Molecular marker related to length of millet awn and related biological materials and applications

Abstract

This invention discloses a molecular marker for the length of millet setae, related biomaterials, and applications. The technical problem this application aims to solve is how to provide a molecular marker related to the length of millet setae. This application provides the application of substances that detect the InDel molecular marker in identifying or assisting in the identification of millet setae length, preparing products for identifying or assisting in the identification of millet setae length, or in millet breeding or the preparation of millet breeding products. The length of millet setae is identified or assisted in the identification of the haplotype or genotype of the InDel molecular marker gene locus in the tested plant.

Description

Technical Field

[0001] This application specifically relates to molecular markers and related biomaterials and applications related to the length of millet bristles. Background Technology

[0002] Crop breeding has always been a top priority for crop scientists. However, with social development and the progress of human civilization, new breeding requirements are constantly being raised, such as yield, quality, stress resistance, and field performance. Many of these superior agronomic traits can only be directly identified in the later stages of crop growth, which increases the breeding cycle and consumes more time and resources, contradicting the basic principles and needs of modern crop breeding. Field phenotypic identification is time-consuming and labor-intensive, and phenotypes are easily affected by environmental factors to varying degrees. Furthermore, certain superior agronomic traits are often closely linked to genetic segments. Therefore, the development and utilization of relevant molecular markers have significant application value.

[0003] Compared to phenotypic identification, molecular markers offer better stability and heritability. Currently, molecular markers can be broadly categorized into three types: first, DNA marker technologies based on molecular hybridization, such as restriction fragment length polymorphism (RFLP); second, various DNA fingerprinting technologies based on polymerase chain reaction (PCR); and third, novel molecular markers, such as single nucleotide polymorphism (SNP), single-base transversions, transitions, insertions / deletions, etc. Molecular marker-assisted breeding has yielded numerous successes in many crops, such as the development of rice resistant to bacterial leaf blight, the high-yield and disease-resistant hybrid rice Guodao No. 1, and powdery mildew-resistant wheat varieties Zhengmai 835 and Zhengmai 863. New breeding systems for photosensitive forage sorghum varieties have also been established, and cotton varieties with improved fiber strength have been selected. Molecular marker-assisted breeding significantly shortens the breeding cycle, improves breeding efficiency, overcomes many difficulties in traditional breeding processes, promotes the progress of molecular precision breeding, and accelerates the development of the breeding industry. In addition, the new breeding requirements are not only reflected in crop yield, disease resistance, quality, plant type and field performance, but also in unprecedented attention to the abundance of crop genetic background.

[0004] Millet cultivation has been intertwined with the development of human civilization in the Yellow River basin of my country. For a long period, it served as a staple crop, reaching its peak during this time. Millet variety breeding began with the birth of this agricultural civilization, and the development of superior varieties, in particular, often involved a lengthy process. During this period, targeted breeding selection has resulted in an increasingly narrow genetic background for millet varieties, which does not meet the needs of future breeding development. Using relevant molecular markers can directly screen parents, enriching genetic diversity and alleviating the pressure of a narrowing genetic background. Molecular markers can also screen for indirectly related traits, assisting in the selection of desirable traits. However, while utilizing these genetic resources, traits that do not meet current breeding requirements may also emerge. For example, the length of the bristles is not a major factor affecting millet yield, but it increases the amount of work involved in ear appendages, harvesting, and processing. In particular, as an ear trait, it affects the aesthetic appearance of millet in the field, objectively reflecting the level of millet breeding.

[0005] During the domestication and breeding of millet, the bristles have become significantly shorter, especially in modern breeding where strong selection for shorter bristles is evident. Shorter bristles greatly improve the field appearance of millet varieties, reflecting significant progress in millet breeding. However, as a developmental structure of the panicle, the bristles only become prominent in the later stages of millet growth, prolonging the breeding cycle for superior varieties with shorter bristles. Therefore, developing, utilizing, and identifying molecular markers for bristle length / shortness can significantly shorten the breeding cycle and reduce breeding costs for varieties with superior short bristles. Summary of the Invention

[0006] The technical problem addressed by this application is how to identify or assist in the identification of the length of millet bristles.

[0007] To address the above problems, this application provides the following applications;

[0008] The application of InDel molecular markers or substances that detect said InDel molecular markers, wherein the InDel molecular marker is a DNA fragment with nucleotide sequence positions 764-872 of sequence 1:

[0009] A1) Application in identifying or assisting in the identification of the length of millet bristles;

[0010] A2) Application in the preparation of products for identification or auxiliary identification of the length of millet bristles;

[0011] A3) Applications in millet breeding;

[0012] A4) Application in the preparation of millet breeding products.

[0013] In this application, the bristles are ear bristles.

[0014] In the above applications, the substance used to detect the InDel molecular marker is P1 or P2;

[0015] P1 is any of the following:

[0016] A1) Detect the presence of AGCT tetrabase insertion material between positions 821 and 822 of SEQ ID No. 2 in the genome;

[0017] A2) Detect the presence of a tetra-AGCU intercalation between nucleotides 424-425 of the transcriptome shown in SEQ ID No. 3;

[0018] P2 is a substance for detecting haplotypes, and the haplotype is InDel (A1) on a chromosome of millet.

[0019] Sequence 2 (SEQ ID No. 2) is as follows:

[0020]

[0021] Sequence 3 (SEQ ID No. 3) is as follows:

[0022]

[0023] To address the aforementioned issues, this application also provides a product.

[0024] The product is P1 or P2;

[0025] The P1 is a substance containing the InDel molecular marker as described in claim 1 or 2, and may be any one of the following G1)-G3):

[0026] G1) Products that detect the InDel molecular marker;

[0027] G2) Products used for identification or auxiliary identification of the length of millet bristles;

[0028] G3) Products used in millet breeding;

[0029] The P2 is a substance containing the detection haplotype described in claim 2, or the substance containing the detection haplotype, and may be any one of J1)-J3) below:

[0030] J1) Products that detect InDel molecular markers related to the length of millet bristles;

[0031] J2) Products used for identification or auxiliary identification of the length of millet bristles;

[0032] J3) Products used for millet breeding.

[0033] To address the aforementioned issues, this application also provides a method for identifying or assisting in the identification of the length of the bristles on millet grains.

[0034] The method described is for identifying or assisting in the identification of the length of millet setae, including detecting the genotype of the InDel molecular marker in the millet to be tested, and identifying or assisting in the identification of the length of millet setae based on the genotype of the millet to be tested:

[0035] The length of the millet bristles of the homozygous genotype with an insertion of the tetra AGCT base between positions 821 and 822 of SEQ ID No. 2 is shorter than or candidate shorter than the length of the millet bristles of the homozygous genotype without an insertion of the tetra AGCT base between positions 821 and 822 of SEQ ID No. 2.

[0036] To address the aforementioned issues, this application also provides a method for identifying or assisting in the identification of the length of the bristles on millet grains.

[0037] The method is either A or B:

[0038] Method A is a method for identifying or assisting in the identification of the length of millet setae, including detecting the haplotype described in claim 2 in the millet to be tested, and identifying or assisting in the identification of the length of the millet setae based on the haplotype of the millet to be tested:

[0039] The length of the millet bristles in the homozygous genotype corresponding to haplotype SiBL1-1 is shorter than or candidate shorter than the length of the millet bristles in the homozygous genotype corresponding to haplotype SiBL1-2. Haplotype SiBL1-1 has an insertion of the tetrabase AGCT between nucleotides 821-822 in the region of SEQ ID No. 2 of the genome; haplotype SiBL1-2 does not have an insertion of the tetrabase AGCT between nucleotides 821-822 in the region of SEQ ID No. 2 of the genome.

[0040] Method B is used to detect whether there is an insertion of the AGCU tetrabase between nucleotides 424-425 of the transcriptome shown in SEQ ID No. 3.

[0041] In the above applications, products, or methods, the millet is a pure line or a self-pollinated line of millet.

[0042] The above methods are applied in millet breeding.

[0043] The breeding mentioned above can be either short bristle length breeding or long bristle length breeding of millet.

[0044] The short bristle length breeding involves selecting plants with bristle lengths shorter than the target millet variety. The long bristle length breeding involves selecting plants with bristle lengths longer than the target millet variety.

[0045] In the above-mentioned applications, products, methods, or other applications, products, or methods, the purpose of breeding includes cultivating or selecting millet with short bristles or long bristles.

[0046] In the above-described applications, products, methods, or other applications, products, or methods, the substance used to detect the InDel molecular marker is one of the following: D1), D2), D3), or D4):

[0047] D1) Contains in vitro nucleic acid amplification primers that specifically amplify the SiBL1 gene;

[0048] D2) An in vitro nucleic acid amplification reagent containing the in vitro nucleic acid amplification primers described in D1);

[0049] D3) A kit containing the in vitro nucleic acid amplification primers described in D1) or the in vitro nucleic acid amplification reagents described in D2);

[0050] D4) A detection instrument containing the in vitro nucleic acid amplification primers described in D1), the in vitro nucleic acid amplification reagents described in D2), or the kit described in D3).

[0051] In the above-mentioned applications, products, methods, or methods, the substance for detecting InDel molecular markers or genotypes, or the substance for detecting haplotypes, is as follows: D1), D2), D3), or D4):

[0052] D1) In vitro nucleic acid amplification primers containing specific amplification sites of InDel molecular markers;

[0053] D2) An in vitro nucleic acid amplification reagent containing the in vitro nucleic acid amplification primers described in D1);

[0054] D3) A kit containing the in vitro nucleic acid amplification primers described in D1) or the in vitro nucleic acid amplification reagents described in D2);

[0055] D4) Products containing the in vitro nucleic acid amplification primers described in D1), the in vitro nucleic acid amplification reagents described in D2), or the kits described in D3).

[0056] The in vitro nucleic acid amplification technology may be polymerase chain reaction (PCR), chain substitution amplification (SDA), ligase chain reaction (LCR), sequence-dependent amplification (NASBA), rolling circle amplification (RCA), loop-mediated isothermal amplification (lamp), helicase-dependent isothermal amplification (HDA), or Qβ replication technology.

[0057] This application uses polymerase chain reaction (PCR) as an amplification method to detect polymorphism.

[0058] In the above applications, methods, and products, the in vitro nucleic acid amplification primers may or may not be labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be linked to a nucleic acid. Markers include, but are not limited to, dyes; radioactive labels, such as 32P; binding moieties, such as biotin; haptens, such as digoxigenin (DIG); luminescent, phosphorescent, or fluorescent moieties; and fluorescent dyes alone or in combination with moieties whose emission spectra can be inhibited or shifted by fluorescence resonance energy transfer (FRET). The marker can provide a signal detectable by fluorescence, radioactivity, colorimetry, gravimetric determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moieties (positive or negative) or, optionally, charge-neutral. The marker can include nucleic acid or protein sequences or combinations thereof, provided that the sequence containing the marker is detectable. In some embodiments, nucleic acids are detected directly without labeling.

[0059] The in vitro nucleic acid amplification primers mentioned above can be the following primers:

[0060] SiBL1MK3-F:CGTTGCAGGTTGATAGGGA;

[0061] SiBL1MK3-R: CCAGGATGAGACGAGGTTG.

[0062] The millet may be at least one of the following:

[0063] Yugu1, Zhanggu, DQJ, A10, N10, L411L and L411S.

[0064] The millet described is a homozygous plant.

[0065] In the above applications, methods, and products, the substance may be a reagent and / or kit and / or instrument required to determine the InDel molecular marker or genotype by at least one of the following methods: in vitro nucleic acid amplification, DNA sequencing, restriction enzyme fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography, and InDel chips. InDel chips include chips based on nucleic acid hybridization reactions, chips based on single-base extension reactions, chips based on allele-specific primer extension reactions, chips based on one-step reactions, chips based on primer ligation reactions, chips based on restriction endonuclease reactions, chips based on protein-DNA binding reactions, and chips based on fluorescent molecule-DNA binding reactions.

[0066] Beneficial effects

[0067] This invention discloses long molecular markers for millet bristles and related biomaterials and applications.

[0068] First, this application identified a molecular marker related to the length of millet bristles through technical analysis. The genome contains an SNP with an insertion of a tetrabase AGCT between nucleotides 821-822 in the region of SEQ ID No. 2. Homozygous genotypes with the insertion exhibit shorter bristle length, while homozygous genotypes without the insertion exhibit longer bristle length.

[0069] Bioinformatics analysis revealed that the insertion / deletion of four bases at positions 425bp-428bp (i.e., the insertion of four bases at nucleotides 821-822 in the region of SEQ ID No. 2 of the aforementioned genome) in the coding gene (CDS) resulted in a frameshift mutation, completely altering the protein structure and severely affecting its function. Further investigation was conducted to explore the relationship between the insertion / deletion of these four bases in AGCT and the length of the bristles.

[0070] In this application, recombinant plasmids Cas9-MH-Target1 and Cas9-MH-Target2 were constructed and introduced into millet Ci846, respectively. SiBL1-CR#1, SiBL1-CR#2, and SiBL1-CR#3 were obtained, respectively. Compared with wild-type Ci846, the bristle length of SiBL1-CR#1, SiBL1-CR#2, and SiBL1-CR#3 was shorter. This demonstrates that knocking out the expression of the gene encoding the SiBL1 protein can reduce bristle length.

[0071] Furthermore, the recombinant vector Pro was constructed afterward. SiBL1 The SiBL1 (restoration vector) was introduced into SiBL1-CR#1 to obtain bristle length-restored plants (SiBL1-COM). Post-planting phenotype showed that the bristle length of the SiBL1-COM restored plants was restored, identical to the wild-type Ci846. This verifies the direct relationship between the presence or absence of the SiBL1 gene function and millet bristle length. In natural varieties, this is indicated by the presence of an AGCT tetrabase insertion between nucleotides 821-822 in the SEQ ID No. 2 region. Attached Figure Description

[0072] Figure 1 For genome-wide association analysis (GWAS), the main genetic loci for bristle development are located on chromosome 1. The horizontal axis represents the chromosome number, and the vertical axis represents the strength of the association signal.

[0073] Figure 2 This is for the chain imbalance analysis of the associated intervals.

[0074] Figure 3 SNP analysis within the 330Kb interval.

[0075] Figure 4 To analyze the differences in bristle length among different haplotypes, haplotype -1 / 2 represents two haplotypes with inserted AGCT and missing AGCT, respectively; the ordinate represents bristle length; P = 2.71E-06 < 0.01. The number of materials involved in the survey was 24, of which 5 were long bristle materials and 19 were short bristle materials.

[0076] Figure 5 The practicality of the molecular markers was validated for 24 cultivated varieties. Lanes 1-19 are insertion types (insertion of four bases of AGCT (109bp)), lane 20 is the marker lane, with the red arrow indicating the position of the 100bp band, and lanes 21-25 are deletion types (deletion of four bases of AGCT (105bp)). Detailed Implementation

[0077] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0078] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0079] The following examples used GraphPad Prism 8.0 statistical software to process the data. The experimental results are expressed as mean ± standard deviation. One-way ANOVA was used. P < 0.05 (*) indicates a significant difference, P < 0.01 (**) indicates a highly significant difference, and P < 0.001 (***) indicates a highly significant difference.

[0080] The biological material in Table 1 of Example 2 below is described in the following literature and its appendix: A haplotype map of genomic variations and genome-wide association studies of agronomic traits in foxtail millet (Setaria italica); published online 23 June 2013; doi:10.1038 / ng.2673.

[0081] Example 1: Discovery of Molecular Markers

[0082] We conducted a genome-wide association study (GWAS) using the bristle length phenotype of 916 millet accessions in the Beijing area, ultimately locating the locus highly associated with this trait on chromosome 1. Figure 1 ).

[0083] Linkage disequilibrium (LD) analysis further narrowed the interval containing this site to 330 kb. Figure 2 Near-isogenic group segregation analysis (BSA) revealed 1684 SNPs in this interval. To further identify SNPs affecting bristle elongation development, we analyzed SNPs in this interval from two other bred varieties, Zhang gu (long bristles) and Yu 1 (short bristles). Ultimately, 395 SNPs were identified as potential variation sites contributing to the differences in bristle length. Figure 3Based on the analysis of the strength of the associated signal, protein structural variation, and gene expression profile, we finally identified a major effector gene, Seita.1G316900, that influences the development of millet bristle length, which we named SiBL1.

[0084] Example 2: Confirmation of Molecular Markers

[0085] Haplotype analysis of the protein-coding sequences of this gene in 24 cultivated varieties revealed two haplotypes (Table 1). Both haplotypes exhibited an insertion / deletion of four AGCT bases at positions 425bp-428bp in the CDS sequence. Bioinformatics analysis showed that this insertion / deletion at 425bp-428bp resulted in a frameshift mutation, completely altering the protein structure and severely impacting its function. To further investigate the relationship between the insertion / deletion of the four AGCT bases and bristle length, the protein-coding sequences of this gene in Zanggu, A10, N10, L411L (long bristle phenotype) and Yugu1, DQJ, L411S (short bristle phenotype) were analyzed. The results showed that the insertion / deletion of the four AGCT bases in SiBL1 co-segregated with bristle length phenotypes. Furthermore, statistical analysis indicated a highly significant difference in bristle length between the two haplotypes. Figure 4 The insertion / deletion marker for the four bases of AGCT is referred to as InDe1-4bp. InDe1-4bp is positions 425-428 of SEQ ID No. 4.

[0086] Molecular marker primers SiBL1MK3-F (5'-CGTTGCAGGTTGATAGGGA-3') and SiBL1MK3-R (5'-CCAGGATGAGACGAGGTTG-3') were designed for insertion / deletion of four bases (AGCT) to identify the phenotype of millet spike bristles at the seedling stage. The feasibility of this molecular marker was verified by randomly selecting 24 millet cultivars (see below). The results showed that the marker could clearly distinguish between materials with bristle lengths. Figure 5 ).

[0087] Using the genomic DNA of millet leaves in Table 1 as templates, PCR amplification was performed using primer pairs composed of SiBL1MK3-F and SiBL1MK3-R to obtain PCR amplification products.

[0088] The PCR reaction program was as follows: 98℃ pre-denaturation for 5 min; 98℃ denaturation for 20 s, 55℃ annealing for 20 s, 72℃ extension for 10 s, 35 cycles; 72℃ for 10 min.

[0089] The PCR amplification products were subjected to 6% polyacrylamide gel electrophoresis. The results showed that the PCR products of millet numbered 1-24 in Table 1 were all DNA fragments of approximately 100 bp in size. These PCR products were recovered and sequenced. The results showed that the nucleotide sequences of the PCR products of millet numbered 1-19 were all at positions 764-872 of Sequence 1, i.e., the presence of the InDel molecular marker. In the genome of millet 1-19, there was an insertion of the AGCT tetrabase at positions 821-822 of SEQ ID No. 2 (and an insertion of the AGCU tetrabase at positions 424-425 of the transcript shown in SEQ ID No. 3). Its haplotype was named haplotype-1 (SiBL1-1), and its sequence characteristics are shown in Table 1. The PCR products of millet seeds numbered 21-25 all had nucleotide sequences with positions 764-868 of 2, meaning there was no InDel molecular marker. In the genome of millet seeds 21-25, there was no insertion of the AGCT tetrabase between positions 821-822 of SEQ ID No. 2 (there was no insertion of the AGCU tetrabase between positions 424-425 of the transcript product shown in SEQ ID No. 3). Its haplotype was named haplotype-2 (SiBL1-2), and its sequence characteristics are shown in Table 2.

[0090] The length of the ear bristles can be determined using the following method:

[0091] Remove the spikelets attached to the inflorescence, and use pointed tweezers to remove each bristle. Attach the bristles to double-sided tape pre-attached to A4 white paper. Carefully straighten the bristles with tweezers and measure them using calipers. The standard measurement is the straight-line distance from the base to the tip of the bristle. Measure five plants for each variety, and the average length is shown in Table 1.

[0092] The results showed that the average length of spikelet setae in millet haplotypes 1-19 (insertion type) was 5.15 ± 0.93 mm, while the average length of spikelet setae in millet haplotypes 20-24 (deletion type) was 8.76 ± 1.6 mm. Each material had five biological replicates. The spikelet setae length in millet haplotypes was significantly shorter than that in haplotypes with deletion (P = 2.70631E-06). This indicates that InDe1-4bp can be used to identify the length of spikelet setae in millet breeding materials.

[0093] Furthermore, the genome of material 1 in Table 1 was extracted, and this DNA was used as a template for PCR amplification using primers G4F1-1 (TCGTACAAGAGGCACAACA), G4R0-1 (TTCAATCTCCTGACCACCC), and PrimeSTAR HS DNA Polymerase with GC Buffer (catalog number: R044A). The PCR reaction program was: 98℃ for 3 min, (98℃ for 20 s, corresponding primer Tm value 20 s, 72℃ for 2 min 30 s) for 35 cycles, followed by 72℃ for 10 min, to obtain the DNA sequence of the gene from the corresponding material. After sequencing, using sequence 1 (SEQ ID No. 1) as a baseline, the sequence characteristics are shown in Table 1, consistent with the above results.

[0094] Sequence 1 (SEQ ID No. 1) is shown below:

[0095] ATGGAGGAGCAGCTGAGCCCGCTGGCGGTGACGCACCTGCTGCAGCACACGCTGCGCAGCCTCTGC

[0096] GGCCACGACGACGCGCAGTGGGTGTACGCCGTCTTCTGGCGGATCCTCCCCAGGAACTACCCGCCCC

[0097] CCAAGTGAGTCGTCGTCGTCGTCGTTCGCATGCGATCTGCGCTTGGCTCTTGCTTCTTCTCGTCGTCCT

[0098] CGATCGACGCTGCGTCTTGTTTGGGTTCTCGTGCTGATTTGTTTGTTTATCTCTATATCCCCTGTGTGTT

[0099] CAGATGGGATCTCCAGGGCGGCATCTACGACCGGACCAGAGGGAACAGGAGGAACTGGTACGGCCT

[0100] GAGACAAGTTATTCTTATTCCTCTTCAATTTCTTAGGGGTTAATTTGCGTTTGTTTGCACGTGATCCCTT

[0101] TCGGGGGTGCAACCGATTCCAGGATCCTGGCATGGGAGGATGGGTTCTGCAACTTCGCGGCCTCTGCT

[0102] TGTGACCACGAGGGCGCAGCTGCCCCTGCCGCCGCCGCCGCCTACACGGAGTGTGCCGCCGCGCAG

[0103] GAGGCCAAGCAGGGCCTGCAGCCCGAGCTCTTCTTCAAGATGTCCCACGACATCTACAACTACGGCG

[0104] AAGGGTAGGACACGACACCATGCTTGCTGCGGCTATTAGCTAGTCCATCGGTCGTGTCGCAACCTAAT

[0105] CGCAGCTTTCATTATAAACGGCTTTGATTTCATGCTAATCATCAAGCTTAACTTATCGCGGTCCCGTTGG

[0106] TGATGCATTTGTTTCGCGTTGCAGGTTGATAGGGAAAGTGGCAGCCGACCACAGCCACAAATGGGTG

[0107] TTCCAGGAGCTAGGCCCAGCAGCAGCAGGAGAACGAGATCAACCTCGTCTCATCCTGGAGCAACCCT

[0108] GCCGATTCTGTAAGCGTCTCCTTTTAGCCAACACATTAACATGTCACCCAACGCTTAGTTACATAACTA

[0109] GTGAACACCGGTGCTTCTTTGTCTGTGTGCGGTTGGTTTGCAGCATCCGAGGACATGGGAGGCGCAG

[0110] TTCCAGTCTGGTATCAAGGTAGAGCCCGTAGCTAAAACATGAAGAGTACCATTTGATGACTGAAAAAT

[0111] AGGAGCTCGATCAGCATGCCAAATAAAGCTGACCATGCACATCTTTTATCGCCATCTCTCTTGCAGACC

[0112] ATTGCCCTCATCGCCGTCAGAGAAGGCGTCGTGCAGCTTGGCTCCATGAAGAAGGTACCCTGACACT

[0113] GTTCCTCACCCACTCCACAACACTGCAGCGCGTGACGCACTGTGTGTGACTTGGTGTGCATCAGTGC

[0114] ATGCATGATTTTCGCAAATGTACCAGCAGCTCAGCTCAGCTTTGCATTTGCATGCATGCACGACAAGA

[0115] CGTACACGCTAATGTGTACGTGCGCACGGTCATGTGGTCTGACGAATTGTTGCGCGTGTCGATCTGGG

[0116] CTGCACCAACACGCAGGTGGCGGAGGACCTGAGCTACGTGGTGATGCTGCGCCGGAAGTTCGGATAC

[0117] CTGGAGAGCATCCCGGGGGTGCTGCTGCCGCACCCGTCGTCGGCCGCGTTCCCGGCGGCCGGGTGCG

[0118] CGGCCGTCATCGGCGGCCCCGCGGACGCCGCCGCCGCCTGCGGCTGGCCGCCGGGGCTCGTGCCGA

[0119] CGCCGATGGACCTCTACGACCCCTACGGCCAGGCAGCGGCGGCCGCCGCCGCCGCGGCGCAGATGCA

[0120] CATCGTGCCGTCGATGAGCAGCCTGGAGGCGCTGCTGTCGAAGCTGCCCTCGGTCGACCCCGCAGCC

[0121] GCCGGCAGCCTGGCGGCCACGATGATGGCCAAGGACGAGGCCGACGCCGCGGAGCGCGGCGAGTGC

[0122] CACGGCGGCGCGGCCGACGTCGCCGCGGGGTGCGGTGGCGAGGGCACCAGCGTTGCCGCCGCCGCC

[0123] GCCACTACTACTACTGCCGCCGCGGCGCCCTACTACATCAACGTGGCCAAGCCCAGCGAGGGCTTCTA

[0124] GTCCGTCCCGTCCCCGTCTCCGTCTCTCAAGTTGGCGCGTGCATGCGCCGATCAGCTAG

[0125] Furthermore, the PCR products were sequenced using three primers: G4F2 (CAGCTTTCATTATAAACGGC), G4R1-1 (CTACGGGCTCTACCTTGATA), and G4R2 (ACATCGCAACTACCACGC). Referring to the annotations of the introns in the Phytozome V13 database, the intron sequences were removed to obtain the cDNA sequence. cDNA sequence alignment analysis was performed using DNAMAN 6.0.3.99. Using sequence 4 (SEQ ID No. 4) as a baseline, the sequence characteristics are shown in Table 1, consistent with the results above.

[0126] Sequence 4 (SEQ ID No. 4) is shown below:

[0127]

[0128] Table 1. Relationship between haplotypes, gene sequences, cDNA sequences, and bristle length of millet inbred lines.

[0129]

[0130]

[0131] In summary, based on the characteristics of this gene, molecular markers can be designed and used to effectively identify the bristle trait of millet ears during the seedling stage, greatly shortening the breeding cycle. This also helps to enrich the selection diversity of breeding parents, promote breeding development, and improve the level of breeding.

[0132] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. The application of InDel-labeled substances in any of the following: A1) Application in determining the length of millet bristles; A2) Application in the preparation of products for identifying the length of millet bristles; A3) Application in millet breeding, the purpose of which is to cultivate or select millet with short bristles; A4) Application in the preparation of millet breeding products, the purpose of which is to cultivate or select millet with short bristles; The substance used to detect the InDel molecular marker is a substance that detects the presence of an AGCT tetrabase insertion between positions 821 and 822 of SEQ ID No. 2 in the genome; The length of the setae of homozygous millet with an insertion of the tetra AGCT base between positions 821 and 822 of SEQ ID No. 2 in the genome is shorter than that of homozygous millet setae without an insertion of the tetra AGCT base between positions 821 and 822 of SEQ ID No. 2 in the genome.

2. The application according to claim 1, characterized in that, The millet mentioned is a pure line or a self-pollinated line of millet.

3. A method for determining the length of the bristles on millet grains, characterized in that, The method includes detecting the genotype of the InDel molecular marker in the millet seed sample, and determining the length of the millet bristles based on the genotype of the millet seed sample: The length of the millet bristles of the homozygous genotype with an insertion of the tetra AGCT base between positions 821 and 822 of SEQ ID No. 2 is shorter than the length of the millet bristles of the homozygous genotype without an insertion of the tetra AGCT base between positions 821 and 822 of SEQ ID No.

2.

4. The method according to claim 3, characterized in that, The millet mentioned is a pure line or a self-pollinated line of millet.

5. The application of the method according to claim 3 or 4 in millet breeding, wherein the purpose of breeding is to cultivate or select millet with short bristles.

Images