Application of a tumor suppressor gene COTL1 in the preparation of drugs for the diagnosis and / or prognosis of clear cell renal cell carcinoma

Abstract

This invention provides the application of the tumor suppressor gene COTL1 in the preparation of drugs for the diagnosis and prognosis of clear cell renal cell carcinoma. This invention discloses the application of a novel tumor suppressor gene, COTL1, and its encoded protein, specifically designing the COTL1 gene and / or its encoded protein for the preparation of drugs against clear cell renal cell carcinoma; and the application of kits and methods for detecting the mRNA or protein levels of the COTL1 gene in drugs for the diagnosis and / or prognosis of clear cell renal cell carcinoma. This invention discovers that the COTL1 gene is a novel tumor suppressor gene, particularly playing an important role in the development and progression of clear cell renal cell carcinoma, providing new targets and methods for cancer diagnosis, prognosis, treatment, and drug screening.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, and in particular refers to the application of a tumor suppressor gene COTL1 in the preparation of drugs for the diagnosis and prognosis of clear cell renal cell carcinoma. Background Technology

[0002] Clear cell renal cell carcinoma is the most common malignant tumor of the kidney, accounting for 75-82% of primary kidney malignancies. In various clinical and genomic studies, clear cell renal cell carcinoma has been demonstrated to be a highly immune-infiltrating tumor and was one of the earliest tumors to be treated with immunotherapy. Because clear cell renal cell carcinoma is insensitive to conventional radiotherapy and chemotherapy, its treatment primarily relies on targeted therapy and immunotherapy. Targeted therapies include tyrosine kinase inhibitors, such as sunitinib and sorafenib. However, tumor heterogeneity, dynamic changes, and alterations in cell death-related signaling pathways in response to treatment significantly limit the application of targeted drugs in the treatment of clear cell renal cell carcinoma.

[0003] COTL1 is an actin-binding protein that binds to α-actin, β-actin, and f-actin. Furthermore, when interacting with 5-lipoxygenase (5-LO), COTL1 leads to increased 5-LO activity during the biosynthesis of pro-inflammatory leukotrienes. The role of COTL1 in cancer is paradoxical; it inhibits breast cancer growth but promotes glioblastoma growth in vitro and in vivo. Interestingly, COTL1 clearly exhibits both tumor-promoting and tumor-suppressing activities in lung cancer. Therefore, the role of COTL1 in clear cell renal cell carcinoma (KIRC) warrants further investigation. Summary of the Invention

[0004] To address the aforementioned technical problems, this invention provides the application of the tumor suppressor gene COTL1 in the preparation of drugs for the diagnosis and prognosis of clear cell renal cell carcinoma.

[0005] The first objective of this invention is to provide the application of the tumor suppressor gene COTL1 and its mutants in the preparation of medicaments for the diagnosis and / or prognosis of clear cell renal cell carcinoma.

[0006] In one embodiment of the present invention, the sequence of the tumor suppressor gene COTL1 is shown in SEQ ID NO.1.

[0007] In one embodiment of the invention, the drug further includes a pharmaceutically acceptable drug carrier.

[0008] In one embodiment of the present invention, the drug carrier includes one or more of the following: diluent, excipient, filler, binder, humectant, lubricant, disintegrant, absorption enhancer, surfactant, adsorbent carrier, flavoring agent, and sweetener.

[0009] In one embodiment of the present invention, the excipient comprises water; the filler comprises at least one of starch, sucrose, or lactose; the binder comprises at least one of cellulose derivatives, alginate, gelatin, or polyvinylpyrrolidone; the humectant comprises glycerin; the disintegrant comprises at least one of agar, calcium carbonate, or sodium bicarbonate; the absorption promoter comprises a quaternary ammonium compound; the surfactant comprises hexadecyl alcohol; the adsorbent carrier comprises at least one of kaolin or soap clay; and the lubricant comprises at least one of talc, calcium stearate, magnesium stearate, or polyethylene glycol.

[0010] In one embodiment of the present invention, the dosage form of the drug includes tablets, capsules, granules, pills, or oral liquids.

[0011] A second objective of this invention is to provide a real-time quantitative detection kit for the diagnosis and / or prognosis of clear cell renal cell carcinoma, comprising the tumor suppressor gene COTL1 and its mutants.

[0012] In one embodiment of the present invention, the real-time quantitative detection kit further includes at least one pair of primers for specifically amplifying the COTL1 gene, with the primer sequences being: upstream primer ATATGACGGCTCCACCAT and downstream primer AATTCTGTACGACCTCCTTC.

[0013] A third object of the present invention is to provide a pharmaceutical composition comprising the tumor suppressor gene COTL1.

[0014] A fourth object of the present invention is to provide the use of the pharmaceutical composition in the preparation of medicaments for the diagnosis and / or prognosis of clear cell renal cell carcinoma.

[0015] A fifth objective of this invention is to provide RNA interference target sequences for the tumor suppressor gene COTL1 as shown in SEQ ID NO.2 or SEQ ID NO.3. Interference targets: GTTTGTGATCAGTGATCGGAA (SEQ ID NO.2) and AGATTTCATCAAGAGCGAGCT (SEQ ID NO.3).

[0016] The sixth object of the present invention is to provide the application of the aforementioned RNA interference target sequence in the preparation of a drug for treating clear cell renal cell carcinoma.

[0017] In one embodiment of the invention, the drug further includes a pharmaceutically acceptable drug carrier.

[0018] In one embodiment of the present invention, the drug carrier includes one or more of the following: diluent, excipient, filler, binder, humectant, lubricant, disintegrant, absorption enhancer, surfactant, adsorbent carrier, flavoring agent, and sweetener.

[0019] In one embodiment of the present invention, the excipient comprises water; the filler comprises at least one of starch, sucrose, or lactose; the binder comprises at least one of cellulose derivatives, alginate, gelatin, or polyvinylpyrrolidone; the humectant comprises glycerin; the disintegrant comprises at least one of agar, calcium carbonate, or sodium bicarbonate; the absorption promoter comprises a quaternary ammonium compound; the surfactant comprises hexadecyl alcohol; the adsorbent carrier comprises at least one of kaolin or soap clay; and the lubricant comprises at least one of talc, calcium stearate, magnesium stearate, or polyethylene glycol.

[0020] In one embodiment of the present invention, the dosage form of the drug includes tablets, capsules, granules, pills, or oral liquids.

[0021] This invention used immunohistochemistry to discover that COTL1 expression is low in clear cell renal cell carcinoma (KIRC) compared to adjacent normal cells. Further investigation was conducted by knocking down COTL1 expression to explore its role in the proliferation, cloning, migration, and cell cycle of KIRC cells. First, PCR and Western blotting confirmed successful COTL1 knockdown, revealing that interfering with COTL1 expression inhibited the proliferation, cloning, and migration of KIRC cells. It was also found that interfering with COTL1 expression increased the cell cycle S phase. The relationship between COTL1 expression and tumor immune infiltration in KIRC was also assessed. The results demonstrate a close correlation between COTL1 and immune-infiltrating lymphocytes in KIRC.

[0022] The technical solution of the present invention has the following advantages compared with the prior art:

[0023] This invention is the first to demonstrate that COTL1 is a diagnostic marker for clear cell renal cell carcinoma, and the first to discover that COTL1 can serve as a molecular marker for the diagnosis and prognosis of clear cell renal cell carcinoma, as well as a target for therapeutic drugs. COTL1 can also serve as an immunotherapy target for clear cell renal cell carcinoma. Attached Figure Description

[0024] To make the content of this invention easier to understand, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings, wherein...

[0025] Figure 1 The present invention demonstrates that COTL1 is expressed at low levels in clear cell renal cell carcinoma tissue.

[0026] Figure 2The present invention describes the knockdown of COTL1 mRNA expression in clear cell renal cell carcinoma cells.

[0027] Figure 3 This invention relates to knocking down the expression of COTL1 protein in COTL1 clear cell renal cancer cells.

[0028] Figure 4 This invention knocks down COLT1 expression to promote cell proliferation in clear cell renal cancer cells.

[0029] Figure 5 This invention demonstrates the ability of knocking down COTL1 expression to promote the cloning of clear cell renal cancer cells.

[0030] Figure 6 This invention knocks down COTL1 expression to promote the migration ability of clear cell renal cell carcinoma.

[0031] Figure 7 This invention knocks down COTL1 expression, causing cycle arrest in clear cell renal cell carcinoma at the G1 phase.

[0032] Figure 8 This invention relates COTL1 to immune infiltration in clear cell renal cell carcinoma. Detailed Implementation

[0033] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments are not intended to limit the present invention. The reagents or kits used in the present invention are all commercially available products, and the detection methods are all conventional detection methods.

[0034] 1, SEQ ID NO.1:

[0035]

[0036]

[0037] 2. Interference targets: GTTTGTGATCAGTGATCGGAA (SEQ ID NO.2) and AGATTTCATCAAGAGCGAGCT (SEQ ID NO.3).

[0038] Example

[0039] 1. Immunohistochemistry

[0040] (1) Before dewaxing, the tissue chip should be baked in a constant temperature oven at 60°C for 30 minutes.

[0041] (2) The tissue chip was immersed in xylene for 15 minutes;

[0042] (3) Replace the xylene and soak for another 15 minutes;

[0043] (4) Soak in a 1:1 mixture of xylene and ethanol for 10 minutes;

[0044] (5) Soak in anhydrous ethanol for 10 minutes;

[0045] (6) Soak in 95% ethanol for 10 minutes;

[0046] (7) Soak in 85% ethanol for 10 minutes;

[0047] (8) Soak in 75% ethanol for 10 minutes;

[0048] (9) Soak in distilled water for 10 minutes;

[0049] (10) Prepare fresh 3% H2O2 with distilled water or PBS and block at room temperature for 10 minutes;

[0050] (11) Antigen retrieval: Heat 0.01M sodium citrate buffer solution (pH 6.0) in a microwave oven on high heat until boiling, then place the tissue chip in the microwave and maintain on low heat for 20 minutes;

[0051] (12) After naturally cooling to room temperature, soak in distilled water for 10 minutes;

[0052] (13) Block with 10% serum (prepared with TBS) for 30 minutes;

[0053] (14) Discard the serum, do not wash, add the corresponding primary antibody and incubate overnight;

[0054] (15) Recover the primary antibody and wash twice with TBS for 5 minutes each time;

[0055] (16) Add the secondary antibody and incubate at room temperature for 60 minutes;

[0056] (17) Wash with TBS 4 times, 5 minutes each time;

[0057] (18) Add VULCAN FAST RED CHROMOGEN kit2 and stain for 15 minutes, then stop;

[0058] (19) Add DAB staining until a light yellow color appears, then stop the reaction by placing it in distilled water;

[0059] (20) Stain with hematoxylin for 30 seconds, then place in distilled water to terminate the reaction;

[0060] (21) Dehydration and mounting: Immerse in 75% ethanol for 5 minutes;

[0061] (22) Soak in 85% ethanol for 5 minutes;

[0062] (23) Soak in 95% ethanol for 5 minutes;

[0063] (24) Soak in anhydrous ethanol for 5 minutes;

[0064] (25) Soak in a 1:1 mixture of xylene and ethanol for 5 minutes;

[0065] (26) Soak in xylene for another 5 minutes;

[0066] (27) Replace the xylene and soak for another 5 minutes;

[0067] (28) After removing it, add 30 μL of neutral resin and seal it with a coverslip;

[0068] (29) Dry the product, observe the results, and take photos. See the experimental results below. Figure 1 .

[0069] Depend on Figure 1 The results showed that COTL1 was expressed at a lower level in renal cell carcinoma tissue compared to adjacent tissue.

[0070] 2. PCR

[0071] (1) Cell inoculation: Renal clear cell carcinoma 786-0 and Caki-1 cells were inoculated in 35 mm petri dishes.

[0072] (2) Viral infection: COTL1 virus was used for infection, purine screening was performed, and stable transgenic strains were constructed. They were divided into control group NC and experimental groups shCOTL11# and shCOTL12#. The interference targets of COTL11# and shCOTL12# were GTTTGTGATCAGTGATCGGAA and AGATTTCATCAAGAGCGAGCT, respectively.

[0073] (3) Primer design: The accession number of COTL1 in the NCBI database is NM_021149.5, and the primer sequences are as follows: ATATGACGGCTCCACCAT (upstream primer); AATTCTGTACGACCTCCTTC (downstream primer).

[0074] (4) RNA extraction and reverse transcription. Experimental results are shown below. Figure 2 As shown in the figure, the expression level of COTL1 mRNA was detected by quantitative fluorescence detection. The results showed that the expression of COTL1 in the interference group was significantly reduced.

[0075] 3. Western blot

[0076] (1) Cell inoculation: Renal clear cell carcinoma 786-0 and Caki-1 cells were inoculated in 35 mm petri dishes.

[0077] (2) Viral infection: COTL1 virus was used for infection, purine screening was performed, and stable transgenic strains were constructed. They were divided into control group NC and experimental groups shCOTL11# and shCOTL12#.

[0078] (3) Protein extraction and BCA protein quantification.

[0079] (4) Protein electrophoresis, transfer to membrane, block, incubate with the corresponding primary and secondary antibodies, and develop.

[0080] (5) The results showed that COTL1 protein levels were significantly reduced in the interference group. See the experimental results below. Figure 3 .

[0081] 4. Cell proliferation

[0082] (1) After digesting the cells of each experimental group in the logarithmic growth phase with trypsin, the cells were resuspended in complete culture medium to form a cell suspension and counted.

[0083] (2) Determine the cell density for plating based on the cell growth rate (mostly 2000 cells / well), with 3-5 replicates per group, and determine the number of plates according to the experimental design (e.g., if the test is conducted for 5 days, then plating 5 96-well plates).

[0084] (3) After uniformly spreading the cells, observe the cell density of each experimental group under a microscope after the cells have completely settled. If the density is uneven, fix one group and adjust the amount of cells in other groups before spreading them again (e.g., if the Con group has more cells, reduce the amount of cells and spread them again). Place them in a cell culture incubator for culture.

[0085] (4) Starting from the second day after plating, add 20 μL of 5 mg / mL MTT to the well 4 hours before the end of the culture. No medium change is required.

[0086] (5) After 4 hours, completely remove the culture medium, being careful not to remove the formazan particles at the bottom of the well plate. Add 100 μL of DMSO to dissolve the formazan particles.

[0087] (6) Shake for 2-5 minutes, and detect the OD value at 490 / 570nm using an enzyme-linked immunosorbent assay (ELISA) reader.

[0088] (7) Data statistical analysis. Experimental results are shown in […]. Figure 4 .

[0089] Depend on Figure 4 The results showed that interfering with COTL1 expression increased the proliferation ability of clear cell renal cell carcinoma.

[0090] 5. Cell cloning

[0091] (1) Preparation of infected cells: The cells of each experimental group in the logarithmic growth phase were digested with trypsin, resuspended in complete culture medium, and made into cell suspensions for counting.

[0092] (2) Cell seeding: 400-1000 cells / well were seeded in each experimental group in a 6-well plate (the number of cells was determined according to the cell growth). Each experimental group had 3 replicates.

[0093] (3) Continue to culture the inoculated cells in an incubator until 14 days or until the number of cells in most individual clones is greater than 50. Change the medium every 3 days and observe the cell status.

[0094] (4) Before the experiment was terminated, the cell clones were photographed under a fluorescence microscope and the cells were washed once with PBS.

[0095] (5) Add 1 mL of 4% paraformaldehyde to each well, fix the cells for 30-60 min, and wash the cells once with PBS.

[0096] (6) Add 1000 μL of clean, impurity-free crystal violet staining solution to each well and stain the cells for 10-20 min.

[0097] (7) Wash cells several times with ddH2O, air dry, photograph with a digital camera, and count clones. See the experimental results below. Figure 5 .

[0098] Depend on Figure 5 The results showed that interfering with COTL1 expression promoted the proliferation and cloning ability of clear cell renal cell carcinoma.

[0099] 6. Cell migration

[0100] (1) Cell seeding: Cells were seeded in each experimental group, control group and interference group in a 6-well cell culture plate.

[0101] (2) Scratching: After the cells have grown to full size, use a fine tip to make a cross-shaped scratch.

[0102] (3) Taking photos: Photos were taken at a specified time. The experimental results are shown below. Figure 5 .

[0103] Depend on Figure 6 The results showed that interfering with COTL1 expression increased the migration ability of clear cell renal cell carcinomas 786-0 and Caki-1.

[0104] 7. Cell cycle

[0105] (1) Cell seeding: Control and interference group 786-0 and Caki-1 cells were seeded in 35 mm petri dishes.

[0106] (2) Sample preparation: Digest cells into single-cell suspension with trypsin, collect them into centrifuge tubes, control the total number of cells between 500,000 and 1,000,000, centrifuge at 1500 rpm at room temperature for 5 minutes, carefully remove the supernatant, add 1 mL PBS, pipette the cell pellet and transfer it to a sample drop tube, centrifuge again and remove the supernatant, leaving 50 μL of supernatant to avoid removing cells.

[0107] (3) Sample preparation: Add 100 μL of reagent A, mix gently without shaking, and let stand at room temperature for 10 minutes without discarding the supernatant; add 100 μL of reagent B, mix gently without shaking, and let stand at room temperature for 10 minutes without discarding the supernatant; add 150 μL of reagent C, mix gently without shaking, and let stand at room temperature for 10 minutes without discarding the supernatant.

[0108] (4) Loss analysis: At least 20,000 cells were collected from each sample, and red fluorescence at an excitation wavelength of 488 nm was recorded. The cell population to be analyzed was circled in the FSC / SSC plot. After removing sticky cells using FL2-W and FL2-A, the DNA histogram of the cells was analyzed using FL2-A. The results were analyzed using the automated software Modfit, and G0 / G1%, S%, and G2 / M% were calculated. The results showed that after interfering with COTL1 expression, the G1 phase of clear cell renal cell carcinoma increased, while the S and G2 phases decreased. Figure 7 ).

[0109] 8. Correlation analysis of immune infiltration

[0110] Using TIMER data, the correlation between COTL1 and the main immune infiltrating cells in clear cell renal cell carcinoma—B cells, CD8+ T cells, CD4+ T cells, macrophages, neutrophils, and dendritic cells—was analyzed. The experimental results are shown below. Figure 8 ,Depend on Figure 8 The results showed that COT1 was positively correlated with major immune infiltrating cells in clear cell renal cell carcinoma.

[0111] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. The application of a reagent for detecting the expression level of the tumor suppressor gene COTL1 in the preparation of a diagnostic drug for clear cell renal cell carcinoma, wherein the sequence of the tumor suppressor gene COTL1 is shown in SEQ ID NO.

1.

2. Application of a real-time quantitative detection kit in the preparation of diagnostic drugs for clear cell renal cell carcinoma, wherein the real-time quantitative detection kit includes primers for specifically amplifying the COTL1 gene, the sequence of which is shown in SEQ ID NO.

1.

3. The application according to claim 2, characterized in that: The primers include an upstream primer and a downstream primer, wherein the upstream primer is AATGACGGCTCCACCAT and the downstream primer is AATTCTGTACGACCTCCTTC.

Images