Composition, kit and use thereof for detecting bladder cancer

Abstract

The present invention relates to the field of molecular biology detection, and more specifically, to the field of bladder cancer detection. The present invention provides a composition for detecting bladder cancer, comprising a detection reagent for detecting the methylation level of the following regions: the region shown in SEQ ID NO:1 in the SLC6A18 gene; the region shown in SEQ ID NO:2 in the HS3ST2 gene; and the region shown in SEQ ID NO:3 in the SIX6 gene. At the same time, a kit comprising the composition and the use of the composition are also provided. Bladder cancer can be detected clinically with high sensitivity and good specificity; in clinical practice, bladder cancer can be detected sensitively and specifically in the early stages.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biological detection, specifically, to the field of bladder cancer detection, and more specifically, to the detection of the methylation level of bladder cancer gene markers. Background Art

[0002] Bladder cancer (BC) is the tenth most common malignant tumor in the world. The diagnosis and postoperative follow-up of bladder cancer mainly rely on urine cytology, cystoscopy, urine tumor marker examination and imaging. Urine exfoliated cytology is one of the main methods for the diagnosis and postoperative follow-up of bladder cancer. It has the advantages of non-invasiveness, high specificity and non-invasiveness. However, the sensitivity of urine exfoliated cytology is related to the tumor grade. The positive rate of G3 and high-grade urothelial carcinoma and carcinoma in situ can be as high as 84%, while the sensitivity in G1 and low-grade tumors is only 16%. Urine cytology cannot detect the occurrence of early bladder cancer. Endoscopy is regarded as the gold standard for the diagnosis of bladder cancer, but ordinary cystoscopy is usually very painful for patients and has poor patient compliance. Painless cystoscopy still has the risk of anesthesia and high fees, and it also cannot avoid the risk of negative effects such as urinary tract infection. Conventional imaging (ultrasound, CT, MRI) has limited diagnostic ability for bladder carcinoma in situ and smaller tumors (<5mm), and is generally not used for early screening of bladder cancer and postoperative recurrence monitoring. FISH detection uses fluorescence in situ hybridization technology to detect the most common chromosome aberrations in bladder cancer to detect whether bladder cancer cells are present in urine. However, this detection method is cumbersome and expensive. It has a relatively low sensitivity for Ta and Tis stage tumors. Low tumor burden and the failure of tumor cells to shed may also affect sensitivity. It can only be used as a supplement to urine exfoliative cytology and cystoscopy. In addition, non-invasive urine marker detection methods for bladder cancer also include nuclear matrix protein 22 (NMP22), human bladder tumor antigen (BTA), fibrinogen and fibrin degradation products (FDP), and immunocytology (ImmunoCyt). However, these methods are not ideal in terms of sensitivity or specificity, and have high rates of missed diagnosis and misdiagnosis. They are difficult to meet clinical needs and have a low actual clinical application rate.

[0003] In recent years, based on molecular diagnostic technologies such as PCR and NGS, liquid biopsy has continued to develop and break through, and has become a powerful weapon for accurate early screening of cancer. From the perspective of the signal abundance and signal intensity of the marker, ctDNA methylation is a relatively ideal detection marker. Studies have shown that the phenomenon of increased methylation levels of tumor suppressor genes usually occurs in the early stages of cancer and is a hallmark change in the early development of tumors; in the CpG islands of the human genome, 60-80% of cytosine residues are methylated, and DNA methylation has become a common and abundant source of signals in early cancer screening; in addition, different types of cancer have their own unique DNA methylation patterns, which are highly organ-specific and can achieve tissue traceability. Therefore, ctDNA methylation is the mainstream detection indicator adopted by early screening companies at home and abroad.

[0004] There is an urgent need in this field for a more effective bladder cancer diagnostic product that can make early diagnosis of bladder cancer highly sensitive and specific, and be non-invasive and rapid. Summary of the invention

[0005] In view of this, the present invention provides a composition for detecting bladder cancer, the composition comprising a detection reagent for detecting the methylation level of at least two of the following regions:

[0006] The region of the SLC6A18 gene as shown in SEQ ID NO: 1;

[0007] The region of the HS3ST2 gene as shown in SEQ ID NO:2; and

[0008] The region of the SIX6 gene as shown in SEQ ID NO:3.

[0009] In some specific embodiments, the composition includes a detection reagent for detecting the methylation level in the following regions:

[0010] The region of the SLC6A18 gene as shown in SEQ ID NO: 1; and

[0011] The region of the HS3ST2 gene as shown in SEQ ID NO:2.

[0012] In some specific embodiments, the composition includes a detection reagent for detecting the methylation level in the following regions:

[0013] The region of the HS3ST2 gene as shown in SEQ ID NO:2; and

[0014] The region of the SIX6 gene as shown in SEQ ID NO:3.

[0015] In some specific embodiments, the composition includes a detection reagent for detecting the methylation level in the following regions:

[0016] The region of the SLC6A18 gene as shown in SEQ ID NO: 1; and

[0017] The region of the SIX6 gene as shown in SEQ ID NO:3.

[0018] In some specific embodiments, the composition includes a detection reagent for detecting the methylation level in the following regions:

[0019] The region of the SLC6A18 gene as shown in SEQ ID NO: 1;

[0020] The region of the HS3ST2 gene as shown in SEQ ID NO:2; and

[0021] The region of the SIX6 gene as shown in SEQ ID NO:3.

[0022] The region shown in SEQ ID NO: 1 in the SLC6A18 gene, the region shown in SEQ ID NO: 2 in the HS3ST2 gene, and the region shown in SEQ ID NO: 3 in the SIX6 gene are a sequence of the CpG island of the respective gene regions.

[0023] Specifically, the SEQ ID NO: 1 region of the SLC6A18 (Genbank accession number: NM_182632) gene is as follows:

[0024] GCCCTGACTGAGGCTGCCAGGGACAGGGCCCTCCTGGATGAGAGGTGGG

[0025] GCGGGGGCGGGTCCATGCCTGTGGTACGGAAGCGGGCCAGGCCAGGCCGG

[0026] CGGGTGGGGTGGCAGGGAGCCCTTGGGTGTGTGTGAGAAGCAGCGGTGA

[0027] CTCGGGGAGAATTAGAGATGGAGAACATGTGTGCCAGGACATCCCGGAA

[0028] GGACCTGGAAGCTGGTGTTGCCATTCACATGTGAGGTGTGAGGGAGGCCT

[0029] GGCTTTCAGCTGCGCCCTTCAGCATGTGTTATTTTATGTTGTTATTTTGTTTT

[0030] ATTCTCACTGCTTCTGGGCAGAGGGAGCTGGGAAGGAGCCCCGGGGCCA

[0031] CCTGACATGGTCCCTGTCCACAGGGCTGGGCTGTGTCACGCTGTCCTTCC

[0032] TGATCAGCCTGTACTACAACACCATCGTGGCGTGGGTGCTGTGGTACCTCCTCAACTCCTTCCAGCACCCGCTGCCCTGGA;

[0033] The SEQ ID NO:2 region of the HS3ST2 (Genbank accession number: NM_006043) gene is shown as follows:

[0034] GCTCCTCGACGCATCTTCAACATGTCCCGAGACACCAAGCTGATCGTGGT

[0035] TGTGCGGAACCCTGTGACCCGTGCCATCTCTGATTACACGCAGACACTCT

[0036] CCAAGAAGCCCGACATCCCGACCTTTGAGGGCCTCTCCTTCCGCAACCGC

[0037] ACCCTGGGCCTGGTGGACGTGTCATGGAACGCCATCCGCATCGGCATGTA

[0038] CGTGCTGCACCTGGAGAGCTGGCTGCAGTACTTCCCGCTAGCTCAGATTC

[0039] ACTTCGTCAGTGGCGAGCGACTCATCACTGACCCGGCCGGCGAGATGGG

[0040] GCGAGTCCAGGACTTCCTGGGCATTAAGAGATTCATCACGGACAAGCACTTCTATTTCAACAAGACCAAAGGATTCCCTTGCTTGAAAA;

[0041] SEQ ID of SIX6 (Genbank accession number: NM_007374) gene The NO:3 area is as follows: GGCCGTTGAGCCACCGCCGCCACCCGGTAGTGTGTCCCGCTGCCCCAATCCGCCTCATCAACAAGCGCCTGGCACACTCAGCCAGGCCCGCGGGCATCTGCTGCGTGTCCCGCTCCGGG CTCAGTGCCCTCGCCGCCGCCGGCACTGCCTCGATGTTCCAGCTGCCCATCTTGAATTTCAGCCCCCAGCAAGTGGCCGGGGTATGTGAGACCCTGGAAGAGAGCGGCGATGTGGAGCGCCTGGGTCGCTT CCTCTGGTCGCTGCCCGTGGCCCCTGCGGCCTGCGAGGCCCTCAACAAGAATGAGTCGGTGCTACGCGCACGAGCCATCGTGGCCTTTCACGGTGGCAACTACCGCGAGCTCTATCATATCCTGGAAAAC CACAAGTTCACCAAGGAGTCGCACGCCAAGCTGCAGGCGCTGTGGCTTGAAGCACACTACCAGGAGGCTGAGAAGCTGCGTGGAAGACCCCTGGGACCTGTGGACAAGTACCGAGTAAGGAAGAAGTTCC.

[0042] Using the composition of the present invention, bladder cancer can be predicted in tissues with a specificity of up to 0.953, a sensitivity of 0.964 and an area under the curve of 0.993, and bladder cancer samples can be detected in free DNA in urine with a sensitivity of up to 0.873, a specificity of 0.950 and an area under the curve of 0.965; the reagent combination of the present invention can detect bladder cancer with high sensitivity and specificity in clinical practice with fewer markers, saving both cost and time; clinically, bladder cancer can be sensitively and specifically detected in the early stages of malignant transformation.

[0043] In the present invention, "CpG island" is the abbreviation of cytosine (C)-phosphate (p)-guanine (G), which refers to some regions rich in CpG dinucleotides on the genome, with a length of 300 to 3000 bp.

[0044] In some embodiments, the detection reagent of the present invention can be used to detect the methylation level of a CpG island on a corresponding gene or a sequence on a CpG island present in a sample.

[0045] In the present invention, "sample" is a biological sample selected from an individual. Specifically, for example, selected from cell lines, histological sections, tissue biopsies / paraffin-embedded tissues, body fluids, feces, colon effluent, urine, serum, whole blood, isolated blood cells, cells isolated from blood, or a combination thereof.

[0046] Preferably, the "sample" of the present invention is urine, ie, free DNA in urine.

[0047] Free DNA in urine can be used to detect tumors, with the characteristics of little harm to patients and good specificity. However, due to its extremely low content in urine, there is a problem of low sensitivity. Using the detection reagent of the present invention, free DNA in urine can be used as a sample, and can be detected clinically with a sensitivity of 0.873, a specificity of 0.950 and an area under the curve of 0.965.

[0048] In the present invention, "detection reagent" refers to a reagent for detecting the methylation level of a gene in a sample, wherein the methylation level is measured by amplification-sequencing, chip, or methylation fluorescence quantitative PCR.

[0049] In some specific embodiments, the methylation level detection reagent can also be a detection reagent for detecting the average methylation level of a gene fragment.

[0050] In some specific embodiments, the methylation level detection reagent can also be a detection reagent for detecting one or more methylation sites within a gene segment.

[0051] In some specific embodiments, the detection reagents include, but are not limited to, nucleic acid primers and sequencing Tag sequences, for measuring methylation levels by amplification-sequencing.

[0052] In some specific embodiments, the detection reagent includes but is not limited to a chip, and the chip is a methylation chip, and the methylation chip has a probe that specifically binds to the methylation region. The chip can be, for example, but is not limited to, Agilent's Human CpG Island Microarrays and Human DNA Methylation Microarrays, Illumina's Infinium HumanMethylation27 BeadChip, Infinium HumanMethylation450BeadChip and GoldenGate Methylation Assay, and Roche NimbleGen's Human DNAMethylation 2.1M Deluxe Promoter Array, Human DNA Methylation Array, etc., for measuring methylation levels by chip.

[0053] In some specific embodiments, the detection reagents include, but are not limited to, nucleic acid primers and nucleic acid probes for measuring methylation levels by methylation fluorescence quantitative PCR.

[0054] The above reagent combination may also include other reagents, specifically, for example, various reagents required for pre-treatment or pre-processing of the sample, such as a sample release agent for extracting sample nucleic acid, a purification agent for purifying sample nucleic acid, bisulfite or bisulfite used for conversion, etc.

[0055] In a second aspect, the present invention provides use of the above reagent combination in preparing a kit for detecting bladder cancer.

[0056] Furthermore, the present invention provides use of the above reagent combination in preparing a kit for detecting bladder cancer using urine free DNA.

[0057] In a third aspect, the present invention provides a kit for detecting bladder cancer, the kit comprising the above-mentioned reagent combination. Further, the kit also includes but is not limited to at least one of a reagent for extracting nucleic acid, a reagent for purifying nucleic acid, and bisulfite.

[0058] Furthermore, the kit also includes a negative sample.

[0059] Specifically, the negative sample is human genomic DNA that has been sequenced to verify that there is no methylation of the target gene.

[0060] Furthermore, the reagents for extracting nucleic acid are reagents for extracting tissue DNA and reagents for extracting urine free DNA.

[0061] Furthermore, the reagent for extracting nucleic acid is a reagent for extracting free DNA in urine.

[0062] Furthermore, the kit also includes T4 polynucleotide kinase and T4 ligase.

[0063] Furthermore, the kit also includes dNTPs, Mg 2+ , at least one of a methylation-sensitive restriction endonuclease, a PCR buffer, and a hot-start enzyme. BRIEF DESCRIPTION OF THE DRAWINGS

[0064] Figure 1 The difference in methylation levels between the promoter and target regions of the HS3ST2 gene;

[0065] Figure 2 The difference in methylation levels between the target region and the nearby region of the SIX6 gene target region;

[0066] Figure 3 The difference in methylation levels between the target region and the region near the target region of the SLC6A18 gene. DETAILED DESCRIPTION

[0067] The present invention will be described in detail below in conjunction with specific embodiments and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific embodiments and examples are used to illustrate the present invention, rather than to limit the present invention.

[0068] Example 1: Screening of methylation genes

[0069] The present invention collects tumor methylation detection data from the TCGA data set (https: / / tcga.xenahubs.net) of the UCSC Xena website and the GEO database of the National Center for Biotechnology Information (NCBI). The bladder cancer and control data are used for differential analysis, and the physical location and gene information of the differential sites are annotated. To ensure that the screened fragments have consistent methylation levels, the screening of methylated gene fragments needs to meet the following requirements at the same time: 1) The selected gene fragments are required to have no less than 2 sites with relatively consistent methylation levels; 2) The bladder cancer and adjacent tissues or normal control tissues are used for differential analysis, and the methylated gene fragments with high consistency in the bladder cancer samples and high differences with adjacent tissues or normal tissues are selected; 3) The whole blood methylation detection data of bladder cancer and healthy samples are used for differential analysis, and the gene fragments with significant differences in methylation between the two are selected; 4) Finally, the methylation performance of each gene is analyzed from the segments that meet the above 3 points, so as to obtain candidate methylated genes.

[0070] Based on the modeling and analysis of tissue sample data, the CpG island regions of the three genes SLC6A18, HS3ST2, and SIX6 were selected as the best combination of detection targets, and the model and performance of the combination in detecting bladder cancer in urine free DNA were further verified.

[0071] Example 2: Sample preparation, library construction and candidate gene methylation level detection method

[0072] The samples were collected to detect and analyze the methylation levels of DNA methylation markers in the samples. The diagnosis of bladder cancer and healthy people was based on the final hospital pathological diagnosis. DNA extraction was completed in a timely manner, and the extracted nucleic acid was stored in a -80℃ refrigerator for future use. The experimental process is as follows:

[0073] 1. Sample preparation

[0074] The tissue sample nucleic acid extraction sampling TIANamp Genomic DNA Kit of the present invention is extracted according to the operating instructions. The urine sample DNA is extracted by QIAamp MinElute Virus Spin Kit. The extracted nucleic acid must meet the following quality control conditions: the total amount of extracted nucleic acid is greater than 20ng.

[0075] 2. Library preparation

[0076] In the present invention, all nucleic acids that have passed the quality control are treated with bisulfite using the EZ DNA Methylation-Lightning™ Kit (Zymo Research, Irvine, CA, USA). Subsequently, the sample DNA treated with bisulfite is used to construct a pre-library using a single-stranded library construction method. After the pre-library passes the quality inspection, the target region is captured and enriched by liquid chip hybridization to complete the construction of the final library.

[0077] Prelibrary construction steps: 1) Phosphorylation: T4 polynucleotide kinase phosphorylates the 5' end of the bisulfite-treated DNA. 2) SS1 ligation: T4 DNA Ligase (Rapid) ligates the SS1 adapter to the 5' end of the phosphorylated DNA. 3) Nucleic acid purification: Use 2 volumes of Agencourt AMPure XP system (Beckman CoμLter, CA, USA) to remove the remaining adapter. 4) SS2 ligation: T4 DNA Ligase (Rapid) ligates the SS2 adapter to the 3' end of the phosphorylated DNA. 5) Nucleic acid purification: Use 2 volumes of Agencourt AMPure XP system (Beckman CoμLter, CA, USA) to remove the remaining adapter. 6) Amplification: Use NEBNext Q5U Master Mix, primer1.0 (universal primer) and Bacard sequence to amplify the nucleic acid in the previous step. 7) Nucleic acid purification: Use 1.2 times the volume of Agencourt AMPure XP system (Beckman CoμLter, CA, USA) to remove primer dimers and excess primers. 8) Quality inspection: The purified pre-library is The dsDNA HS Assay Kit (Life Technologies, CA, USA) was used to quality check the total amount of the library, and the LabChip GXIITouch was used to quality check the fragment distribution of the library.

[0078] Chip (Twist Bioscience) hybridization capture steps: 1) Chip hybridization: Pre-vacuum concentrate the 1.5ug library that has passed the quality inspection into powder and then mix it with Panel, Hybridization Mix, Blocker Solution, Universal Blockers, and Hybridization Enhancer reagents (all reagents used for chip hybridization are provided by TwistBioscience), place it in a PCR instrument and incubate it at 70 degrees for 16 hours overnight (the hot cover temperature is 85 degrees). 2) Magnetic bead capture: Pre-wash the captured magnetic beads 3 times with Streptavidin Binding Buffer, add the hybridized product to the captured magnetic beads, incubate for 30 minutes, wash once with Wash Buffer I, wash 3 times with Wash Buffer 2, and finally elute with 42μl ultrapure water. 3) Amplification: Use KAPA HiFi HotStart ReadyMix and universal primers to amplify the captured library. , 4) Purification: Use 1 volume of Agencourt AMPure XP system (Beckman Company, CA, USA) to remove primer dimers and excess primers.

[0079] The purified library was used The dsDNA HS Assay Kit (Life Technologies, CA, USA) and LabChip GXII Touch were used to perform quality checks on the total nucleic acid amount, fragment distribution, and primer dimer ratio in the library.

[0080] 3. Sequencing

[0081] The libraries to be tested that have passed the quality inspection of the total amount of the library, the fragment size distribution of the amplified product, and the primer dimer ratio are mixed in a 1:1 ratio and used The mixed library was accurately quantified using the dsDNA HS Assay Kit (Life Technologies, CA, USA). The library was denatured and diluted and then sequenced using the NextSeq500 desktop sequencer using PE75.

[0082] 4. Establishment and evaluation of bladder cancer classification model

[0083] Cutadapt quality control software was used to remove the original fastq data connectors and low-quality sequences obtained by sequencing. After filtering the sequences, bismark methylation analysis software was used to align them to the reference genome to obtain the methylation level of each site in the captured segment, and the average methylation level of each candidate gene was further calculated.

[0084] Example 3: Determination of bladder cancer marker combination

[0085] Based on the collection of 64 clinically diagnosed bladder cancer tissue samples and 56 adjacent adjacent cancer control tissue samples, the methylation levels of each gene in the sample were detected according to the method described in Example 2. Based on the performance of different combinations of candidate gene methylation in the identification of bladder cancer and control samples, the methylation levels of SIX6, HS3ST2 and SLC6A18 gene fragments (SEQ ID 1-3) were finally confirmed as markers for detecting bladder cancer.

[0086] Table 1

[0087]

[0088]

[0089] The performance of different gene combinations is shown in Table 1. The optimal classification model constructed by SIX6, HS3ST2 and SLC6A18 genes had a sensitivity of 0.953, a specificity of 0.964 and an area under the curve of 0.993 in tissue samples, respectively.

[0090] Example 4: Results of testing clinical samples using the reagent combination of the present invention

[0091] Based on the collection of 66 urine samples from bladder cancer patients and 56 normal control samples of the same age group as the bladder cancer patient group. The diagnosis of bladder cancer is based on the final hospital pathological diagnosis. According to the method described in Example 2, the library is built, sequenced, and the methylation level of the target gene in the urine sample is calculated. The present invention finally determined that the combination of SIX6, HS3ST2 and SLC6A18 gene fragment methylation model is a marker for detecting bladder cancer through Logistics regression analysis of methylation data. The sample calculation score is obtained by the following calculation formula, and the score>0.5 is judged as positive:

[0092] Prediction score S = exp(prediction value A) / (1+exp(prediction value A)),

[0093] The predicted value A=x1+a1*SLC6A18+a2*HS3ST2+a3*SIX6; x1=10.966, a1=-8.416, a2=-10.631, a3=12.987, SLC6A18, HS3ST2, SIX6 represent the methylation level values ​​of each gene respectively.

[0094] Table 3

[0095] Gene combination Sensitivity Specificity AUC SLC6A18 0.810 0.9643 0.913 HS3ST2 0.804 0.963 0.942 SIX6 0.803 0.937 0.917 SLC6A18+SIX6 0.859 0.95 0.953 SIX6+HS3ST2 0.831 0.937 0.95 SLC6A18+HS3ST2 0.845 0.962 0.957 SLC6A18+SIX6+HS3ST2 0.873 0.950 0.965

[0096] Comparative Example 1: Comparison of performance of methylation detection samples at different gene positions of the present invention

[0097] The methylation level of the promoter region of the HS3ST2 gene was selected as a marker. Compared with the present invention's selection of a CpG site-enriched region of Exon2 of the HS3ST2 gene as a marker, the methylation differences and performances of the two in cancer and non-cancerous samples were different. Figure 1 As shown, the methylation levels in the promoter region and the Exon2 segment selected by the present invention in the HS3ST2 gene are inconsistent in cancer and healthy samples. In the clinical urine samples tested, the promoter region of the HS3ST2 gene was hypomethylated in healthy samples, and the methylation was increased in cancer samples, with a sensitivity of 0.703 and a specificity of 0.892 for distinguishing cancer and non-cancer samples; in the Exon2 target region, the healthy samples were hypermethylated, and the methylation was reduced in cancer samples, with a sensitivity of 0.804 and a specificity of 0.963 for distinguishing cancer and non-cancer samples, and the performance was better than the promoter.

[0098] We investigated whether the average methylation levels of CpG sites in the upstream segments of the selected target segments of SIX6 and SLC6A18 genes could be used as markers for detecting bladder cancer, and compared the methylation differences between cancer and non-cancerous samples. Figure 2 , Figure 3 As shown. Figure 2 As can be seen from the figure, the average methylation level of the upstream segment of the selected target segment in the SIX6 gene is different in cancer and non-cancerous tissues, but the difference in the target segment is more significant. Figure 3 It can be seen that the average methylation level of the CpG guide segment upstream of the selected target segment in the SLC6A18 gene does not have a significant difference in cancer and non-cancerous tissues, and is not suitable as a detection marker. The combined model constructed by the methylation levels of the three gene control segments of SLC6A18, SIX6, and HS3ST2 has a sensitivity of 0.773 and a specificity of 0.857 for distinguishing cancer and non-cancerous samples, which is inferior to the segment combination of the present invention.

Claims

1. A composition for detecting bladder cancer, characterized in that The composition includes the region of the SLC6A18 gene as shown in SEQ ID NO: 1; The region of the HS3ST2 gene as shown in SEQ ID NO:2; as well as At least two regions of the region shown in SEQ ID NO: 3 in the SIX6 gene are primers for targets, and the composition is used to detect the average methylation level of the target.

2. Use of the composition as claimed in claim 1 in preparing a kit for detecting bladder cancer.

3. The use according to claim 2, characterized in that: The kit is a kit for detecting bladder cancer using urine free DNA.

4. A kit for detecting bladder cancer, comprising the composition according to claim 1.

5. The kit according to claim 4, characterized in that The kit further comprises at least one of a reagent for extracting nucleic acid, a reagent for purifying nucleic acid or bisulfite.

6. The kit according to claim 5, characterized in that The kit also includes T4 polynucleotide kinase and T4 ligase.

7. The kit according to claim 5, characterized in that The kit also includes dNTPs, Mg 2+ , at least one of a methylation-sensitive restriction endonuclease, a PCR buffer, or a hot-start enzyme.

8. The kit according to any one of claims 5 to 7, characterized in that The reagent for extracting nucleic acid is a reagent for extracting free DNA in urine.

Images