Brucellosis cellular immunity protein and application thereof

By detecting the IL-17 level in whole blood of animals after brucellosis vaccination and using brucellosis cellular immune proteins BMEI1536, BMEI0845, and BMEI0178, the complexity and safety issues of assessing the cellular immune level of brucellosis vaccines in existing technologies have been resolved, enabling rapid and accurate assessment of immunization efficacy.

CN116217739BActive Publication Date: 2025-11-25TECON BIOPHARMACEUTICAL CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310147968.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-02-22
Publication Date
2025-11-25
Estimated Expiration
2043-02-22

AI Technical Summary

Technical Problem

Current technologies lack a rapid, simple, and safe method to assess the cellular immune level of brucellosis vaccines, and traditional methods are complex and pose biosafety risks.

Method used

The brucellosis cell-mediated immunity proteins BMEI1536, BMEI0845, and BMEI0178 were used to evaluate the immunoprotective efficacy of the vaccine by detecting the level of the cytokine IL-17 in the whole blood of immunized animals using the ELISA method.

Benefits of technology

This provides a simple, safe, and accurate method to evaluate the immunizing effect of brucellosis vaccines, enhancing the ability of antigens to induce immune responses.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116217739B_ABST
    Figure CN116217739B_ABST
Patent Text Reader

Abstract

The present application belongs to the field of microbial genetic engineering, and particularly relates to a brucellosis cellular immunity protein and application thereof. Firstly, a brucella protein with high immunogenicity is screened through antibody profiling technology; then, molecular biology technology is used to fuse and express the brucella protein gene sequence and the brucella T cell epitope and antigen gene sequence, so as to improve the ability of the antigen to induce immune response; then, the antigen is subjected to multistage purification after in-vitro expression, and the obtained purified protein is used as a stimulant; finally, the anticoagulated blood of an immunized animal is collected, the stimulant is added, and the mixture is incubated at 37 DEG C for 24 hours; the supernatant is collected by centrifugation, and the IL-17 level in the supernatant is detected by ELISA. The brucellosis cellular immunity protein is prepared into a reagent for detecting the IL-17 level, and the IL-17 is detected by ELISA, so that the protection level of an animal after brucella vaccine immunization can be effectively evaluated, the operation is simple and accurate, and the problem that the protection level of the vaccine after brucella vaccine immunization cannot be quickly evaluated is solved.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of microbial genetic engineering, and particularly relates to a brucellosis cellular immunity protein and application thereof. BACKGROUND

[0002] Brucellosis (brucellosis) is a zoonosis caused by various Brucella, which has a significant impact on human health and animal economic returns. Like other infectious diseases, vaccine immunization is the most effective means of brucellosis prevention and control. The currently used vaccines include A19, S2, M5, A19-ΔVirB12, etc. The vaccines can effectively provide protection after vaccination, and the protection efficacy gradually decreases over time after vaccination.

[0003] To detect the protection efficacy of the vaccine in time, the prior art often adopts the method of immune challenge combined with antibody detection, and usually adopts the Rose Bengal plate agglutination test (RBT) and the test tube agglutination test (SAT) antibody detection method. However, the antibody detection cannot directly reflect the change of the protection efficacy of the vaccine, because Brucella is an intracellular parasite, and the body mainly plays a role in preventing and clearing Brucella through cellular immunity. Cellular immunity is the main indicator of the protection efficacy provided by the brucellosis vaccine. At present, the post-vaccine efficacy evaluation method is only the challenge verification method, that is, after vaccination, a virulent strain is used for challenge, and the bacterial load in the tissue after challenge is evaluated to evaluate the efficacy of the vaccine. This method is complex, and needs to be carried out in a three-level biosafety laboratory, which has high economic investment. At the same time, operating the virulent strain has a high biosafety risk, and there is a possibility of personnel infection. At present, there is no detection method that can quickly, simply and effectively evaluate the cellular immunity level after vaccination. SUMMARY

[0004] The technical problem to be solved by the present application is to provide a reagent and method for effectively detecting the immune protection efficacy by detecting the level of cytokine IL-17 in the whole blood of animals after immunization, aiming at the deficiencies of the prior art.

[0005] To solve the above technical problem, the present application provides a brucellosis cellular immunity protein.

[0006] The present application also provides the application of the above-mentioned brucellosis cellular immunity protein in preparing a reagent for detecting the immunization level of a brucellosis vaccine and in detecting the immunization level of a brucellosis vaccine.

[0007] The technical solution adopted by the present application is as follows:

[0008] A brucellosis cellular immunity protein, wherein the brucellosis cellular immunity protein is any one of BMEI1536*, BMEI0845* and BMEI0178*.

[0009] The BMEI1536* has a nucleotide sequence as shown in SEQ ID No. 1.

[0010] The BMEI0845* has a nucleotide sequence as shown in SEQ ID No. 2.

[0011] The BMEI0178* has a nucleotide sequence as shown in SEQ ID No. 3.

[0012] Preferably, the brucellosis vaccine cellular immunoprotein is BMEI1536*.

[0013] The brucellosis cellular immunoprotein is obtained by recombination transformation, culture expression and purification after fusion expression of a brucellosis T cell epitope peptide segment and the gene sequences BMEI1536, BMEI0845 and BMEI0178 of antigens.

[0014] The brucellosis T cell epitope peptide segment is APGEKDGKIVPA, and has a nucleotide sequence as shown in SEQ ID No. 4.

[0015] The recombination transformation is to synthesize the sequence after the fusion expression into an expression vector pET-28a to obtain a recombination plasmid, and then transform the recombination plasmid into a host strain BL21.

[0016] The culture expression has a culture condition of 37℃, 200r / min, and culture for 12-16h.

[0017] The purification is nickel column purification and molecular sieve purification.

[0018] The application of the brucellosis cellular immunoprotein in preparing a reagent for detecting the immune level of a brucellosis vaccine is also within the protection scope of the present application.

[0019] The reagent is any one of BMEI1536*, BMEI0845* and BMEI0178*, and is preferably BMEI1536*.

[0020] The application of the brucellosis cellular immunoprotein in detecting the immune level of a brucellosis vaccine is also within the protection scope of the present application.

[0021] The specific detection steps are: collecting a blood sample of a cow after immunization, adding the brucellosis cellular immunoprotein to the blood sample, collecting the supernatant after incubation, and detecting the concentration of IL-17 in the supernatant by an ELISA method.

[0022] The Brucella cell immunity protein has a concentration of 600-1500 μg / ml; and the incubation is carried out at 37℃ for 16-48 hours.

[0023] Preferably, when the Brucella cell immunity protein is BMEI1536*, the antigen protein concentration is 800-1200 μg / ml, the incubation time is 32-48 hours, and the IL-17 concentration can reach 91.029-174.898 pg / ml; when the Brucella cell immunity protein is BMEI0845*, the antigen protein concentration is 1000-1500 μg / ml, the incubation time is 24-40 hours, and the IL-17 concentration can reach 95.976-128.955 pg / ml; when the Brucella cell immunity protein is BMEI0178*, the antigen protein concentration is 800-1200 μg / ml, the incubation time is 40-48 hours, and the IL-17 concentration can reach 103.308-146.181 pg / ml.

[0024] Preferably, when the Brucella cell immunity protein is BMEI1536*, the antigen protein concentration is 800-1200 μg / ml, the incubation time is 32-48 hours, and the IL-17 concentration can reach 91.029-174.898 pg / ml.

[0025] Most preferably, when the Brucella cell immunity protein is BMEI1536*, the antigen protein concentration is 1000 μg / ml, the incubation time is 40 hours, and the IL-17 concentration can reach 174.898 pg / ml.

[0026] Advantages of the present application:

[0027] (1) The present application first uses the method of detecting the IL-17 concentration level to detect the immune effect of Brucella, and the method is simple in operation, high in safety and fast in accuracy.

[0028] (2) The present application provides a Brucella cell immunity protein which can effectively stimulate immune response in vitro, and the Brucella T cell epitope is fused and expressed with the antigen gene sequence, so that the ability of the antigen to induce immune response is further improved. BRIEF DESCRIPTION OF DRAWINGS

[0029] The above and / or other aspects of the present application will become apparent and more readily appreciated from the following description, taken in conjunction with the accompanying drawings, in which:

[0030] Figure 1The recombinant gene cloning results. Note: M: D2000; 1: BMEI0845; 2: BMEI1536; 3: BMEI0178.

[0031] Figure 2 The recombinant plasmid double enzyme digestion verification results. Note: M1: 15000 maker; M2: D2000; 1: BMEI0845; 2: BMEI1536; 3: BMEI0178; 4: pET-28a. DETAILED DESCRIPTION

[0032] The experimental methods described in the following examples are conventional methods unless otherwise specified. The reagents and materials described are commercially available unless otherwise specified.

[0033] The experimental materials used in the following examples are as follows:

[0034] 1. Experimental animals: 20 Brucella antibody-negative healthy calves were purchased from Xinjiang Xinglongsheng Animal Husbandry Technology Co., Ltd.

[0035] 2. Strains: Sheep Brucella M28 strain was purchased from China Veterinary Microbial Culture Collection Center; E. coli BL21 strain was purchased from GenScript Biotech Corporation (Shanghai) Co., Ltd.

[0036] 3. Vaccine: Brucella vaccine (A19 strain) was produced by Tiankang Biopharmaceutical Co., Ltd.

[0037] 4. Plasmid: pET-28a plasmid was purchased from GenScript Biotech Corporation (Shanghai) Co., Ltd.

[0038] 5. Experimental reagents

[0039] (1) PBS buffer dry powder, item number P1010, purchased from Beijing Solabio Technology Co., Ltd.

[0040] (2) Kanamycin was purchased from sigma company.

[0041] (3) Gram's stain, Kinyoun's stain, hydrogen sulfide biochemical medium, basic fuchsin, thionine were all purchased from Hangzhou Tianhe Microbial Reagent Co., Ltd.

[0042] (4) Plasmid extraction kit, nucleic acid gel recovery kit, PCR mix, T4 ligase, ployHis tag detection antibody were all purchased from Baobioengine (Dalian) Co., Ltd.

[0043] (5) Trypticase soy broth (TSB) item number 211825, trypticase soy agar (TSA) item number 236950, LB liquid medium item number 211327, all purchased from BD company, USA.

[0044] (6) IPTG, purchased from invitrogen company.

[0045] (7) Imidazole, purchased from sigma company.

[0046] (8) Bovine IL-17A ELISA kit, C-terminal polyHis and N-terminal polyHA tag detection antibody, purchased from abcam company.

[0047] 6. Experimental consumables

[0048] Table 1 Experimental consumables

[0049]

[0050] Example 1

[0051] 1. Construction of Brucella genome ORF recombinant expression library

[0052] Using high-throughput polymerase chain reaction / recombination cloning method, using Brucella genome sequence as template, construct all gene ORF expression clone library. Through high-throughput homologous recombination, the ORF cloned into the plasmid expression vector pET-28a, that is, the recombinant expression library is obtained.

[0053] 2. Establishment of protein chip method

[0054] 2.1 Chip protein preparation

[0055] Using cell-free in vitro expression system to express all ORF plasmid encoded proteins, a total of 3164 expression products were obtained, and each expressed protein was individually transferred to a custom-made nitrocellulose microarray slide. Each batch of printed protein chip slides was tested for quality control to check spot deposition and morphology by automatic scanning, and the expression of recombinant proteins was detected using antibodies against C-terminal polyHis and N-terminal polyHA tag, and the expression of recombinant proteins was analyzed. Non-expressed proteins are not included in subsequent analysis.

[0056] 2.2 Establishment of chip detection method

[0057] Labeling with CY5 anti-IgG antibody, preparing fluorescently labeled secondary antibody, optimizing serum concentration and secondary antibody dilution to obtain optimal primary and secondary antibody working conditions, and establishing chip detection method.

[0058] 3. Screening of immunogenic antigens

[0059] 3.1 Serum preparation

[0060] Ten 3-6 month old Brucella antibody negative calves were randomly divided into two groups, 5 in each group. A19 vaccine and normal saline were injected respectively. In the A19 vaccine group, each calf was subcutaneously immunized with 6.0 x 1010 CFU in the neck. The control group was injected with normal saline, and all the calves were isolated and fed under the same conditions. The serum of all experimental calves was collected 21 days after immunization and stored at -80°C. 10 CFU, the control group was injected with normal saline, and all the calves were isolated and fed under the same conditions. The serum of all experimental calves was collected 21 days after immunization and stored at -80°C.

[0061] 3.2 Antigen screening

[0062] The serum of the vaccine group and the serum of the control group were reacted with the protein chip screened for detection, and the specific reaction conditions were as follows: the protein-containing PBS buffer (containing 10%-50% glycerol) was spotted on the substrate. Incubate at 37°C for 2 hours, then block with PBS solution (containing 5% skim milk powder) at 37°C for 2 hours, wash with PBS buffer (containing 10% glycerol) 3 times, 5 min each time, with 2 min standing and 3 min shaking. After standing for 15 min, fluorescence detection was performed, and the immunogenicity of the corresponding protein was evaluated according to the fluorescence intensity. The proteins with a fluorescence intensity / control group fluorescence intensity ratio greater than 2 were selected as candidate antigens, and the candidate proteins are shown in Table 2 for the next experimental verification.

[0063] Table 2 Results of chip reaction of immune serum and control serum

[0064]

[0065] 4. Protein expression strain construction and protein purification

[0066] 4.1 Fusion expression of antigens

[0067] The online tool phyre2 (http: / / www.sbg.bio.ic.ac.uk / phyre2 / html / page.cgi?id=index) was used to predict the cell epitope, and the nucleotide sequence corresponding to the predicted Brucella bovine T cell epitope peptide segment (APGEKDGKIVPA) (AGCCGGTACGATCTTGCCGTCTTTTTCTCCCGGAGC) was linked to the nucleotide sequences of the three antigens screened to obtain antigens BMEI1536*, BMEI0845* and BMEI0178*, and their nucleotide sequences are shown in SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, respectively.

[0068] 4.2 Construction of immunoprotein recombinant expression strain

[0069] According to the sequence information of the three antigens after fusion expression in 4.1, the sequence is synthesized into the expression vector pET-28a to obtain a recombinant plasmid, and the recombinant plasmid is transformed into E. coli BL21, and the protein recombinant expression strain is obtained by screening, which can be used for subsequent protein expression Figure 1 and Figure 2 ).

[0070] Specifically, the upstream and downstream primers are designed according to the coding region sequences of antigens BMEI1536*, BMEI0845* and BMEI0178*, and the BMEI1536*, BMEI0845* and BMEI0178* gene fragments are obtained by cutting and recovering.

[0071] The PCR recovery product and the plasmid pET-28a are digested with restriction endonuclease HindIII and NdeI, and the enzyme digestion product is purified by 1% agarose gel and recovered for standby.

[0072] The primer information and the PCR reaction system are shown in Tables 3 and 4.

[0073] Table 3 Primer sequence information

[0074]

[0075] Table 4 PCR system

[0076]

[0077] The recombinant plasmid construction and transformation method are as follows:

[0078] (1) 2 μL linearized pET-28a vector, 1 μL antigen fragment, 5 μL 2×ClonExpress Mix, 2 μL ddH2O are mixed by pipetting, and the reaction solution is collected at the bottom of the tube by centrifugation.

[0079] (2) 50℃ water bath heating for 5 min, immediately placed on ice to cool.

[0080] (3) The competent cells BL21 are thawed on ice.

[0081] (4) Take 10 μL recombinant product and add to 100 μL competent cells BL21, mix by tapping the tube wall, and stand on ice for 30 min.

[0082] (5) 42℃ water bath heat shock for 45 s, immediately placed on ice to cool for 2-3 min.

[0083] (6) Add 900 μL antibiotic-free LB liquid medium, 37℃, 200 rpm culture for 1 h.

[0084] (7) Kanamycin resistant LB solid medium containing 100 μg / mL concentration is preheated in 37 °C incubator.

[0085] (8) 5000 r / min centrifugation for 5 min, 900 μL supernatant is discarded. The bacterial body is resuspended with the remaining medium, and a sterile coating rod is used to evenly coat the plate containing kanamycin resistance.

[0086] (9) 37 °C, 200 r / min incubator for 12-16 h.

[0087] 4.3 Purification of immunoprotein recombinant expression strain

[0088] The LB medium containing 1‰ kanamycin is configured, and the recombinant expression strain prepared in 4.2 is inoculated at a ratio of 1:100. After 4 h of culture at 37 °C and 200 r / min, the inducer (IPTG) is added at a ratio of 1:1000. After overnight culture at 37 °C and 200 r / min on a shaker, the bacterial solution is centrifuged at 8000 rpm for 15 min, and the supernatant is discarded. The pellet is resuspended with PBS and washed three times. The resuspended bacterial solution is broken on an ultrasonic disrupter for 2 times, 15 min each time, until the bacterial solution is clear. The antigen protein is collected, purified by a nickel column and molecular sieve, and the purified products of three kinds of antigen proteins are obtained. The protein concentration is detected by BCA protein quantification kit.

[0089] Specifically, the protein purification steps are as follows:

[0090] (1) 5 mL of 20% alcohol is used to clean the purification column;

[0091] (2) 1.5 mL of filler is added to the purification column, and 3 column volumes of ultrapure water are used to clean the purification column with filler to remove alcohol;

[0092] (3) 2 column volumes of protein purification A solution (20 mM imidazole) are used to balance the purification column with filler;

[0093] (4) The protein solution is passed through the column 5 times;

[0094] (5) 50 mL of protein purification A solution (20 mM imidazole) per column is used to balance the purification column with filler;

[0095] (6) 30 mL of washing solution (50 mM imidazole) per column is repeatedly passed through the column 3 times;

[0096] (7) 30 mL of washing solution (100 mM imidazole) per column is repeatedly passed through the column 3 times;

[0097] (8) 5 mL of eluent (500 mM imidazole) eluted the target protein, and the column was repeatedly washed for 3 times;

[0098] (9) 20 mL of eluent (500 mM imidazole) washed the purification column;

[0099] (10) 20 mL of pure water washed the purification column;

[0100] (11) 20% alcohol 15 mL washed the purification column.

[0101] 5. Animal immunization and IL-17 detection

[0102] Ten experimental cattle were randomly divided into two groups, five of which were subcutaneously injected with Brucella vaccine A19, 6.0 x 10 10 CFU / each, and five of which were injected with normal saline as a control. Thirty days after immunization, all experimental cattle were collected with anticoagulant blood from the tail root vein, 2 ml / tube, and 100 μl of Brucella cell immune protein with a concentration of 1000 μg / ml was added to each tube, which was incubated at 37°C for 24 hours. The supernatant was collected by centrifugation, and the IL-17 level in the supernatant was detected by ELISA method.

[0103] The specific method of ELISA is as follows: (1) after equilibration at room temperature for 20 min, the required board strip was taken out;

[0104] (2) standard sample holes and sample holes were set, and 50 μL of different concentrations of standard sample was added to each standard sample hole;

[0105] (3) 50 μL of the sample to be tested was added to the sample hole, and no sample was added to the blank hole;

[0106] (4) except for the blank hole, 100 μL of horseradish peroxidase (HRP) labeled detection antibody was added to each of the standard sample hole and the sample hole, the reaction hole was sealed with a sealing film, and it was incubated in a constant temperature incubator at 37°C for 60 min;

[0107] (5) the liquid was discarded, and it was dried on a blotting paper, and each hole was filled with washing liquid (350 μL), and it was left for 1 min;

[0108] (6) PBST was washed, and it was dried on a blotting paper, and the plate was washed repeatedly for 5 times;

[0109] (7) 50 μL of substrate A and B was added to each hole, and it was incubated at 37°C for 15 min in the dark;

[0110] (8) 50 μL of termination liquid was added to each hole, and the OD value was measured at 450 nm within 15 min.

[0111] The concentration of all antigens and the corresponding induced IL-17 is shown in Table 3.

[0112] Table 3 IL-17 detection results after peripheral blood incubation with antigens

[0113]

[0114] Example 2 Screening of optimal protein concentration and incubation time

[0115] According to the parameters and methods in Example 1, the working concentration and processing time of the three brucellosis cell immune proteins BMEI0845*, BMEI0178* and BMEI1536* were adjusted for IL-17 concentration detection. The specific experimental grouping and detection results are shown in Tables 4-6.

[0116] Table 4 IL-17 detection results of different concentrations of BMEI0845* at different processing times

[0117]

[0118] Table 5 IL-17 detection results of different concentrations of BMEI0178* at different processing times

[0119]

[0120] Table 6 IL-17 detection results of different concentrations of BMEI1536* at different processing times

[0121]

[0122] As can be seen from Tables 4-6, the optimal concentration of the antigen protein BMEI0845* is 1000-1500 μg / ml, and the optimal incubation time is 24-40 hours, at which time the IL-17 concentration can reach 95.976-128.955 pg / ml; the optimal concentration of the antigen protein BMEI0178* is 800-1200 μg / ml, and the optimal incubation time is 40-48 hours, at which time the IL-17 concentration can reach 103.308-146.181 pg / ml; the optimal concentration of the antigen protein BMEI1536* is 800-1200 μg / ml, and the optimal incubation time is 32-48 hours, at which time the IL-17 concentration can reach 91.029-174.898 pg / ml; among the three antigen proteins, BMEI1536* has the best immunogenicity, and the IL-17 concentration produced by incubation with whole blood of the experimental cattle after immunization can reach 174.898 pg / ml.

[0123] Example 3 Detection of IL-17 level after immunization and challenge

[0124] According to the parameters in Example 1, the method, experimental cattle immunization, 30 days after immunization, challenge with sheep Brucella M28 bacteria liquid, 40 days after challenge, slaughter, and detect the tissue bacterial load and IL-17 concentration at different immunization times using the optimal conditions of BMEI1536* protein. The specific experimental results are shown in Table 7 and Table 8.

[0125] The preparation steps of the challenge bacteria liquid are as follows: the sheep Brucella M28 strain is streak inoculated on TSA medium, cultured at 37°C for 48 hours, and single colonies are picked and streaked on TSA plates, cultured at 37°C for 72 hours. TSB medium is added to the plates, soaked for 5 minutes, and then the colonies are washed off. The bacteria liquid is transferred to a 50ml centrifuge tube, sterile glycerol solution is added to a final concentration of 20% v / v, mixed and counted, and then stored in a -20°C refrigerator for standby. The counting plate is placed at 37°C for 72 hours, and the sheep Brucella M28 strain bacteria liquid is adjusted to 1×10 9 CFU / ml according to the counting results.

[0126] Table 7 Tissue bacterial load (CFU) and protection results (%) of experimental cattle after immunization and challenge

[0127]

[0128] Table 8 IL-17 detection results at different time points after immunization of experimental cattle

[0129]

[0130] As can be seen from Tables 7-8, the tissue bacterial load is used to evaluate the challenge protection results after Brucella vaccine immunization. 80% of the cattle are protected, and the corresponding challenge strain is not isolated from the tissue. The protection results of the corresponding cattle are consistent with the trend of IL-17 concentration. The cattle with high IL-17 concentration (971, 973, 974, 975) are protected and the challenge strain is not isolated; when the IL-17 concentration is low, the cattle are not protected and the challenge strain is isolated from the tissue, showing an infected state.

[0131] The above results show that the concentration of IL-17 can reflect the immune state of the animal body after Brucella vaccine immunization. The Brucella cell immune protein is prepared into a reagent for detecting the immunization level of Brucella vaccine, and the efficacy of vaccine immunization can be evaluated by detecting IL-17. Compared with the traditional method, it has higher safety and simplicity.

[0132] The application provides a brucellosis cellular immunity protein and a thought and method for application of the brucellosis cellular immunity protein. The method and approach for specifically realizing the technical scheme are various, and the above description is only a preferred embodiment of the application. It should be noted that, for ordinary skilled technicians in the technical field, several improvements and refinements can be made without departing from the principle of the application, and the improvements and refinements should also be regarded as the protection scope of the application. The components not explicitly described in the embodiment can be realized by using the prior art.

Claims

1. A brucellosis cellular immune protein, characterized in that, The brucellosis cell immune protein described herein is obtained by linking the reverse complementary sequence of the nucleotide sequence shown in SEQ ID No. 4 with any one of the gene sequences of antigens BMEI1536, BMEI0845, and BMEI0178, followed by recombination transformation, culture expression, and purification. The nucleotide sequence of BMEI1536 is shown in SEQ ID No.

1. The nucleotide sequence of BMEI0845 is shown in SEQ ID No. 2; The nucleotide sequence of BMEI0178 is shown in SEQ ID No.

3.

2. The brucellosis cellular immune protein according to claim 1, characterized in that, The brucellosis cell immune protein described above is obtained by recombinant transformation, culture expression, and purification after linking the reverse complementary sequence of the nucleotide sequence shown in SEQ ID No. 4 with the gene sequence of antigen BMEI1536. The nucleotide sequence of BMEI1536 is shown in SEQ ID No.

1.

3. The brucellosis cellular immune protein according to claim 1, characterized in that, The recombinant transformation involves synthesizing the fusion-expressed sequence into the expression vector pET-28a to obtain a recombinant plasmid, and then transforming the recombinant plasmid into the host strain BL21.

4. The use of the brucellosis cell immune protein according to any one of claims 1-3 in the preparation of a reagent for detecting the immune level of brucellosis vaccine.

5. The application according to claim 4, characterized in that, The specific testing steps are as follows: collect bovine blood samples after immunization, add brucellosis cell immune protein to them, collect the supernatant after incubation, and use ELISA to detect the concentration of IL-17 in the supernatant.

6. The application according to claim 5, characterized in that, The concentration of the brucellosis cell immune protein is 600-1500 μg / ml; the incubation conditions are: incubation at 37℃ for 16-48 h.

Citation Information

Patent Citations

  • Method and kit for evaluating whether cattle herd is immunized with brucellosis vaccine

    CN115508561A

  • Brucellosis DNA vaccine

    US20070224257A1