reverse transcription kit to perform the RNA reverse transcription experiment. The specific operation steps are as follows:

[0065] (1) Use a ultra-micro nucleic acid and protein concentration detector to detect the concentration and quality of the extracted RNA and record them.

[0066] (2) Perform agarose gel electrophoresis on the extracted RNA. Qualified RNA should have 3 obvious bands, mainly 28S, 18S, 5.8S and 5S.

[0067] (3) For the qualified RNA detected, perform the reverse transcription experiment according to the kit instructions. For each reverse transcription reaction, accurately add 1 μg of RNA according to the concentration. The loading system is as follows: Ⅱ SuperMix 10 μL; Total RNA is added to 1 μg according to the measured concentration; then add RNase free H 2 O to make up to 20 μL. After careful mixing, incubate in a water bath at 25 °C for 5 min, then at 42 °C for 30 min, and finally inactivate the enzyme at 85 °C.

[0068] 2.3.4 ZmWRKY60 Gene Expression Pattern

[0069] According to the CDS sequence of the ZmWRKY60 gene, quantitative primers 60D-F / R were designed using the online version of Primer3 Plus. Online version of Primer3 Plus: https: / / www.bioinformatics.nl / cgi-bin / primer3plus / primer3plus.cgi.

[0070] The primers were synthesized by Sangon Biotech Co., Ltd., and the primer sequences are as follows:

[0071] SEQ ID NO.9: 60D-F: ACGAAGCATGCACCAAGTTT

[0072] SEQ ID NO.10: 60D-R: TTCTGAGTCAAGAACCCTGGA

[0073] Using GAPDH (GenBank accession no. EU969279.1) as the internal reference gene, real-time fluorescence quantitative PCR reactions were carried out using the fluorescence quantitative reagent of Roche. The specific reaction system is as follows: 10 μL SYBR Green RealtimePCR Master Mix, 6.8 μL ddH 2 O, 0.8 μL forward primre, 0.8 μL reverse primer, and finally 1.6 μL cDNA template was added.

[0074] The thermal cycling program is as follows: 55 °C for 1 min, 95 °C for 10 min, 40 cycles, 95 °C for 15 s, 60 °C for 1 min. After the last cycle, melting curve analysis was carried out in the temperature range of 60 - 95 °C with an increment of 0.5 °C to verify the specificity of the reaction. The amplification signals and data processing were performed using the comparative Ct method (ΔΔCt), and the relative expression value RQ = 2 (-ΔΔCt) 。

[0075] The results are as Figure 3 shown, indicating that the expression level of the ZmWRKY60 gene is the highest in the stem, followed by the leaves, and lower in other tissues such as roots, bracts, anthers, and filaments.

[0076] 2.4 Extraction of genomic DNA from the mutant Zmwrky60

[0077] The genomic DNA of the maize plant height dwarf mutant Zmwrky60 was extracted using the CTAB method. The steps are as follows:

[0078] Take a 2-cm-long leaf and place it in a 2-mL centrifuge tube. Add small steel beads, quickly freeze it in liquid nitrogen, and then place it in a grinder. Vortex at 45 Hz for 2 min. After sufficient vortexing, add 800 μL of CTAB extraction buffer, vortex to mix evenly, incubate in a 65 °C water bath for 1 h, and turn it over several times in the middle. Add an equal volume of chloroform-isoamyl alcohol (24:1) in the fume hood, vortex to mix evenly; centrifuge at 12,000 rpm for 10 min, carefully pipette about 700 μL of the supernatant, transfer it to a 1.5-mL centrifuge tube, add an equal volume of isopropanol to precipitate nucleic acids, and let it stand for 2 min; then centrifuge at 12,000 rpm for 10 min, discard the supernatant, add 500 μL of 70% alcohol and gently wash twice; finally, pour out the alcohol, air-dry it in the fume hood, add 100 μL of deionized water, and store it at -20 °C.

[0079] 2.5 Detection of ZmWRKY60 gene termination mutants

[0080] 2.5.1 Primer design

[0081] The full-length CDS of the ZmWRKY60 gene is 1100 bp, containing 3 exons, and the first exon is the longest, which is 824 bp. In this study, specific primers were designed for the first exon region using Primer Premier 5.0 software, and the primers were synthesized by Sangon Biotech Co., Ltd. The primer sequences are as follows:

[0082] SEQ ID NO.11: 60EMS-F: 5'ATGGAGGAAGTGGAGGAGGC3'

[0083] SEQ ID NO.12: 60EMS-R: 5'CTTCTCTTTGAACAATGGCACC3'

[0084] The amplified length is 824 bp.

[0085] 2.5.2 PCR amplification conditions

[0086] Using the genomic DNA of the maize plant height dwarf mutant Zmwrky60 as a template, perform a PCR amplification reaction. The reaction system is as follows: The total volume is 25 μL, including 12.5 μL of Primer STAR Max premix (2×), 1 μL each of primers 60EMS-F and 60EMS-R, 2 μL of mutant genomic DNA, and finally 8.5 μL of sterilized water is added.

[0087] After adding the samples, centrifuge at low speed to mix evenly, and perform the reaction in a PCR instrument. The reaction program is as follows: After pre-denaturation at 98 °C for 10 min, then denaturation at 98 °C for 10 s, annealing at 60 °C for 5 s, extension at 72 °C for 1 min, run 35 cycles, and finally extension at 72 °C for 10 min. Store the PCR product at 4 °C.

[0088] 2.5.3 PCR Product Electrophoresis and Sequencing

[0089] After PCR, agarose gel electrophoresis was used to detect the product size. The band around 800 bp was recovered and sent to Nanjing Shengong Biological Company for Sanger sequencing, and then compared with SEQ ID NO.1. The results (see Figure 4 ) showed that the bases CAG at positions 736 - 738 of the ZmWRKY60 gene in the mutant changed to TAG, and a homozygous termination mutant of the ZmWRKY60 gene was obtained.

[0090] 2.6 Identification of the Plant Height Phenotype of Mutant Zmwrky60

[0091] Maize inbred line B73 with consistent kernel size was selected as the control group, and mutant Zmwrky60 as the experimental group. First, vermiculite was used to germinate at room temperature for 2 days. After germination, 30 seeds with consistent growth vigor were selected from each group and transplanted into flower pots with a vermiculite:black soil ratio of 1:1, and then placed in the greenhouse for growth. The temperature in the greenhouse was maintained at about 28°C during the day and about 22°C at night. The photoperiod was approximately 16 hours of light and 8 hours of darkness, and the humidity was about 60%. After tasseling, the plant height was measured and photographed. The results are shown in Figure 5 and Figure 6 respectively. Compared with the wild type (WT in Figure 6 ), the plant height of mutant Zmwrky60 (W60 in Figure 6 ) was significantly reduced.

[0092] 2.7 Identification of the Plant Height Phenotype of Gene-Edited Plant KOwrky60

[0093] The seeds of gene-edited plant KOwrky60 returned by the company were germinated with vermiculite at room temperature for 2 days. The control group used the seeds of maize inbred line B73 returned by the company. After germination, 30 seeds with consistent growth vigor were selected from each group and transplanted into flower pots with a vermiculite:black soil ratio of 1:1, and then placed in the greenhouse for growth. The temperature in the greenhouse was maintained at about 28°C during the day and about 22°C at night. The photoperiod was approximately 16 hours of light and 8 hours of darkness, and the humidity was about 60%. After tasseling, the plant height was measured and photographed. The results are shown in Figure 7 and Figure 8 respectively. Compared with the wild type (WT in Figure 7 ), the plant height of gene-edited plant KOwrky60 (KOwrky60 in Figure 7 ) was significantly reduced.

[0094] The results showed that compared with the wild type B73 plants, the plant heights of mutant Zmwrky60 and gene-edited plant KOwrky60 were significantly reduced, which provided important application value for creating new germplasms and cultivating ideal plant types of maize.

[0095] The embodiments described above merely represent several implementation manners of the present invention. The description thereof is relatively specific and detailed, but it should not be construed as a limitation to the scope of the patent for the present invention. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all fall within the protection scope of the present invention.

Claims

1. A ZmWRKY60 gene mutant, characterized in that, the ZmWRKY60 gene mutant can reduce the plant height of maize. The ZmWRKY60 gene mutant is obtained by a point mutation in which the base C at the 736th position in the coding region of the wild-type ZmWRKY60 gene is replaced by the base T. The nucleotide sequence is as shown in SEQ ID NO.3, and the amino acid sequence encoded by the ZmWRKY60 gene mutant is as shown in SEQ ID NO.

4.

2. Use of a ZmWRKY60 gene mutant as described in claim 1 in regulating the plant height of maize.

3. The use according to claim 2, characterized in that, by using gene editing technology, the ZmWRKY60 gene in wild-type maize is edited into the ZmWRKY60 gene mutant to obtain maize with reduced plant height.

4. The use according to claim 2, characterized in that, a maize plant containing the ZmWRKY60 gene mutant is hybridized, backcrossed, and self-crossed with a maize inbred line to be improved to obtain a dwarf maize inbred line with a clear genetic background and containing the ZmWRKY60 gene mutant.

Images