An insertion / deletion molecular marker for identifying resistance to scab in wheat and use thereof

By using insertion/deletion molecular markers and PCR electrophoresis at the 21,012,058 bp site on wheat chromosome 2D, the problem of unstable phenotypic identification in wheat scab resistance breeding was solved, enabling rapid and accurate genotypic selection and improving breeding efficiency.

CN116219053BActive Publication Date: 2026-04-28YANGZHOU UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202211242010.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-10-11
Publication Date
2026-04-28
Estimated Expiration
2042-10-11

AI Technical Summary

Technical Problem

Existing technologies for breeding wheat scab resistance suffer from problems such as unstable phenotypic identification, high workload, and low efficiency. Traditional breeding methods are difficult to quickly and effectively identify and eliminate susceptible genes.

Method used

Using insertion/deletion molecular markers combined with PCR and electrophoresis, genotype selection was performed at a 21,012,058 bp site on wheat chromosome 2D using specific primers. The genotypes of wheat resistance to Fusarium head blight were identified by PCR amplification and electrophoretic separation.

Benefits of technology

It enables rapid and accurate identification of wheat scab resistance, improves breeding efficiency, reduces the workload and time of manual identification, and has high stability and accuracy with a consistency rate of up to 91%.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116219053B_ABST
    Figure CN116219053B_ABST
Patent Text Reader

Abstract

The application belongs to the field of molecular biology, and particularly relates to an insertion / deletion molecular marker for identifying wheat resistance to scab and application thereof, wherein the insertion / deletion marker is located on a 2D chromosome of wheat; and a characteristic sequence of the insertion / deletion marker is 21 bp, and a nucleotide sequence is represented by AACGGCAAAGGCAGGAATACA (SEQ ID No. 1). The application uses PCR and electrophoresis technology to perform genotype selection on a wheat scab-regulating gene, so as to provide a marker for molecular marker-assisted breeding of wheat resistance to scab, and has the advantages of good stability, high accuracy and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology, specifically relating to an insertion / deletion molecular marker for identifying wheat resistance to Fusarium head blight and its application. Background Technology

[0002] Wheat, as one of the world's three major grains, has the largest planting area and widest distribution, accounting for 30% of global grain production, and its yield is crucial to global food security. Fusarium head blight (FHB) is a global wheat disease caused by Fusarium graminearum. The winter wheat region of the middle and lower reaches of the Yangtze River in my country is a frequent and severe area for FHB. In recent years, due to factors such as climate warming, returning corn stalks to the field, and wheat-corn rotation, the occurrence of FHB has become more frequent and its range has continued to expand, leading to a gradual increase in the severity of FHB in the northern winter wheat region. With global warming and changes in farming systems, the range of FHB outbreaks has continued to expand and the severity of the disease has increased year by year. High-intensity epidemics of FHB not only cause large-scale yield reductions (yield losses can reach over 70% in severely affected areas), but also seriously affect the processing and edible quality and seed value of wheat. Promoting the application of FHB-resistant wheat varieties is key to stabilizing and increasing wheat yields. Traditional breeding methods are basically based on direct selection of phenotypes, which has the disadvantages of unstable phenotypic identification, long cycle, large workload and low efficiency.

[0003] Through preliminary laboratory testing of recombinant inbred lines for Fusarium head blight inoculation and resistance locus analysis, a stable susceptible gene, Qfhbs-2D, was detected on chromosome 2D of the wheat variety Ning 7840. Eliminating susceptible variants during the breeding process can significantly improve the efficiency of resistance improvement.

[0004] In recent years, molecular biology has matured, and molecular techniques have been widely applied in breeding. Marker-assisted selection (MAG) can improve breeding efficiency and accelerate the breeding process. Identifying molecular markers closely linked to target traits is a prerequisite for MAG-assisted selection breeding. Insertion / deletion polymorphism (IPP) markers are molecular markers that amplify sequence length polymorphisms using polymerase chain reaction (PCR) based on specific primers designed around the insertion / deletion sites. IPP markers are not only abundant but also developed based on sequence differences, exhibiting stable variation and high accuracy, avoiding problems such as ambiguity in subsequent analyses caused by nonspecificity and complexity. Compared to SNP markers, IPP markers are simpler and easier to operate, allowing for direct genotyping using electrophoresis platforms. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of existing phenotypic identification techniques, such as large workload and instability, and to provide an insertion / deletion molecular marker for identifying wheat resistance to Fusarium head blight. By using PCR and electrophoresis techniques, genotypic selection is performed on wheat Fusarium head blight resistance regulatory genes to provide markers for molecular marker-assisted breeding of wheat resistance to Fusarium head blight. This invention has the advantages of good stability and high accuracy.

[0006] The technical solution adopted in this invention is:

[0007] An insertion / deletion marker for identifying wheat scab resistance, characterized in that the insertion / deletion marker is located at 21,012,058 bp on wheat chromosome 2D; the characteristic sequence of the insertion / deletion marker is 21 bp, and the nucleotide sequence is AACGCAAAGGCAGGAATACA (SEQ ID No. 1).

[0008] This invention also provides primers for the above-mentioned insertion / deletion markers for identifying wheat scab resistance, characterized in that the primer nucleotide sequences are as follows:

[0009] 2DS152-F: 5'-TATGAATCAGGCAGTTTGCCATT-3' (SEQ ID No. 2)

[0010] 2DS152-R: 5'-AATGCCTGATGAGAAGCTAACGG-3' (SEQ ID No. 3).

[0011] The present invention also provides the application of the above-mentioned insertion / deletion markers for identifying wheat scab resistance or the above-mentioned primers in wheat breeding.

[0012] The present invention also provides a method for breeding wheat resistant to Fusarium head blight, which involves detecting whether the germplasm to be tested possesses the insertion / deletion marker as described in claim 1, and breeding based on the detection results.

[0013] Furthermore, using the primers described in claim 2 to amplify the DNA of the plant to be tested, after the amplification product is subjected to polyacrylamide gel electrophoresis, the variety that amplifies to a 130bp band is the variety carrying the susceptible allelic variant; the variety that amplifies to a 151bp band is the variety carrying the resistant allelic variant.

[0014] Furthermore, the PCR amplification system was as follows: 5 μl template DNA, 0.4 μl each of 10 μmol upstream and downstream primers, 0.4 μl 10 mM dNTPs, 2 μl 10× PCR buffer, 0.1 μl rTaq enzyme, and 20 μl of ddH2O to supplement the reaction system.

[0015] Furthermore, the PCR reaction procedure was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 45 s, for 35 cycles; 72℃ extension for 5 min, and storage at 12℃.

[0016] Furthermore, the amplification products were separated by 3.5% agarose gel electrophoresis.

[0017] Furthermore, DNA was extracted from wheat leaves.

[0018] Further, the DNA extraction steps are as follows:

[0019] Tear the plant leaves into small pieces and place them in a 2mL centrifuge tube;

[0020] Add one grinding steel ball, tighten the cap, place it in liquid nitrogen for 60 seconds, and then grind it for 30 seconds using a grinding machine at a grinding frequency of 1400 r / min.

[0021] Add 1000 μl of 1.5% CTAB extraction solution to the ground sample, place it in a 70℃ oven, let it stand for 1 hour, and shake it once every 20 minutes.

[0022] Cool to room temperature, add 500 μL of chloroform, mix by inverting, balance and centrifuge at 12000 r / min for 5 min;

[0023] Add 600 μL of the supernatant to a new 1.5 ml centrifuge tube, add an equal amount of isopropanol, invert and mix 40 times, incubate at -20℃ for 1 h; balance and centrifuge at 12000 r / min for 5 min, then discard the supernatant.

[0024] Add 1 mL of 75% alcohol to wash, and let stand for 1 hour;

[0025] Balance the centrifuge at 12000 r / min for 5 min, discard the alcohol, remove excess liquid, and air dry at room temperature;

[0026] Add 400 μL of ddH2O, dissolve at room temperature for 30 min, and store at -20℃ for later use.

[0027] Based on the differences between the Ning7840 (carrying a susceptible allelic variant at the Qfhbs-2D locus) and Clark (carrying a resistant allelic variant at the Qfhbs-2D locus) sequences, an insertion / deletion marker for identifying wheat scab resistance was developed.

[0028] The sequence of the amplified product in the disease-carrying allelic variant Ning 7840 is as follows:

[0029] cggcaaagag tactttgccg ttagcttctc atcaggcaga cggcaatgtc tttgccgtcagccagtcttc atctttgtcg tctgcccaca aacccacaaa cggtaaagaa agtggtaaac ttttaaaaaa (SEQ ID No. 4).

[0030] The sequence of the amplified product in Clark, a variety carrying a disease-resistant allelic variant, is as follows:

[0031] cggcaaagag tactttgccg ttagcttctc atcaggcaga cggcaatgta acggcaaaggcaggaataca ctttgccgtc agccagtctt catctttgtc gtctgcccac aaacccacaa acggtaaagaaagtggtaaa cttttaaaaa a (SEQ ID No. 5).

[0032] Beneficial effects

[0033] Conventional phenotypic identification requires waiting 21 days after inoculation, and manual identification is labor-intensive and prone to errors. The phenotypic marker in the patent can distinguish resistance by genotype, saving a significant amount of manpower and time. This invention overcomes the limitation that the presence of susceptible loci cannot be visually identified from phenotypes, providing an insertion / deletion molecular marker for identifying scab-related loci in wheat. Using PCR and electrophoresis techniques, genotypic selection is performed on wheat scab resistance regulatory genes to provide markers for marker-assisted breeding of wheat scab resistance. Stable and clear bands were observed in a natural population of 544 varieties preserved in our laboratory, demonstrating advantages such as good stability and high accuracy. Attached Figure Description

[0034] Figure 1 This indicates the genotyping results of the molecular marker 2DS152 on some wheat varieties.

[0035] Figure 2 This indicates the association analysis between phenotypes and plants carrying disease-resistant and disease-susceptible genotypes. Detailed Implementation

[0036] The principles and features of the present invention are described below with reference to the accompanying drawings. The examples given are only for explaining the present invention and are not intended to limit the scope of the present invention.

[0037] Example 1

[0038] Application of insertion / missing markers

[0039] Genotypic identification of Fusarium head blight resistance in 130 wheat varieties was performed using the insertion / deletion marker 2DS152, followed by statistical analysis of the phenotypes. The specific steps are as follows:

[0040] 1. Extraction of DNA from Leaves

[0041] ① Take a plant leaf about 5cm long, tear it into pieces and put it into a 2mL centrifuge tube;

[0042] ② Add one grinding steel ball, tighten the lid, place it in liquid nitrogen for 60 seconds, and then grind it for 30 seconds using a grinding machine at a grinding frequency of 1400 r / min;

[0043] ③ Add 1000 μl of 1.5% CTAB extraction solution to the ground sample, place it in a 70℃ oven, let it stand for 1 hour, and shake it once every 20 minutes.

[0044] ④ Cool to room temperature, add 500 μL of chloroform, mix by inverting, balance and centrifuge.

[0045] 12000 r / min, 5 min.

[0046] ⑤ Take 600 μL of the supernatant and add it to a new 1.5 ml centrifuge tube. Add an equal amount of isopropanol, invert and mix 40 times, and let stand at -20℃ for 1 h. Balance the centrifuge at 12000 r / min for 5 min, and discard the supernatant.

[0047] ⑥ Add 1 mL of 75% alcohol to wash and let stand for 1 hour.

[0048] ⑦ Balance the liquid and centrifuge at 12000 r / min for 5 min. Discard the alcohol, remove excess liquid, and dry at room temperature.

[0049] ⑧ Add 400 μL of ddH2O, dissolve at room temperature for 30 min, and store at -20℃ for later use.

[0050] 2. PCR amplification and detection

[0051] The 20 μL PCR reaction system consists of: 5 μL template DNA, 0.4 μL each of 10 μmol upstream and downstream primers, 0.4 μL of 10 mM dNTPs, 2 μL of 10×PCR buffer, 0.1 μL of rTaq enzyme, and ddH2O to make up the remaining 20 μL of the reaction system.

[0052] The PCR reaction program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 45 s, for 35 cycles; 72℃ extension for 5 min, and storage at 16℃. The amplified products were separated by 3.5% agarose gel electrophoresis.

[0053] The primer nucleotide sequences are as follows:

[0054] 2DS152-F: 5'-TATGAATCAGGCAGTTTGCCATT-3' (SEQ ID No. 2)

[0055] 2DS152-R: 5'-AATGCCTGATGAGAAGCTAACGG-3' (SEQ ID No. 3).

[0056] Varieties that amplify to a 130bp band are those carrying the Fusarium head blight susceptibility allelic variant; varieties that amplify to a 151bp band are those carrying the Fusarium head blight resistance allelic variant.

[0057] 3. The genotypes of insertion / deletion markers in some varieties were statistically analyzed in conjunction with phenotypes. An independent samples t-test was used to analyze the phenotypic data, revealing that 60 varieties carried disease-resistant variants and 70 varieties carried disease-susceptible variants. For example... Figure 2 Plants carrying disease-resistant and disease-susceptible variants were significantly correlated with their phenotypes. The evaluation method for phenotypic data involved injecting the bacterial solution into the bilateral florets of the fifth spikelet from the top during the wheat flowering stage, inoculating 10-15 spikelets. The inoculation date was marked on the inoculated spikelets with adhesive tape. One week after inoculation, the inoculation status was checked; spikelets where the inoculation site remained unchanged were considered inoculated as failed and discarded. After 21 days, the number of diseased spikelets per spikelet was recorded, and the disease spikelet rate was calculated. Phenotypic resistance was graded according to the disease spikelet rate, ranging from 1 to 4 levels. Level 1: less than 25% of the total spikelets were diseased; Level 2: 25%-50%; Level 3: 50.1%-75%; and Level 4: more than 75.1%. Level 1 was highly resistant, Level 2 was moderately resistant, Level 3 was moderately susceptible, and Level 4 was highly susceptible. When the test result is 151bp, the variety can reach level 2 or below, that is, moderate resistance to Fusarium head blight.

[0058] 4. The above experiments have confirmed that detecting deletion sequences related to Fusarium head blight resistance allelic variations in wheat varieties using the 2DS152 insertion / deletion marker can identify Fusarium head blight resistance in wheat varieties and calculate the degree of agreement, which is the proportion of consistency between genotype and phenotypic identification results. For example, genotype identification indicates carrying disease-resistant variations, while phenotypic identification indicates moderate or high resistance to Fusarium head blight. The genotype identification results of the target population using the insertion / deletion marker showed a high degree of agreement with the actual field phenotypic identification results, reaching 91%, indicating that the marker is accurate and stable in identifying Fusarium head blight resistance in wheat varieties. In the natural population constructed in our laboratory, 76% of the varieties (lines) carrying susceptible variations were screened using this marker. Promoting this marker can eliminate varieties (lines) carrying susceptible variations at this locus when selecting breeding materials, effectively avoiding the disadvantage of traditional breeding where susceptible variations cannot be identified by the naked eye, while also greatly saving time and labor input.

Claims

1. The application of primers for identifying wheat resistance to Fusarium head blight in the breeding of wheat resistant to Fusarium head blight, characterized in that, The primer nucleotide sequence is as follows: 2DS152-F: 5'-TATGAATCAGGCAGTTTGCCATT -3'; 2DS152-R: 5'-AATGCCTGATGAGAAGCTAACGG-3'.

Citation Information

Patent Citations

  • SNP marker linked with wheat ear type character, CAPS marker capable of identifying wheat ear type, kit and method

    CN112852993A

  • Cultivation method for novel interspecific hybrid downy mildew resistant cucumis sativus variety and use thereof

    WO2020113979A1