Aspergillus niger and method for preparing ginkgo leaf fermented feed using the same

Abstract

The application discloses an Aspergillus niger and a method for preparing ginkgo leaf fermented feed by using the Aspergillus niger, and the Aspergillus niger is classified and named as Aspergillus niger, and the strain number is Yx202103, and can be applied to the ginkgo leaf fermented feed. The Aspergillus niger strain of the application is used for fermentation of natural components of ginkgo leaves, so that the flavor of the ginkgo leaves is obviously improved, the probiotics are significantly amplified, the nutrition and active components are improved, and the feeding quality of the ginkgo leaves is improved.

Description

Technical Field

[0001] This invention relates to Aspergillus niger and a method for preparing fermented feed from Ginkgo biloba leaves, belonging to the field of microbial technology. Background Technology

[0002] In recent years, ginkgo leaves have been used in livestock and poultry farming, promoting intestinal absorption, growth, and immunity. As a feed additive, it has broad application prospects in the livestock and poultry sector. However, unfermented ginkgo leaves have poor flavor, high lignocellulose content, and low protein content, resulting in poor feed quality, especially for monogastric animals, where lignocellulose is an anti-nutritional component. Furthermore, existing ginkgo leaf fermentation methods use microorganisms, but often involve the addition of wheat bran, soluble starch, or flour, along with other additives. The microorganisms primarily utilize these added nutrients for growth, resulting in insufficient degradation of lignocellulose. The increase in protein and other nutrients is also based on the additives, not on the ginkgo leaves themselves. Currently, there is a lack of effective microorganisms for fermenting the natural components of ginkgo leaves. Therefore, this invention provides a *Aspergillus niger* strain that achieves fermentation without the need for any other additives in the fermentation substrate. The strain utilizes the natural components of ginkgo leaves for fermentation, decomposing and reducing the content of anti-nutritional components in ginkgo leaves, increasing protein, flavonoids, and other nutrients and active components, and improving the flavor of fermented ginkgo leaf feed. Summary of the Invention

[0003] To address the problems existing in the prior art, the present invention provides a *Aspergillus niger* strain and its application in fermented ginkgo leaf feed. The *Aspergillus niger* strain of the present invention utilizes the natural components of fermented ginkgo leaves for fermentation, which significantly improves the flavor of ginkgo leaves, significantly increases the number of probiotics, and enhances the nutritional and active components, thereby improving the feeding quality of ginkgo leaves.

[0004] To achieve the above objectives, the present invention adopts the following technical solution: a black mold, which is classified and named as Aspergillus niger, strain number Yx202103, and was deposited at the China Center for Type Culture Collection on February 13, 2023, with accession number CCTCC NO: M 2023117.

[0005] The Aspergillus niger Yx202103 of this invention was obtained by screening from the soil under ginkgo trees.

[0006] The application of Aspergillus niger Yx202103 of the present invention in fermented feed of Ginkgo biloba leaves.

[0007] The method for preparing fermented Ginkgo biloba feed using Aspergillus niger Yx202103 of the present invention comprises the following specific steps:

[0008] (1) Aspergillus niger Yx202103 was inoculated into an activation medium for activation to obtain activated Aspergillus niger Yx202103;

[0009] (2) The activated Aspergillus niger Yx202103 was then transferred into the fermentation medium for fermentation to obtain fermented Ginkgo leaf feed.

[0010] Preferably, in step (1), the activation medium is potato agar medium.

[0011] Preferably, in step (1), the activation temperature is 25~33℃ and the activation time is 4~6 days.

[0012] Preferably, in step (2), the amount of activated Aspergillus niger inoculated is 0.03% to 0.1% of the weight of Ginkgo leaf powder. If the inoculation amount is too small, it will prolong the fermentation production time and also affect the production efficiency and fermentation uniformity.

[0013] Preferably, in step (2), the fermentation medium consists of ginkgo leaf powder and water.

[0014] The particle size of the ginkgo leaf powder is 20-40 mesh.

[0015] Preferably, in step (2), the water content of the fermentation medium is 45-65%.

[0016] Preferably, in step (2), the fermentation is solid-state fermentation, and the thickness of the fermentation medium is 5-8 cm. If the thickness of the fermentation medium is too large, the lack of oxygen will result in insufficient aeration and incomplete fermentation of the ginkgo leaves.

[0017] Preferably, in step (2), the fermentation temperature is 25~31℃ and the fermentation time is 48~80h. If the temperature is too low, it will inhibit the growth of microorganisms, affect the fermentation efficiency, and cause uneven fermentation. If the temperature is too high, the microorganisms will grow faster and the fermentation cycle will be shortened accordingly. In the later stage of fermentation, flavonoids will be lost. Moreover, the higher the temperature, the faster the oxidation of flavonoids will be. Therefore, both too high and too low temperatures are unfavorable, affecting the component content of the fermented ginkgo leaf feed and also affecting the fermentation time.

[0018] Compared with existing technologies, the present invention utilizes *Aspergillus niger* strain Yx202103, deposited on February 13, 2023, at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M 2023117, to ferment ginkgo leaves. This significantly improves the flavor of ginkgo leaves and enhances their feeding quality. The resulting fermented ginkgo leaf feed contains 6 × 10⁻⁶ *Aspergillus niger* probiotics per dry portion. 7The product contains more than 100 cfu / g and various digestive enzymes produced by Aspergillus niger fermentation, which helps promote the absorption of nutrients in the intestines of livestock and poultry. The Aspergillus niger of this invention is fermented using natural components of Ginkgo biloba leaves. Compared with unfermented Ginkgo biloba leaves, the protein content is increased by more than 15% and the flavonoid content is increased by more than 10%, thereby improving the nutritional and active components.

[0019] Strain preservation information: The strain is classified as *Aspergillus niger*, strain number Yx202103, preservation date is February 13, 2023, the depositary institution is China Center for Type Culture Collection, accession number CCTCC NO: M 2023117, and the address of the depositary institution is Wuhan University, Wuhan, China, postcode 430072. Attached Figure Description

[0020] Figure 1 This is a picture of a single colony of Aspergillus niger Yx202103 after 36 hours of screening culture in this invention;

[0021] Figure 2 This is a picture of a single colony of Aspergillus niger Yx202103 after screening and culturing for 60 hours according to the present invention.

[0022] Figure 3 This is a scanning electron microscope image of Aspergillus niger Yx202103 spores of the present invention. Detailed Implementation

[0023] To provide a clearer and more complete description of the present invention, specific embodiments are described below, but these are not intended to limit the invention.

[0024] Unless otherwise specified, all materials and reagents used in the embodiments of this invention are commercially available. Experimental methods not specifically described in the embodiments are generally performed under standard conditions or as recommended by the manufacturer.

[0025] This invention provides a strain of *Aspergillus niger* Yx202103, which was deposited on February 13, 2023, at the China Center for Type Culture Collection (CCTCC), with accession number CCTCC NO: M 2023117. The 18S DNA sequence of this strain of *Aspergillus niger* Yx202103 is shown in SEQ ID No. 1, and is as follows: ccgggtttga ccagctttcc ggctctgggg ggtcgttgccaaccctcctg agccagtccg gaggcctcac cgagccattc aatcggtagt agcgacgggc ggtgtgtacaaagggcaggg acgtaatcgg cacgagctga tgactcgtgc ctactaggca ttcctcgttg aagagcaataattgcaatgc tctatcccca gcacgacagg gtttaacaag attacccagg cctctcggcc aaggtgatgtactcgctggc cctgtcagtg tagcgcgcgt gcggcccaga acatctaagg gcatcacaga cctgttattgccgcgcactt ccatcggctt gagccgatag tccccctaag aagccagcgg cccgcaaatg cggaccgggctatttaaggg ccgaggtctc gttcgttatc gcaattaagc agacaaatca ctccaccaac taagaacggccatgcaccac catccaaaag atcaagaaag agctctcaat ctgtcaatcc ttattttgtc tggacctggtgagtttcccc gtgttgagtc aaattaagcc gcaggctcca cgcctggtgg tgcccttccg tcaatttctttaagtttcag ccttgcgacc atactccccc cagaacccaa aaactttgat ttctcgtaag gtgccgagcgggtcattgta gaatcccgcc cgatccctag tcggcatagt ttatggttaa gactacgacg gtatctgatcgtcttcgatc ccctaacttt cgttccctga ttaatgaaaa catccttggc gaatgctttcgcagtagttagtcttcagca aatccaagaa tttcacctct gacagctgaa tactgacgcc cccgactatc cctattaatcattacggcgg tcctagaaac caacaaaata gaaccacacg tcctattcta ttattccatg ctaatgtattcgagcaaagg cctgctttga acactctaat tttttcacag taaaagtcct ggttcccccc acagccagtgaaggccatgg gattccccag aaggaaagga acggccggac agtactcgcg gtgaggcgga ccggccggccgaacccaagg ttcaactacg agctttttaa ctgcaacaac tttaatatac gctattggag ctggaattaccgcggctgct ggcaccagac ttgccctcca attgttcctc gttaagggat ttagattgta ctcattccaattacgagacc caaaagagcc ccgtatcagt atttattgtc actacctccc cgtgtcggga ttgggtaatttgcgcgcctg ctgccttcct tggatgtggt agccgtttct caggctccct ctccggaatc gaaccctaattccccgttac ccgttgccac catggtaggc cactatccta ccatcgaaag ttgatagggc agaaatttgaatgaaccatc gccggcgcaa ggccatgcga ttcgttaagt tattatgatt caccaaggag ccccgaagggcattggtttt ttatctaata aatacacccc ttccgaagtc gaggttttca gcatgtatta gctctagaattaccacaggt atccatgtag taaggtacta tcaaataaac gataactgat ttaatgagcc attcgcagtttcaccgtata aa

[0026] Example 1

[0027] I. Obtaining the original strain

[0028] 1. In 2021, soil samples were taken from under the ancient ginkgo trees in Taixing Ancient Ginkgo Forest Park. The samples were placed in clean sampling bags or bottles, clearly labeled, and stored at 4℃ for later use.

[0029] 2. Take 1g of prepared soil, add 100ml of sterile water, place in a clean bench and stir at room temperature for 20min, then let stand for 10min. Take the supernatant and dilute with sterile water, then spread the diluted solution on a red agar plate and incubate at 28℃±0.5℃ for 5~7d. Select single colonies that produce black spores and continue streaking to obtain a stable strain and pure culture of black Aspergillus. During the screening culture, after 36h of culture, white fluffy mycelium appears, and the mycelium color darkens thereafter. After 60h, black conidia are produced. The apical sac of the conidial head is spherical or nearly spherical, black, with double-layered pedicels of varying lengths, arranged radially. Based on the morphology of the strain, it is preliminarily identified as Aspergillus and the strain is named Yx202103.

[0030] In addition, during the strain screening process, the present invention also screened and obtained other pure culture strains, named strain Yx009, strain Yx026, strain Yx41, strain Yx58, and also screened Aspergillus niger with accession number CCTCC NO: M 2023117.

[0031] To determine the effect of strain Yx202103 on fermented ginkgo leaf feed, strains Yx202103, Yx009, Yx026, Yx41, Yx58, and Aspergillus niger (CCTCC NO: M 2023117) were used for fermentation of ginkgo leaves. Additionally, Asp. niger T8, Asp. niger T10, Asp. niger A, Asp. niger B, and Asp. niger C from the strain bank of Nanjing Forestry University were also selected for comparison. The fermentation temperature was 28℃, and the fermentation time was 60 h. Unfermented ginkgo leaves served as a control. Sensory evaluation, total flavonoids, crude protein, reducing sugar, and other nutritional analyses were performed on both fermented and unfermented ginkgo leaves. The results are shown in Table 1 below.

[0032] Table 1. Effects of different bacterial strains on Ginkgo leaf fermentation

[0033]

[0034] Note: g dw represents g of absolutely dried ginkgo leaves.

[0035] As shown in Table 1 above, the strain Yx202103 selected in this invention, when used in the fermentation of ginkgo leaves, imparts a sweet aroma to the fermented ginkgo leaves, and also results in higher levels of total flavonoids, crude protein, and reducing sugars. To better address the problems existing in the current technology of unfermented ginkgo leaves and existing microbial fermentation of ginkgo leaves, and to increase the protein, flavonoids, and other nutrients and active components of ginkgo leaves, thereby improving their flavor, this invention selects strain Yx202103 for use in fermented ginkgo leaf feed.

[0036] The red agar plate culture medium was sourced from Shanghai Shengsi Biotechnology Co., Ltd.

[0037] This embodiment further identifies the screened and cultured strain Yx202103 as follows:

[0038] II. Identification of strain Yx202103

[0039] A series of physiological and biochemical identifications were performed on the pure culture strain Yx202103, and DNA was extracted. The 18S DNA gene fragment was sequenced, with a sequence length of 1662 bp, as shown in SEQ ID NO.1. The 18S DNA sequencing results of the strain Yx202103 were compared with the BLAST results of NCBI. The results showed that the 1662 bp nucleotide fragment of strain Yx202103 had 100% homology with the corresponding nucleotide fragment of Aspergillus niger in GenBank. Based on the above results, the strain was identified as a strain of the genus Aspergillus niger, classified and named Aspergillus niger, with strain number Yx202103.

[0040] The Aspergillus niger strain, with strain number Yx202103, was deposited at the China Center for Type Culture Collection on February 13, 2023, with accession number CCTCC NO: M 2023117.

[0041] The Aspergillus niger Yx202103 described above can be applied to fermented feed made from ginkgo leaves.

[0042] Specifically, Examples 2 to 6 of the present invention provide a method for preparing Aspergillus niger for fermented feed from Ginkgo leaves:

[0043] Example 2

[0044] A method for preparing Ginkgo leaf fermented feed using Aspergillus niger, the specific steps of which are as follows:

[0045] (1) Pretreatment: First, crush the ginkgo leaves, filter them through a sieve, and take ginkgo leaf powder with a particle size of 20~40 mesh for later use;

[0046] (2) Preparation of fermentation medium: Ginkgo powder and tap water are mixed. The total water content of the mixture is 45 wt.%. The mixture is then sterilized at 120℃ for 15 min and cooled to obtain the fermentation medium.

[0047] (3) Activation of strain: Aspergillus niger Yx202103 was streaked into the activation medium - potato agar medium by an inoculation needle and activated at 25~33℃ for 4~6 days to obtain activated Aspergillus niger Yx202103;

[0048] (4) In a sterile room, the activated Aspergillus niger Yx202103 was transferred into a plastic mesh tray with a gauze bottom containing the fermentation medium at an inoculation amount of 0.05% of the weight of the ginkgo leaf powder. The thickness of the fermentation medium was 5 cm. The tray was covered with sterile gauze to allow air to circulate freely around the fermentation material. Solid fermentation was carried out at 25°C for 80 hours to obtain fermented ginkgo leaf feed.

[0049] Example 3

[0050] The preparation method of Aspergillus niger for fermented feed of ginkgo leaves is the same as in Example 2, except that the total water content of the mixed material is 50 wt.%, the activated Aspergillus niger Yx202103 is inoculated at 0.03% of the weight of ginkgo leaf powder, the thickness of the fermentation medium is 5 cm, the fermentation temperature is 28℃, and the fermentation time is 60 h.

[0051] Example 4

[0052] The preparation method of Aspergillus niger for fermented feed of ginkgo leaves is the same as in Example 2, except that the total water content of the mixed material is 55 wt.%, the activated Aspergillus niger Yx202103 is inoculated at 0.08% of the weight of ginkgo leaf powder, the thickness of the fermentation medium is 6 cm, the fermentation temperature is 27℃, and the fermentation time is 66 h.

[0053] Example 5

[0054] The preparation method of Aspergillus niger for fermented feed of ginkgo leaves is the same as in Example 2, except that the total water content of the mixed material is 60 wt.%, the activated Aspergillus niger Yx202103 is inoculated at 0.04% of the weight of ginkgo leaf powder, the thickness of the fermentation medium is 7 cm, the fermentation temperature is 30℃, and the fermentation time is 54 h.

[0055] Example 6

[0056] The preparation method of Aspergillus niger for fermented feed of ginkgo leaves is the same as that in Example 2, except that the total water content of the mixed material is 65 wt.%, the activated Aspergillus niger Yx202103 is inoculated at 0.1% of the weight of ginkgo leaf powder, the thickness of the fermentation medium is 8 cm, the fermentation temperature is 31℃, and the fermentation time is 48 h.

[0057] Comparative Example 1

[0058] The preparation method of Aspergillus niger for fermented feed of ginkgo leaves is the same as in Example 2, except that the total water content of the mixed material is 45 wt.%, the activated Aspergillus niger Yx202103 is inoculated at 0.05% of the weight of ginkgo leaf powder, the thickness of the fermentation medium is 5 cm, the fermentation temperature is 24℃, and the fermentation time is 86 h.

[0059] Comparative Example 2

[0060] The preparation method of Aspergillus niger for fermented feed of ginkgo leaves is the same as in Example 2, except that the total water content of the mixed material is 45 wt.%, the activated Aspergillus niger Yx202103 is inoculated at 0.05% of the weight of ginkgo leaf powder, the thickness of the fermentation medium is 5 cm, the fermentation temperature is 32℃, and the fermentation time is 48 h.

[0061] The control group consisted of unfermented ginkgo leaf powder.

[0062] The potato agar medium was sourced from Qingdao High-Tech Industrial Park Haibo Biotechnology Co., Ltd.

[0063] To verify the nutritional composition and other characteristics of Aspergillus niger Yx202103 of the present invention used in fermented ginkgo leaf feed, sensory evaluation and nutritional analysis were conducted. Specifically, unfermented ginkgo leaf powder was used as the control group, and selected...

[0064] This invention analyzed the nutritional content of Ginkgo biloba fermented feed prepared by fermenting Ginkgo biloba leaves with Aspergillus niger Yx202103 in Examples 2 to 6, as well as the unfermented Ginkgo biloba powder in the control group, and conducted sensory evaluation on Aspergillus niger probiotics, total flavonoids, crude protein, filter paper enzyme, reducing sugar, etc. The results are shown in Table 2.

[0065] Table 2. Nutritional composition and sensory evaluation of fermented Ginkgo leaf feed

[0066]

[0067] Note: g dw represents g of absolutely dried ginkgo leaves.

[0068] As shown in the table above, solid-state fermentation of ginkgo leaves using Aspergillus niger Yx202103 resulted in 6 × 10⁶ Aspergillus niger probiotics per gram of dry material. 7Ginkgo leaves fermented with cfu / g or higher and containing digestive enzymes produce a sweet aroma. Compared to unfermented ginkgo leaves, the protein content increases by more than 15%, and the flavonoid content increases by more than 10%, significantly improving the quality of fermented ginkgo leaf feed.

[0069] Finally, it should be noted that the above embodiments are only used to illustrate and not limit the technical solutions of the present invention. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the present invention without departing from the spirit and scope of the present invention. Any modifications or partial substitutions should be covered within the scope of the claims of the present invention.

Claims

1. A type of Aspergillus niger, characterized in that, The strain, named *Aspergillus niger*, with strain number Yx202103, was deposited at the China Center for Type Culture Collection (CCTCC) on February 13, 2023, with accession number CCTCC NO: M 2023117.

2. An application of Aspergillus niger according to claim 1 in fermented feed made from ginkgo leaves.

3. The method for preparing Ginkgo biloba leaf fermented feed using Aspergillus niger according to claim 2, characterized in that, The specific steps are as follows: (1) First, Aspergillus niger Yx202103 was inoculated into an activation medium for activation to obtain activated Aspergillus niger Yx202103; (2) The activated Aspergillus niger Yx202103 was then transferred into the fermentation medium for fermentation to obtain fermented Ginkgo leaf feed.

4. The method for preparing Ginkgo biloba leaf fermented feed using Aspergillus niger according to claim 3, characterized in that, The fermentation medium consists of ginkgo leaf powder and water.

5. The method for preparing Ginkgo biloba leaf fermented feed using Aspergillus niger according to claim 4, characterized in that, The water content of the fermentation medium is 45-65%.

6. The method for preparing Ginkgo biloba leaf fermented feed using Aspergillus niger according to claim 3, characterized in that, The amount of activated Aspergillus niger inoculated is 0.03% to 0.1% of the weight of Ginkgo leaf powder.

7. The method for preparing Ginkgo biloba leaf fermented feed using Aspergillus niger according to claim 4, characterized in that, The fermentation temperature is 25~31℃, and the fermentation time is 48~80h.

8. The method for preparing Ginkgo biloba leaf fermented feed using Aspergillus niger according to claim 4, characterized in that, The fermentation is solid-state fermentation, and the thickness of the fermentation medium is 5-8 cm.

9. The method for preparing Ginkgo biloba leaf fermented feed using Aspergillus niger according to claim 4, characterized in that, In step (1), the activation temperature is 25~33℃ and the activation time is 4~6 days.

10. The method for preparing Ginkgo biloba leaf fermented feed using Aspergillus niger according to claim 4, characterized in that, The activation medium is potato agar medium.

Images