Molecular markers linked to major QTL loci qGH15 and qGH06 for peanut plant type and their application

Abstract

The present invention provides molecular markers linked to the major peanut plant-type QTL loci qGH15 and qGH06, and their applications. The molecular markers are Arahy15.SNP and Arahy06.INDEL; the molecular marker Arahy15.SNP is linked to the QTL loci qGH15; the molecular marker Arahy06.INDEL is linked to the QTL loci qGH06. Genotyping in recombinant inbred line (RIL) populations and natural populations using the KASP and PCR methods of the present invention can distinguish upright or loosely upright from semi-running or running. Using this molecular marker-assisted selection can significantly improve the efficiency of selecting for plant-type traits in future generations.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular markers, and in particular to a molecular marker linked to a major effect QTL locus of peanut plant type and an application thereof. Background Art

[0002] Peanut plant types are divided into creeping, semi-climbing, upright loose and upright types. The peanut plant type determines the planting density, fruit concentration and growth period of peanuts, which has a direct impact on peanut yield and quality.

[0003] Cultivated peanut (Arachis hypogaea L.) is an allotetraploid (AABB). Its two wild diploid ancestors, A. dureansis (AA) and A. ipeansis (BB), are both climbing varieties. Peanut is native to South America, and cultivated varieties have four plant types. Due to different propagation routes, ecological conditions, and consumer habits, farm varieties grown in northern my country are mostly climbing or semi-climbing common varieties, while farm varieties grown in southern China are mostly upright pearl bean varieties. With the improvement of agricultural production levels and the development of multiple-cropping systems, the peanut varieties currently widely promoted in my country are all upright varieties. In contrast, due to the unique soil and climate conditions of the United States, as well as the need for mechanized planting and harvesting, most cultivated varieties are climbing or semi-climbing plants.

[0004] In recent years, in my country, efforts to cultivate high-oleic peanut varieties have often resulted in hybrid combinations in which high-oleic parents have adopted the creeping or semi-climbing genetic background of American peanuts, resulting in distinct plant types in the offspring. Furthermore, to broaden the genetic base of cultivated peanuts and fully utilize the superior genes of closely related wild peanut species, plant type segregation has also been observed in the offspring of cultivated-wild hybrids. The development of molecular markers for peanut plant type is crucial for marker-assisted selection, which can improve the efficiency of selecting for plant type traits in segregated offspring. Summary of the Invention

[0005] In view of the deficiencies of the prior art, the present invention aims to provide a molecular marker linked to the major effect QTL loci qGH15 and qGH06 of peanut plant type and its application.

[0006] In order to achieve the above object, the technical solution adopted by the present invention is:

[0007] Molecular markers linked to the major QTL loci qGH15 and qGH06 for peanut plant type, the molecular markers being Arahy15.SNP and Arahy06.INDEL;

[0008] The molecular marker Arahy15.SNP is linked to the QTL site qGH15; the molecular marker Arahy15.SNP can be amplified by the primers shown in SEQ ID NO.1 to SEQ ID NO.3;

[0009] The molecular marker Arahy06.INDEL is linked to the QTL site qGH06; the molecular marker Arahy06.INDEL can be amplified by the primers shown in SEQ ID NO.4 and SEQ ID NO.5.

[0010] A primer set for amplifying the molecular marker, the primer set consisting of a primer for the Arahy.15 chromosome KASP molecular marker Arahy15.SNP and a primer for the Arahy.06 chromosome PCR molecular marker Arahy06.INDEL;

[0011] The primer sequences of Arahy15.SNP are shown in SEQ ID NO.1 to SEQ ID NO.3;

[0012] The primer sequences of Arahy06.INDEL are shown in SEQ ID NO.4 and SEQ ID NO.5.

[0013] A reagent or kit containing the primer set.

[0014] The method for identifying peanut plant type using the molecular markers comprises the following steps:

[0015] (1) extracting genomic DNA from peanut samples to be tested;

[0016] (2) Genotyping the extracted genomic DNA using primers shown in SEQ ID NO.1 to SEQ ID NO.3; PCR amplification of the extracted genomic DNA using primers shown in SEQ ID NO.4 and SEQ ID NO.5;

[0017] (3) Based on the genotyping results and PCR amplification results, the peanut plant type was obtained.

[0018] The PCR reaction system includes: 4 μL of 5× buffer, 1.6 μL of 2.5 mM dNTP, 0.4 μL of 1.25 U / μL GXL DNA polymerase, 0.5 μL of 10 μM forward primer, 0.5 μL of 10 μM reverse primer, and 5 μL of 50 ng / μL genomic DNA.

[0019] PCR reaction conditions: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 10 s, annealing at 57°C for 15 s, extension at 68°C for 12 s, 35 cycles; extension at 68°C for 7 min.

[0020] The relationship between the genotyping results, PCR amplification results and peanut plant type is:

[0021] Arahy15.SNP Arahy06.INDEL Plant type A:A <![CDATA[C(ATT)5 or C(ATT)3 or C(ATT)4]]> upright or loose upright C:C <![CDATA[C(ATT)4 or C(ATT)5]]> upright or loose upright C:C <![CDATA[C(ATT)3]]> creeping or semi-climbing .

[0022] The application of the molecular marker primer set in peanut plant type identification.

[0023] The application of the reagent or kit in peanut plant type identification.

[0024] Beneficial effects of the present invention:

[0025] The present invention uses the wild-related peanut variety 9102 and the US high-oleic acid resource wt09-0023 as parents to construct segregating populations, locate QTLs for plant type, and develop molecular markers for identifying peanut plant type. Due to the large segregating population, chromosome exchange and gene locus recombination are sufficient, resulting in a rich variety of offspring variation. Two QTL loci, located on Arahy.15 and Arahy.06, respectively, were located. Combining these two, they can accurately identify upright and creeping plant types in peanut. Genotyping using the KASP and PCR methods of the present invention in recombinant inbred line (RIL) populations and natural populations can distinguish upright or loosely upright from semi-creeping or creeping. Using this molecular marker-assisted selection method can significantly improve the efficiency of selection for offspring plant type traits. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 The figure shows the genotype detection results using KASP primers for the molecular marker Arahy15.SNP.

[0027] Among them, the red dot in the upper left corner is the A:A genotype, the blue dot in the lower right corner is the C:C genotype, and the black dot in the lower left corner is the blank control; this KASP marker can accurately distinguish the two genotypes on Arahy.15. DETAILED DESCRIPTION

[0028] The specific embodiments of the present invention are further described in detail below with reference to the examples.

[0029] Example 1 Development of molecular markers and methods for identifying peanut plant types using molecular markers

[0030] 1. Development of molecular markers Using 521 recombinant inbred line families (RILs) derived from hybrids of Yuanza 9102 and wt09-0023, a genetic linkage map containing 5120 markers was obtained through simplified genome sequencing data of the population and parents. 10Using the ICIM-ADD model in the QTL IciMapping software, the multi-environment plant type phenotypes of the RIL population were mapped to two peanut plant type QTL loci, qGH15 and qGH06, located on chromosomes 15 and 6 of the Tifrunner reference genome, respectively. qGH15 is located between linkage groups 203.1 cM and 204.2 cM on LG15, with LOD values ​​ranging from 27.76 to 61.28 and a PVE greater than 20%. qGH06 is located between linkage groups A06.111949361 and A06.111980823 on LG16, with LOD values ​​ranging from 29.24 to 40.20 and a PVE range of 16.83% to 28.21%. Two molecular markers, Arahy15.SNP and Arahy06.INDEL, were designed based on the single nucleotide polymorphisms (SNPs) within the QTL interval.

[0031] Among them, the molecular marker Arahy15.SNP is linked to the QTL locus qGH15, and the molecular marker Arahy06.INDEL is linked to the QTL locus qGH06;

[0032] The molecular marker Arahy15.SNP was amplified using the primers shown in SEQ ID NO.1 to SEQ ID NO.3; the molecular marker Arahy06.INDEL was amplified using the primers shown in SEQ ID NO.4 and SEQ ID NO.5;

[0033] KASP primers for the molecular marker Arahy15.SNP:

[0034] KASP primer X: GTATTCCTTGACAATCTTTGGTGAGC (SEQ ID NO. 1);

[0035] KASP primer Y: GTATTCCTTGACAATCTTTGGTGAGA (SEQ ID NO. 2);

[0036] KASP primer common:CTTCCATGGAAGGAGACTCTCTCTT (SEQ ID NO.3);

[0037] PCR primers for the molecular marker Arahy06.INDEL:

[0038] Forward primer sequence: TGTTGCGGATGATGAGTGTT (SEQ ID NO. 4);

[0039] Reverse primer sequence: TGCCCTTCTTGTGAGACAAT (SEQ ID NO. 5).

[0040] 2. Methods for identifying peanut plant types using molecular markers

[0041] Extract genomic DNA from peanut samples to be identified, and perform genotyping of peanut samples to be identified using the primers shown in SEQ ID NO.1 to SEQ ID NO.3 using the Douglas genotyping platform ( Figure 1 ).

[0042] The extracted genomic DNA was amplified by PCR using primers shown in SEQ ID NO.4 to SEQ ID NO.5.

[0043] 20 μL PCR reaction system: 4 μL 5× buffer, 1.6 μL dNTP (2.5 mM), 0.4 μL GXL DNA polymerase (1.25 U / μL), 0.5 μL forward primer (10 μM), 0.5 μL reverse primer (10 μM), 5 μL genomic DNA of the peanut sample to be tested (50 ng / μL).

[0044] PCR reaction conditions: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 10 s, annealing at 57°C for 15 s, extension at 68°C for 12 s, 35 cycles; extension at 68°C for 7 min.

[0045] The PCR product was about 200 bp and the genotype was obtained after sequencing.

[0046] Figure 1 The KASP primer genotyping results for the molecular marker Arahy15.SNP are shown. The red dot in the upper left corner represents the A:A genotype, the blue dot in the lower right corner represents the C:C genotype, and the black dot in the lower left corner represents the blank control. This KASP marker accurately distinguishes the two genotypes.

[0047] Using the genotyping data of these two molecular markers, the upright or upright loose plant type can be distinguished from the creeping or semi-creeping plant type in segregating offspring or natural populations.

[0048] Among them, the peanut plant type with Arahy15.SNP genotype of “A:A” and Arahy06.INDEL genotype of C(ATT)5 or C(ATT)3 or C(ATT)4 was erect or loose erect;

[0049] Peanuts with Arahy15.SNP genotype of “C:C” and Arahy06.INDEL genotype of C(ATT)4 have an upright or upright loose plant type;

[0050] The peanut plant type of Arahy15.SNP genotype is "C:C" and the Arahy06.INDEL genotype is C(ATT)3 is creeping or semi-vine, as shown in Table 1 below.

[0051] Table 1 Relationship between molecular markers and peanut plant type

[0052] Arahy15.SNP Arahy06.INDEL Predict plant type A:A <![CDATA[C(ATT)5 or C(ATT)3 or C(ATT)4]]> upright or loose upright C:C <![CDATA[C(ATT)4 or C(ATT)5]]> upright or loose upright C:C <![CDATA[C(ATT)3]]> creeping or semi-climbing

[0053] Application Example 1 Identification of Recombinant Inbred Line (RIL) Populations

[0054] In 2021, the inventors planted peanuts of Yuanza 9102 and wt09-0023 in Yuanyang, Shangqiu and Nanyang, Henan Province. 10 A RIL population was selected from three stable peanut plant types, 110 upright plants and 55 creeping and semi-vine plants, from three environments. Genotype prediction was performed using the KASP and PCR molecular marker method described in Example 1. With the exception of samples P740, P366, and P316, all other peanut samples (upright versus semi-vine or creeping) could be distinguished, with a prediction accuracy of 98.18%. The results are shown in Table 2.

[0055] Table 2 Comparison of predicted and actual peanut plant types in the recombinant inbred line (RIL) population

[0056]

[0057]

[0058]

[0059]

[0060]

[0061] Two variation types were detected in the recombinant inbred line (RIL) population using the molecular marker Arahy06.INDEL: C(ATT)3 and C(ATT)5. The peanut plant type with the molecular marker Arahy15.SNP genotype of "C:C" and the Arahy06.INDEL genotype of C(ATT)3 was creeping or semi-creeping; the peanut plant type with the Arahy15.SNP genotype of "C:C" and the Arahy06.INDEL genotype of C(ATT)5 was erect, and the peanut plant type with the Arahy15.SNP genotype of "A:A" was erect.

[0062] There are two exceptions in Table 2. The reason is presumably that the molecular markers in this study are linked markers located to major effect QTLs, and there are other minor effect loci that regulate peanut plant type.

[0063] Application Example 2 Identification of Natural Populations

[0064] In 2021, the inventors selected 35 typical upright and upright loose peanut materials and 20 vine and semi-vine types from natural populations, including China's bred and approved varieties and foreign germplasm resources. The variety types include pearl bean type, common type, multi-grain type and intermediate type. Genotype prediction was performed using the KASP and PCR molecular marker method in Example 1. Except for sample PI159786 (rare genotype) and Yuhua No. 1 and 9 semi-vine materials, the remaining sample plant types can be distinguished, and the overall prediction accuracy is 80%. The results are shown in Table 3.

[0065] Table 3 Comparison of predicted and actual plant types of natural peanut populations

[0066]

[0067]

[0068]

[0069] According to the results of plant type molecular marker testing of 55 natural population samples (Table 3), four genotypes were detected using the Arahy06.INDEL molecular marker: C, C(ATT)3, C(ATT)4, and C(ATT)5. The Arahy15.SNP genotype "C:C" and the Arahy06.INDEL genotype C(ATT)3 were characterized by creeping or semi-creeping plant types. The Arahy06.INDEL genotype C(ATT)4 was characterized by an upright or loose upright plant type; and the Arahy15.SNP genotype "A:A" was characterized by an upright or loose upright plant type. These results are consistent with the predictions in Example 1. However, the Arahy15.SNP genotype "C:C" and the Arahy06.INDEL genotype C(ATT)5 are opposite to the above example 1. The predicted plant type should be upright or upright loose, but the actual plant type is semi-vine. It is speculated that this is because there are interaction sites in the natural population that are not found in the above RIL population, which affects the linkage effect of C(ATT)5.

[0070] In addition, for the individual exception sample Yuhua No. 1, the reason is speculated to be the same as that described in Application Example 1. The molecular marker of the present invention is a linkage marker located to the main effect QTL, and there are other minor effect sites that regulate the plant type of peanuts. The exceptional sample PI159786 has a genotype of "C:C" at the marker Arahy06.INDEL, which may be because the natural population has more allelic variations, and the RIL population does not cover the rare variation sites in the natural population. In fact, the vast majority (about 90%) of these materials with "deviations" in the predicted plant type are foreign varieties or Chinese farm varieties. There are indeed large genetic differences with modern improved varieties such as Yuanza 9102 and wt09-0023, the parents used for marker development, which supports the above speculation to a certain extent.

[0071] Based on the results in Tables 2 and 3, the molecular markers used in the present invention have an average accuracy rate of over 80% in predicting peanut plant type. Specifically, the Arahy15.SNP genotype "A:A" has a 98.1% accuracy rate for predicting an upright or upright loose plant type; the Arahy06.INDEL genotype C(ATT)4 has a 100% accuracy rate for predicting an upright or upright loose plant type; and the Arahy15.SNP genotype "C:C" and the Arahy06.INDEL genotype C(ATT)3 have a 96.9% accuracy rate for predicting a creeping or semi-vine type.

Claims

1. A method for identifying peanut plant type using a primer set, characterized in that: The primer set consists of a primer for the Arahy.15 chromosome KASP molecular marker Arahy15.SNP and a primer for the Arahy.06 chromosome PCR molecular marker Arahy06.INDEL; The primer sequences of Arahy15.SNP are shown in SEQ ID NO.1 to SEQ ID NO.3; The primer sequences of Arahy06.INDEL are shown in SEQ ID NO.4 and SEQ ID NO.5; The identification method includes the following steps: (1) Extracting genomic DNA from peanut samples to be tested; (2) Genotyping the extracted genomic DNA using primers shown in SEQ ID NO.1 to SEQ ID NO.3; PCR amplification of the extracted genomic DNA using primers shown in SEQ ID NO.4 and SEQ ID NO.5; (3) Determine the peanut plant type based on the genotyping results and PCR amplification results; The relationship between the genotyping results, PCR amplification results and peanut plant type is: 。 2. The method according to claim 1, wherein The PCR reaction system includes: 4 μL of 5× buffer, 1.6 μL of 2.5 mM dNTP, 0.4 μL of 1.25 U / μL GXL DNA polymerase, 0.5 μL of 10 μM forward primer, 0.5 μL of 10 μM reverse primer, and 5 μL of 50 ng / μL genomic DNA.

3. The method according to claim 1, wherein PCR reaction conditions: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 10 s, annealing at 57°C for 15 s, and extension at 68°C for 12 s, for 35 cycles; and extension at 68°C for 7 min.

4. An application of the primer set of claim 1 in identifying peanut plant types.

5. Use of a kit obtained by using the primer set of claim 1 in identifying peanut plant types.

Images