Hydroxylase mutants and their applications
By mutating specific amino acid regions of the hydroxylase eryF to regulate its activity, the problem of low efficiency in the conversion of 6-dEB to EB in erythromycin biosynthesis was solved, and efficient production of erythromycin A was achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
- Filing Date
- 2021-12-14
- Publication Date
- 2026-05-26
Smart Images

Figure BDA0003410912640000131 
Figure BDA0003410912640000141 
Figure BDA0003410912640000142
Abstract
Description
Technical Field
[0001] This invention relates to the field of biosynthesis, specifically to hydroxylase mutants and their applications. Background Technology
[0002] Erythromycin is an important macrolide antibiotic with broad biological activity, playing a vital role in clinical applications. Erythromycin biosynthesis involves two stages: polyketide nucleus formation and post-modification. First, one molecule of propionyl-CoA and six molecules of methylmalonyl-CoA condense under the action of 6-deoxyerythromycin B synthase to form the 14-membered macrolide 6-deoxyerythronolide B (6-dEB). The first post-modification step of the polyketide nucleus 6-dEB is the hydroxylation of 6-dEB by the enzyme eryF, catalyzing the formation of erythronolide B (EB). Subsequently, glycosyltransferases eryBV and eryCIII successively transfer the glycosyl donors TDP-L-mycarose and TDP-D-desosamine to C3 and C5 of EB, respectively, to synthesize the glycosylated product erythromycin D. Erythromycin D undergoes further hydroxylation and methylation at C12 and C3', respectively, to generate the final product erythromycin A (…). Figure 1 ).
[0003] In *E. coli*, the yield of polyketide-derived 6-dEB has been increased to 210 mg / L through various engineering strategies, including optimizing the supply of precursors propionyl-CoA and (2S)-methylmalonyl-CoA; high-density cell culture; transporter engineering; cofactor engineering; and systems metabolic engineering. Furthermore, in 2020, Marcellin's group introduced the Wood-Werkman cycle pathway, including methylmalonyl-CoA carboxyltransferase (MTC), propionyl-CoA:succinate transferase (PST), methylmalonyl-CoA mutase (MUT), and methylmalonyl-CoA epimerase (MCE) derived from *Propionibacterium acidipropionici*, into *E. coli*, constructing a pathway for 6-dEB synthesis using glucose as a carbon source, further expanding the ability of heterologous hosts to synthesize 6-dEB (Gonzalez-Garcia et al., 2020b; Gonzalez-Garcia et al., 2020a).
[0004] However, converting accumulated 6-dEB into the target product erythromycin A still faces significant challenges. Low post-modification efficiency, leading to metabolic flux loss and byproduct formation, is a major contributing factor. Early studies found that inactivating the P450eryF encoding gene did not affect downstream post-modification reactions of *Saccharopolyspora erythraea*, but instead generated erythromycin derivatives lacking the C6 hydroxyl group. Furthermore, in vitro enzyme activity assays revealed that the glycosyltransferase eryBV can selectively utilize 6-dEB as a substrate to generate 3-O-α-mycarosylerythronolide B (MEB) analogs. Since EB determines whether 6-dEB is directed towards erythromycin or its analogs, it is a crucial node controlling the metabolic flux of 6-dEB for erythromycin biosynthesis. Therefore, increasing EB yield is of paramount importance for erythromycin biosynthesis.
[0005] The hydroxylation of 6-dEB is catalyzed by P450eryF. Many studies exploring the structure-function relationship between P450eryF and steroid compounds have built upon previously obtained crystal structures and achieved through engineering modifications. However, the influence of active site residues related to substrate binding and oxidation processes on the substrate 6-dEB has not yet been investigated or developed for use. Summary of the Invention
[0006] This invention provides the eryF mutant to regulate the production of EB or its byproducts.
[0007] The present invention first provides a mutant protein derived from Saccharopolyspora erythraea, Actinopolyspora erythraea, or Aeromicrobium erythreum hydroxylase eryF, which has one, two, three or more mutations in amino acids selected from the following regions: hydrogen bond network region, substrate binding pocket region, TTT region and β11 region.
[0008] In one or more embodiments, the mutant protein has the sequence of any one of SEQ ID NO:1-3 or a sequence having at least 90% sequence identity with it, and has one, two, three or more mutations in amino acids selected from the following regions: hydrogen bond network region, substrate binding pocket region, TTT region and β11 region.
[0009] In one or more embodiments, the amino acids in the hydrogen bond network region include E244 and E360 of SEQ ID NO:1, or the amino acids at the corresponding positions of SEQ ID NO:2 or 3.
[0010] In one or more embodiments, the amino acids in the substrate binding pocket region include T92, I174, L175, V237, L391, N89, and A74 of SEQ ID NO:1, or the amino acids at the corresponding positions of SEQ ID NO:2 or 3.
[0011] In one or more embodiments, the amino acids in the TTT region include K162, Y163, G165 and E166 of SEQ ID NO:1, or the amino acids at the corresponding positions of SEQ ID NO:2 or 3.
[0012] In one or more embodiments, the amino acids in the β11 region include S376, G378 and I379 of SEQ ID NO:1, or the amino acids at the corresponding positions of SEQ ID NO:2 or 3.
[0013] In one or more embodiments, the mutant protein has one, two, three or more mutations at the positions selected from the following in SEQ ID NO:1 or the corresponding positions in SEQ ID NO:2 or 3: E244, E360, T92, I174, L175, V237, L391, N89, A74, K162, Y163, G165, E166, S376, G378, I379. In one or more embodiments, the mutant protein has mutations at the positions selected from any of the following groups: (1) I379, A74, (2) I379, G165, (3) I379, G165, A74.
[0014] In one or more embodiments, the mutant protein has one or more mutations selected from the following: A74F, L175I, K162G, G165S, Y163K, E166D, S376H, G378A, I379V, I379T, N89Q, L391I. More preferably, the mutant protein has mutations selected from any one of the following groups: (1) I379V, A74F, (2) I379V, G165S, (3) I379V, G165S, A74F.
[0015] In one or more embodiments, the mutant protein has one or more mutations selected from the following: E244D, E360D, T92S, I174L, I174V, L175V, V237L, V237I, L391V, K162R, L377_(ΔL377).
[0016] The present invention also provides a nucleic acid molecule comprising a sequence selected from the following:
[0017] (1) The coding sequence of the mutant protein described in the first aspect of this article or a fragment thereof used as an amplification primer or detection probe.
[0018] (2) A degenerate variant that has at least 80% sequence identity with (1),
[0019] (3)(1) or (2) complementary sequences.
[0020] Preferably, the encoded sequence is as shown in any of SEQ ID NO:4-6.
[0021] In another aspect, the present invention provides a nucleic acid construct comprising the nucleic acid molecule described in any embodiment herein.
[0022] In one or more embodiments, the nucleic acid construct is a cloning vector, an expression vector, or an integration vector.
[0023] In another aspect, the present invention provides a host cell, said host cell:
[0024] (1) Containing, expressing, and / or secreting the mutant protein described in any embodiment of the first aspect of this document, and / or
[0025] (2) Includes nucleic acid molecules and / or nucleic acid constructs as described in any of the embodiments herein.
[0026] In one or more embodiments, the host cell also expresses 6-deoxyerythromycin B synthase (DEBS).
[0027] In one or more embodiments, the cells also express the pccB and / or pccA genes.
[0028] In one or more embodiments, the host cell contains plasmid pET21c-P T7 -DEBS2-DEBS3-T7ter and / or pET28a-P T7 -pccB-rbs-pccA-P T7 -DEBS1-T7ter.
[0029] In one or more embodiments, the host cell also expresses glycosyltransferases eryBV and / or eryCIII.
[0030] In one or more embodiments, the host cell also expresses EryG and / or EryK.
[0031] In one or more embodiments, the host cell is a bacterial cell.
[0032] In one or more embodiments, the bacteria are Escherichia coli or yeast. Preferably, the bacteria are Escherichia coli BAP1.
[0033] The present invention also provides a method for producing EB or increasing EB yield, comprising catalyzing 6-dEB to obtain EB using a mutant protein of hydroxylase eryF derived from Saccharopolyspora erythraea, Actinopolyspora erythraea, or Aeromicrobium erythreum in a system containing 6-dEB, wherein the mutant protein has one, two, three or more mutations in amino acids selected from the following regions: hydrogen bond network region, substrate binding pocket region, TTT region and β11 region, thereby enhancing the hydroxylation activity of hydroxylase eryF.
[0034] In one or more embodiments, the mutant protein has the sequence of any one of SEQ ID NO:1-3 or a sequence having at least 90% sequence identity with it, and has one, two, three or more mutations at the positions selected from the following in SEQ ID NO:1 or the corresponding positions in SEQ ID NO:2 or 3: E244, E360, T92, I174, L175, V237, L391, N89, A74, K162, Y163, G165, E166, S376, G378, I379. In one or more embodiments, the mutant protein has mutations at the positions selected from any one of the following groups: (1) I379, A74, (2) I379, G165, (3) I379, G165, A74.
[0035] In one or more embodiments, the mutant protein has one or more mutations selected from the following: A74F, L175I, K162G, G165S, Y163K, E166D, S376H, G378A, I379V, I379T, N89Q, L391I. More preferably, the mutant protein has mutations selected from any one of the following groups: (1) I379V, A74F, (2) I379V, G165S, (3) I379V, G165S, A74F.
[0036] In one or more embodiments, the mutant protein has mutations of N89Q and / or L391I, and the method also increases the yield of 6-dEB.
[0037] In one or more embodiments, the system further comprises propionyl-CoA, methylmalonyl-CoA, and 6-deoxyerythromycin B synthase (DEBS).
[0038] In one or more embodiments, the system further contains pccB and / or pccA proteins.
[0039] In one or more embodiments, the system is a cellular system. Preferably, the system is a host cell as described in any embodiment herein, more preferably a bacterial cell.
[0040] In one or more embodiments, the bacteria is *Escherichia coli*. Preferably, the bacteria is *Escherichia coli* BAP1.
[0041] The present invention also provides a method for reducing EB production, comprising using a mutant protein of the hydroxylase eryF derived from Saccharopolyspora erythraea, Actinopolyspora erythraea, or Aeromicrobium erythreum to catalyze the conversion of 6-dEB to EB in a system containing 6-dEB, the mutant protein having one, two, three or more mutations in amino acids selected from the following regions: hydrogen bond network region, substrate binding pocket region, TTT region, and β11 region, thereby reducing the hydroxylation activity of the hydroxylase eryF.
[0042] In one or more embodiments, the mutant protein has the sequence of any one of SEQ ID NO:1-3 or a sequence having at least 90% sequence identity with it, and has one, two, three or more mutations at the positions selected from the following in SEQ ID NO:1 or the corresponding positions in SEQ ID NO:2 or 3: E244, E360, T92, I174, L175, V237, L391, N89, A74, K162, Y163, G165, E166, S376, G378, I379. In one or more embodiments, the mutant protein has mutations at the positions selected from any one of the following groups: (1) I379, A74, (2) I379, G165, (3) I379, G165, A74.
[0043] In one or more embodiments, the mutant protein has one or more mutations selected from the following: E244D, E360D, T92S, I174L, I174V, L175V, V237L, V237I, L391V, K162R, L377_(ΔL377).
[0044] In one or more embodiments, the system further comprises propionyl-CoA, methylmalonyl-CoA, and 6-deoxyerythromycin B synthase (DEBS).
[0045] In one or more embodiments, the system is a cellular system. Preferably, the system is a host cell as described in any embodiment herein, more preferably a bacterial cell.
[0046] In one or more embodiments, the bacteria is *Escherichia coli*. Preferably, the bacteria is *Escherichia coli* BAP1.
[0047] The present invention also provides the use of the mutant protein or nucleic acid molecule described in any embodiment herein in the preparation of EB, MEB, erythromycin D, erythromycin B, erythromycin C or erythromycin A.
[0048] In one or more embodiments, the use includes catalyzing 6-dEB to obtain EB using a mutant protein of the hydroxylase eryF derived from Saccharopolyspora erythraea, Actinopolyspora erythraea, or Aeromicrobium erythreum in a system containing 6-dEB, the mutant protein having one, two, three, or more mutations in amino acids selected from the following regions: hydrogen bond network region, substrate binding pocket region, TTT region, and β11 region, thereby enhancing the hydroxylation activity of the hydroxylase eryF.
[0049] In one or more embodiments, the mutant protein has the sequence of any one of SEQ ID NO:1-3 or a sequence having at least 90% sequence identity with it, and has one, two, three or more mutations at the positions selected from the following in SEQ ID NO:1 or the corresponding positions in SEQ ID NO:2 or 3: E244, E360, T92, I174, L175, V237, L391, N89, A74, K162, Y163, G165, E166, S376, G378, I379. In one or more embodiments, the mutant protein has mutations at the positions selected from any one of the following groups: (1) I379, A74, (2) I379, G165, (3) I379, G165, A74.
[0050] In one or more embodiments, the mutant protein has one or more mutations selected from (1) and (2) below: (1) A74F, L175I, K162G, G165S, Y163K, E166D, S376H, G378A, I379V, I379T, (2) N89Q, L391I. More preferably, the mutant protein has mutations selected from any one of the following groups: (1) I379V, A74F, (2) I379V, G165S, (3) I379V, G165S, A74F.
[0051] In one or more embodiments, the system further comprises propionyl-CoA, methylmalonyl-CoA, and 6-deoxyerythromycin B synthase (DEBS).
[0052] In one or more embodiments, the system further contains pccB and / or pccA proteins.
[0053] In one or more embodiments, the system is a cellular system. Preferably, the system is a host cell as described in any embodiment herein, more preferably a bacterial cell.
[0054] In one or more embodiments, the bacteria is *Escherichia coli*. Preferably, the bacteria is *Escherichia coli* BAP1. Attached Figure Description
[0055] Figure 1 Erythromycin A biosynthetic pathway. Note: 6-dEB, 6-deoxyerythromycin B; EB, erythromycin B; MEB, 3-O-α-carboxyerythromycin B; ErD, erythromycin D; ErB, erythromycin B; ErC, erythromycin C; ErA, erythromycin A. PKS, polyketide synthase; eryF, encoding 6-dEB hydroxylase; eryBV, encoding dTDP-L-mycarose glycosyltransferase; eryCIII, encoding TDP-D-desosamine glycosyltransferase; eryG, encoding erythromycin C methyltransferase; eryK, encoding cytochrome P450 erythromycin B / D C-12 hydroxylase.
[0056] Figure 2 Biosynthesis of Erythronolide B (EB). A, Starting strain sWT and fermentation strain s84 of EB. DEBS1, DEBS2, DEBS3, 6-deoxyerythromycin B synthase. pccAB, propionyl-CoA carboxylase. eryF, P450 monooxygenase. B, HPLC detection of fermentation products of sWT and s84. C, LC-MS / MS fragments of 6-deoxyerythromycin B (6-dEB) and erythromycin B (EB).
[0057] Figure 3 The activities of SaeryF, AceryF, and AeeryF were compared during shake-flask fermentation of E. coli. A, Growth curves of s84, s85, and s86 during 120 h of fermentation. B, EB fermentation yield of s84, s85, and s86. C, 6-dEB fermentation yield of s84, s85, and s86.
[0058] Figure 4The effect of mutant substrate-binding pocket amino acids on EB yield. A, SaeryF receptor substrate-binding pocket (PDB: 1jio). Red, heme; green, substrate 6-deoxyerythromycin B; yellow, amino acid residues involved in substrate recognition; gray, amino acid residues involved in water molecule network formation. B, EB yield of mutants E244D and E360D. C, EB yield of mutants A74F, Y75F, N89Q and T92S. D, EB yield of mutants I174L, I174V, L175I, L175V, V237L, V237I, L391V and L391I.
[0059] Figure 5 The AceryF and AeeryF models were compared with the SaeryF crystal structure. Amino acid sequence alignment results were first performed using MEGA X, followed by online analysis using ESPript 3.0. The regions marked with ★ indicate the TTT and β11 regions with significant sequence differences, respectively.
[0060] Figure 6 Mutant design and shake-flask fermentation validation based on homology models. A, Comparison of superimposed homology models of SaeryF, AceryF, and AeeryF. Pink, SaeryF 3D structure (PDB:1jio); lemon, constructed AceryF model; cyan, constructed AeeryF model. B, EB yield of TTT region amino acid mutants. C, EB yield of β11 region amino acid mutants. L377_ refers to the deletion of amino acid L377.
[0061] Figure 7 Verification through combined mutation fermentation.
[0062] Figure 8 1H NMR spectrum of 6-dEB (500MHz, CD3OD).
[0063] Figure 9 13C NMR spectrum of 6-dEB (125MHz, CD3OD).
[0064] Figure 10 EB 1H NMR spectrum (500MHz, CD3OD).
[0065] Figure 11 EB 13C NMR spectrum (125MHz, CD3OD).
[0066] Figure 12 , 6-dEB standard curve.
[0067] Figure 13 EB standard curve.
[0068] Figure 14 Electrophoresis of SaeryF, AceryF, and AeeryF proteins. Note: M refers to protein standards; Sa refers to SaeryF derived from *Saccharopolyspora erythraea*; Ac refers to AceryF derived from *Actinopolyspora erythraea*; Ae refers to AeeryF derived from *Aeromicrobium erythreum*; FNR refers to spinachferredoxin-NADP oxidoreductase (FNR).
[0069] Figure 15 Mutant expression analysis. Detailed Implementation
[0070] The inventors discovered that by making amino acid mutations in the hydrogen bond network region, substrate binding pocket region, TTT region, and β11 region of the hydroxylase eryF, the activity of the hydroxylase eryF can be regulated, thereby achieving the control of its product EB production.
[0071] Therefore, this invention first provides mutants (i.e., mutant proteins) of the hydroxylase eryF. In this document, the hydroxylase eryF may be derived from *Saccharopolyspora erythraea* (NCBI number: CAM00071, SEQ ID NO:1), *Actinopolyspora erythraea* (NCBI number: AIS23778, SEQ ID NO:2), or *Aeromicrobium erythreum* (NCBI number: ALX06070, SEQ ID NO:3), and the codon-optimized coding sequences of the above enzymes are shown in SEQ ID NO:4-6, respectively. Alternatively, the hydroxylase eryF may be a hydroxylase eryF from a homologous species or subspecies of the same family, genus, or species as the corresponding species, having at least 90%, preferably 95%, more preferably 98% sequence identity with any one of SEQ ID NO:1-3. This document includes mutants of these hydroxylase eryF.
[0072] The eryF mutant of the present invention has one, two, or more mutations in the hydrogen bond network region, substrate binding pocket region, TTT region, and β11 region. The amino acids in the hydrogen bond network region include E244 and E360 of SEQ ID NO:1, or the corresponding amino acids in other eryF sequences (e.g., SEQ ID NO:2 or 3). The amino acids in the substrate binding pocket region include T92, I174, L175, V237, L391, N89, and A74 of SEQ ID NO:1, or the corresponding amino acids in other eryF sequences (e.g., SEQ ID NO:2 or 3). The amino acids in the TTT region include K162, Y163, G165, and E166 of SEQ ID NO:1, or the corresponding amino acids in other eryF sequences (e.g., SEQ ID NO:2 or 3). The amino acids in the β11 region include S376, G378, and I379 of SEQ ID NO:1, or the corresponding amino acids in other eryF sequences (e.g., SEQ ID NO:2 or 3).
[0073] Therefore, the eryF mutant of the present invention has one, two, three or more mutations at positions selected from the following: E244, E360, T92, I174, L175, V237, L391, N89, A74, K162, Y163, G165, E166, S376, G378, I379. The above mutations can be individual mutations or mutations in any combination. For example, the mutant may have mutations at positions selected from any of the following groups: (1) I379, A74; (2) I379, G165; (3) I379, G165, A74.
[0074] For amino acids in the substrate-binding pocket region, mutating these amino acids to those with larger or longer side chains increases the hydroxylation activity of the hydroxylase eryF, leading to increased EB production, for example, A74F, L175I, N89Q, and L391I; conversely, mutating these amino acids to those with smaller or shorter side chains decreases the hydroxylation activity of the hydroxylase eryF, resulting in decreased EB production, for example, T92S, I174L, I174V, L175V, V237L, V237I, and L391V.
[0075] For amino acids in the TTT or β11 regions, the hydroxylation activity of the hydroxylase eryF is increased when the mutation of the amino acid leads to a shortening of the TTT or β11 region. Examples include K162G, G165S, Y163K, E166D, S376H, G378A, I379V, and I379T.
[0076] In a specific implementation, in order to improve the hydroxylation activity of the hydroxylase eryF, the mutant has one or more mutations selected from the following (1) and (2): (1) A74F, L175I, K162G, G165S, Y163K, E166D, S376H, G378A, I379V, I379T, (2) N89Q, L391I. More preferably, the mutant has mutations selected from any of the following groups: (1) I379V, A74F, (2) I379V, G165S, (3) I379V, G165S, A74F. The mutant can be used to prepare EB, MEB, erythromycin D, erythromycin B, erythromycin C or erythromycin A.
[0077] On the other hand, in order to reduce the hydroxylation activity of the hydroxylase eryF, the mutant has one or more mutations selected from the following: E244D, E360D, T92S, I174L, I174V, L175V, V237L, V237I, L391V, K162R, L377_(ΔL377).
[0078] The mutations described herein can be introduced by any method known in the art, such as homologous recombination, PCR, etc.
[0079] The mutants of the hydroxylase eryF described herein also include fragments, derivatives, and analogs of the mutants, provided that they possess the mutation described herein at the mutation site that regulates the activity of the hydroxylase eryF. Thus, the “fragments,” “derivatives,” and “analytes” substantially retain the same biological function or activity as the mutants. The fragments, derivatives, or analogs may be (i) polypeptides in which one or more conserved or non-conserved amino acid residues (preferably conserved amino acid residues) are substituted at a mutation site other than those described herein, and such substituted amino acid residues may or may not be encoded by the genetic code; or (ii) polypeptides having substituent groups at one or more amino acid residues at a mutation site other than those described herein; or (iii) polypeptides formed by fusing a mature mutant polypeptide with another compound (e.g., a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (iv) polypeptides formed by fusing an additional amino acid sequence to this polypeptide sequence (e.g., a leader sequence or secretion sequence, or a sequence used to purify this polypeptide, or a proteogen sequence, or a fusion protein formed with an antigen IgG fragment). These fragments, derivatives, and analogs are within the scope well known to those skilled in the art in accordance with the teachings herein.
[0080] The peptide mutants described herein can be modified peptide mutants. Modifications (typically without altering the primary structure) include chemical derivatization of the peptide, such as acetylation or carboxylation. Modifications also include glycosylation, such as those resulting from glycosylation modifications performed during peptide synthesis and processing or further processing steps. This modification can be accomplished by exposing the peptide to glycosylating enzymes (such as mammalian glycosylation or deglycosylation enzymes). Modifications also include sequences containing phosphorylated amino acid residues (such as phosphotyrosine, phosphotyserine, phosphotythreonine). Modifications also include peptides modified to improve their resistance to proteolysis or optimize their solubility.
[0081] Nucleic acid molecules encoding the mutant polypeptides described herein are also within the scope of this document. Nucleic acid molecules can be in DNA or RNA form. Nucleic acid molecules described herein include sequences modified through codon optimization (e.g., optimization for *E. coli* or yeast), provided that the amino acid sequence encoded by the nucleic acid molecule remains unchanged. Codon-optimized sequences may exhibit more suitable expression for a specific species. Methods for codon optimization of nucleic acid molecule sequences are well known in the art. The coding region sequence encoding the mature polypeptide can be a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding the mutant sequence but with a different base sequence. Exemplary codon-optimized sequences encoding the hydroxylase eryF are shown in SEQ ID NO:4-6.
[0082] Nucleic acid molecules encoding mature mutant peptides include: coding sequences that encode only the mature mutant peptide; coding sequences of the mature mutant peptide and various additional coding sequences; coding sequences of the mature mutant peptide (and optional additional coding sequences) and non-coding sequences. The term "nucleic acid molecule encoding a mutant peptide" can refer to a nucleic acid molecule that includes the peptide itself, or it can also include additional coding and / or non-coding sequences.
[0083] The nucleic acid molecules of this invention can be coding sequences of peptides or domains, or expression cassettes of peptides or domains. Hereinafter, a coding sequence refers to the portion of a nucleic acid sequence that directly defines its protein product. The boundaries of a coding sequence are typically defined by a ribosome-binding site (for prokaryotic cells) immediately upstream of the 5' open reading frame of the mRNA and a transcription termination sequence immediately downstream of the 3' open reading frame of the mRNA. Coding sequences can include, but are not limited to, DNA, cDNA, and recombinant nucleic acid sequences. Hereinafter, an expression cassette refers to the complete element required to express a gene of interest, including a promoter, gene coding sequence, and PolyA tailing signal sequence. In some embodiments, the coding sequence or expression cassette is integrated into the genome of a cell (e.g., *E. coli*).
[0084] This invention also relates to variants of the aforementioned nucleic acid molecules that encode polypeptides or fragments, analogs, and derivatives of polypeptides having the same amino acid sequence as those of this invention. These polynucleotide variants can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As is known in the art, an allelic variant is a substitution of a polynucleotide, which may be the substitution, deletion, or insertion of one or more nucleotides, but does not substantially alter the function of the polypeptide it encodes.
[0085] The present invention also relates to polynucleotides that hybridize with the above-described sequences and have at least 50%, preferably at least 70%, more preferably at least 80%, 85%, 90%, or 95% identity between the two sequences. The present invention particularly relates to polynucleotides that hybridize with the polynucleotides described herein under stringent conditions (or strict conditions). In the present invention, “stringent conditions” means: (1) hybridization and elution at lower ionic strength and higher temperatures, such as 0.2 × SSC, 0.1% SDS, 60°C; or (2) hybridization with a denaturing agent, such as 50% (v / v) formamide, 0.1% fetal bovine serum / 0.1% Ficoll, 42°C, etc.; or (3) hybridization only occurs when the identity between the two sequences is at least 90%, more preferably at least 95%.
[0086] This invention also relates to complementary sequences of the above-described sequences or nucleic acid fragments that hybridize with the above-described sequences. As used herein, a "nucleic acid fragment" is at least 15 nucleotides in length, preferably at least 30 nucleotides, more preferably at least 50 nucleotides, and most preferably at least 100 nucleotides or more. Nucleic acid fragments can be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding desired polypeptides or domains. "Hybridization" as used herein primarily refers to nucleic acid sequence pairing under stringent conditions. An exemplary stringent condition is hybridization and washing at 65°C in a solution of 0.1×SSPE (or 0.1×SSC) and 0.1% SDS.
[0087] In some embodiments, the nucleic acid molecule is a nucleic acid construct containing the coding sequence of the mutant described herein, and one or more regulatory sequences operatively linked to these sequences. The regulatory sequence may be a suitable promoter sequence. The promoter sequence is typically operatively linked to the coding sequence of the protein to be expressed. The promoter may be any nucleotide sequence exhibiting transcriptional activity in the selected host cell, including mutant, truncated, and heterozygous promoters, and may be obtained from a gene encoding an extracellular or intracellular polypeptide homologous or heterologous to that host cell. The regulatory sequence may also be a suitable transcription terminator sequence, a sequence recognized by the host cell to terminate transcription. The terminator sequence is operatively linked to the 3' end of the nucleotide sequence encoding the polypeptide. Any promoter and terminator that are functional in the selected host cell may be used herein. An exemplary promoter is, for example, P… T7 Terminators such as T7ter, whose sequences are well known to those skilled in the art.
[0088] In some embodiments, the nucleic acid construct is a vector. The vector can be a cloning vector, an expression vector, or an integration vector. Specifically, the coding sequence of the mutant described herein can be cloned into many types of vectors, including but not limited to plasmids, phage particles, phage derivatives, animal viruses, and granules. Cloning vectors can be used to provide the coding sequence of the mutant of this invention. Expression vectors can be provided to cells in the form of viral vectors. Integration vectors are used to integrate the expression cassette described herein into the host genome. This invention includes any vectors known in the art suitable for engineered bacteria (e.g., *E. coli* or yeast) used for erythromycin production. Vectors suitable for use herein include, but are not limited to, pET21c, pET28a, pET21a, and pCDFDuet.
[0089] The nucleic acid molecules described herein can generally be obtained using PCR amplification. Specifically, primers can be designed using nucleotide sequences obtained from the amino acid sequences disclosed herein, and the relevant sequences can be amplified using commercially available cDNA libraries or cDNA libraries prepared according to conventional methods known to those skilled in the art. When the sequences are long, two or more PCR amplifications are often required, and then the fragments amplified from each amplification are spliced together in the correct order. Alternatively, the nucleic acid molecules described herein can be synthesized directly.
[0090] The nucleic acid molecules (especially vectors) described in this article can be introduced into host cells using conventional methods, including microinjection, gene gun, electroporation, virus-mediated transformation, electron bombardment, and calcium phosphate precipitation.
[0091] As described herein, host cells contain, express, and / or secrete the mutants described herein, or contain the nucleic acid molecules described herein. Host cells include both engineered bacteria (E. coli or yeast) ultimately used to produce EB, and various cells used in the process of producing engineered bacteria. In some embodiments, this document provides *E. coli* BAP1 that stably expresses the mutants described herein.
[0092] When the host cell is an engineered bacterium for EB production, by providing the host cell with the upstream substrate 6-deoxyerythronolide B (6-dEB) or by causing it to express an enzyme for 6-dEB synthesis, the host cell can utilize the mutant of this application contained therein to convert 6-dEB into EB, thereby further synthesizing erythromycin or its derivatives. The enzyme used for 6-dEB synthesis is 6-deoxyerythromycin B synthase (DEBS, NCBI number: AM420293), which includes DEBS1, DEBS2, and DEBS3, and utilizes propionyl-CoA and methylmalonyl-CoA to synthesize 6-dEB. In a specific embodiment, the host cell (e.g., *Escherichia coli*) contains the plasmid pET21c-P. T7 -DEBS2-DEBS3-T7ter and pET28a-P T7 -pccB-rbs-pccA-P T7 -DEBS1-T7ter. Of course, the host cell may further contain enzymes for the synthesis of other upstream intermediates (e.g., 6-dEB synthesized from propionyl-CoA and methylmalonyl-CoA). These enzymes and their sequences are known in the art.
[0093] Furthermore, when the host cell is an engineered bacterium used to produce erythromycin or its derivatives, it may also express other enzymes used to produce erythromycin or its derivatives, including but not limited to: genes enhancing 6-dEB synthesis (e.g., pccB, pccA), glycosyltransferases eryBV, eryCIII, EryG, and / or EryK. Those skilled in the art can obtain the amino acid sequences or their coding sequences of the above enzymes from publicly available sources (e.g., NCBI), preferably pccB, pccA, glycosyltransferases eryBV, eryCIII, EryG, and / or EryK from *Saccharopolyspora erythraea*, *Actinopolyspora erythraea*, or *Aeromicrobium erythreum*. For example, pccB is referenced in NCBI number AL939121, and pccA is referenced in NCBI number AL939121.
[0094] This invention also provides a method for producing EB or increasing EB yield, comprising using a mutant of the hydroxylase eryF to catalyze 6-dEB in a system containing 6-dEB to obtain EB, wherein the hydroxylase eryF is derived from Saccharopolyspora erythraea, Actinopolyspora erythraea, or Aeromicrobium erythreum (e.g., the sequence of any one of SEQ ID NO: 1-3), and has mutations in the hydrogen-bonding network region, substrate-binding pocket region, TTT region, and β11 region that enhance the hydroxylation activity of the hydroxylase eryF as described elsewhere herein. The system may optionally contain propionyl-CoA, methylmalonyl-CoA, and 6-deoxyerythromycin B synthase (DEBS). The system may be, for example, a cellular system (e.g., cells expressing the mutant) (or a cell culture system), a subcellular system, a solution system, a tissue system, an organ system, or an animal system. Preferably, the system is a host cell or bacterium as described in any embodiment herein.
[0095] Accordingly, the present invention also provides a method for reducing EB production, comprising using a mutant of the hydroxylase eryF to catalyze the conversion of 6-dEB to EB in a system containing 6-dEB, wherein the hydroxylase eryF is derived from Saccharopolyspora erythraea, Actinopolyspora erythraea, or Aeromicrobium erythreum (e.g., the sequence of any one of SEQ ID NO: 1-3), and has mutations in the hydrogen bond network region, substrate binding pocket region, TTT region, and β11 region that reduce the hydroxylation activity of the hydroxylase eryF as described elsewhere herein.
[0096] In the specific implementation plan, the inventors first introduced the TDP-L-mycarose synthetic pathway into the EB-synthesizing strain to verify EB as a precursor limiting the synthesis of the glycosylation product MEB. Then, through in vitro kinetic parameters and in vivo fermentation, SaeryF was screened and obtained. SaeryF was then engineered to further increase EB yield.
[0097] The present invention is illustrated below through specific embodiments. It should be understood that, within the scope of the present invention, the above-described technical features of the present invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions.
[0098] Example
[0099] Materials and Methods
[0100] 1.1 Strains, plasmids, primers and reagents
[0101] The plasmids used are shown in Table 1. The empty plasmids pET21c, pET28a, pET21a, and pCDFDuet were all obtained from Novagen. The strains used are shown in Table 2. eryF from species such as Saccharopolyspora erythraea, Actinopolyspora erythraeaYIM90600, and Aeromicrobium erythreum was synthesized by Nanjing Genscript (codon optimization for E. coli, sequences shown as SEQ ID NO:1-3 respectively). Ferredoxin-NADPreductase (FNR, NCBI number: XM_022006538) from Spinacia oleracea was synthesized by Anhui General Biotechnology Co., Ltd. and codon optimization for E. coli was performed (SEQ ID NO:7).
[0102] Table 1. Plasmids used in this paper
[0103]
[0104]
[0105] Table 2. Strains used in this paper
[0106]
[0107]
[0108] 1.2 Construction of EB biosynthesis-related plasmids
[0109] Using the synthesized plasmids pZF71, pZF72, and pZF73 (Table 1) as templates, PCR amplification was performed using the primers in Table 3. After the PCR products were purified by gel extraction, they were ligated into the pETDuet vector digested with BamHI and SacI restriction endonucleases (NEB, USA) using CloneExpress II One Step Cloning Kit (Vazymebiotech co.Ltd.) to construct plasmids pZF84, pZF85, and pZF86.
[0110] All SaeryF mutant plasmids were amplified by PCR using plasmid pZF84 as a template and primers in Table 4 to obtain the introduced mutant fragments. After gel purification, the fragments were transformed into DH10B and sequenced to verify the recombinant clones.
[0111] Table 3. Primers used to construct plasmids pZF84, pZF85, and pZF86
[0112] Primers Sequence (5'→3') Primer_84F CATCACCATCATCACCACAGCCAGGATCCAATGACCACCGTGCCGGACCT Primer_84R TGCAGGCGCGCCGAGCTCGAATTCACTAGTTTAGCCATCCAGACGAACCG Primer_85F CATCACCATCATCACCACAGCCAGGATCCAATGACCACCGTGCCGGACCT Primer_85R TGCAGGCGCGCCGAGCTCGAATTCACTAGTTTAGCCCTCCAGACGAACCG Primer_86F CATCACCATCATCACCACAGCCAGGATCCAATGACCGCGCTGCCGGAAGT Primer_86R TGCAGGCGCGCCGAGCTCGAATTCACTAGTTTAGCCACCCAGACGAACCG
[0113] Table 4. Primers used to construct the pZF84 mutant plasmid
[0114]
[0115]
[0116] 1.3 Protein Expression and Purification
[0117] Strain sZF70 was used for FNR protein expression, while strains sZF71, sZF72, and sZF73 were used for eryF protein expression from different species. Seed culture collected overnight was inoculated into spectinomycin-resistant LB medium at a 1% v / v inoculation ratio. Cells were cultured at 37°C and 200 rpm for 2 h, then cooled to 22°C and cultured for another 30 min. Protein expression was induced by a final concentration of 0.5 mM IPTG. Cells were harvested after 20 h of culture at 22°C.
[0118] For purification, cells collected by centrifugation were resuspended in buffer C (100 mM phosphate buffer, pH 7.4) with 10% v / v glycerol. Final concentrations of 1 mM PMSF, 1 mM EDTA, 1 mM DTT, 25 mM MgCl2, and 5 μg / ml Dnase I were added, and the mixture was incubated on ice for 30 min. After cell disruption by autoclaving, the cells were centrifuged at 10000 rpm for 2 h at 4 °C. The supernatant was then mixed with Ni... 2+ -NTA incubation for 1 hour. Then, elute with wash buffer (buffer C with 10% v / v glycerol, 25 mM imidazole, 1 mM DTT) for 10 column volumes, and finally elute the target protein with elute buffer (buffer C with 10% v / v glycerol, 250 mM imidazole, 1 mM DTT). The target protein was concentrated to 1 mL using a concentration tube (Amicon Ultra-4 Centrifugal Filter Unit, 30,000 MWCO, EMD Millipore). Protein concentration was determined using the Bradford assay (Sangon Biotech) and repeated three times.
[0119] 1.4 Determination of in vitro kinetic parameters
[0120] The reaction system (100 μL) for the in vitro kinetic assay of eryF consisted of 10 μg eryF protein, 5 mM spinach-ferredoxin, 10 μg spinach-ferredoxin-NADP oxidoreductase (FNR), 10 mM glucose-6-phosphate, 2 U glucose-6-phosphate dehydrogenase, 2 mM NDAPH, substrate 6-dEB concentration ranging from 5 to 300 μM, and buffer C (100 mM phosphate buffer, pH 7.4). After reacting at 30 °C for 15 min, the mixture was extracted three times with an equal volume of ethyl acetate. After concentration and drying, the mixture was reconstituted with 100 μL of methanol. After centrifugation at 12000 rpm for 10 min, samples were prepared for HPLC analysis. Three replicates were performed for each concentration. Kinetic parameter K... m k cat The values were calculated using GraphPad Prism 7.04.
[0121] 1.5 Shake Flask Fermentation Conditions
[0122] Strains sWT and sZF84 were used for the fermentation production of 6-dEB. The fermentation medium consisted of LB, 15 g / L glycerol, and 23.8 g / L HEPES-Free acid, which were dissolved and adjusted to pH 7.6 before final volume determination. The medium was sterilized at 121°C for 20 min. During fermentation, the overnight cultured strains were inoculated into the fermentation medium at a 1% v / v inoculation ratio. The culture was carried out at 37°C until the OD600 reached approximately 0.4. Then, 0.5 mM IPTG was added to induce protein expression, and sodium propionate (a precursor) was supplemented at a final concentration of 5 mM. The culture was then carried out at 22°C and 250 rpm for 5 days.
[0123] 1.6 Compound Isolation and Purification
[0124] The separation, purification, and preparation methods of 6-dEB and EB are as follows: Fermentation broth was collected by centrifugation, extracted three times with equal volumes of ethyl acetate, and concentrated using a vacuum concentrator (EYELA N-1100, RIKEN, Tokyo, Japan) to obtain an extract. Then, column chromatography was performed using a SiliaSphere C18 (50 μm, Silicycle, QulbecK, QC, Canada). During column chromatography, 30% methanol was used as the initial mobile phase, and elutions were performed at gradients of 50%, 70%, and 100% for 10 column volumes each. The eluates from each gradient were then analyzed by HPLC. After concentrating, 6-dEB and EB were purified by pre- and semi-preparative HPLC to obtain 6-dEB and EB with purities greater than 95%. The structures of the compounds were further confirmed by ¹H and ¹C spectroscopy and two-dimensional spectroscopy using an Avance DRX 400, 500 MHz (Bruker, Germany).
[0125] 1.7 Compound Analysis and Detection Methods
[0126] The HPLC detection system for qualitative or quantitative analysis of 6-dEB and EB consisted of a Dionex UltiMate 3000 analytical HPLC (Thermo Scientific, MA, USA) and an ELSD detector (U3000). The HPLC column was a SilGreen ODS column, φ, 4.6 × 250 mm, S-5 μM (Greenherbs Co., Ltd., Beijing, China). Mobile phase A was acetonitrile, and mobile phase B was 50 mM formic acid ammonia. The specific detection method was as follows: the initial mobile phase 0% A was gradient-propelled to 95% A and 5% B over 30 minutes, then returned to the initial mobile phase within 1 minute and held at equilibrium for 4 minutes. The flow rate was 1 mL / min. The ELSD settings were: temperature 105°C, gas flow rate 2.5 L / min, and gain 1.
[0127] For the purification and preparation of compounds such as 6-dEB and EB, a Dionex UltiMate 3000 semi-preparative HPLC (Thermo Scientific, MA, USA) was used. A SilGreen ODS column was used for preparation. 5 μm, (Greenherbs Co., Ltd., Beijing, China) Detection method: isocratic elution with 40% acetonitrile and 60% water for 60 min, flow rate 10 mL / min. UV absorption wavelength is 210 nm.
[0128] When detecting compounds such as 6-dEB and EB by LC-MS, the system used was a Q Exactive quadruple triplet orbital trap mass spectrometer (Thermo Scientific, MA, USA), and the column was an InfinityLab Poroshell 120SB-AQ. 2.7 μM (Agilent, USA). The mobile phase consisted of phase A (acetonitrile) and phase B (2 mM ammonium formate, 0.1% formic acid in water). The mobile phase setup was as follows: 0.0 min, 5% A and 95% B; gradient elution to 95% A and 5% B over 10 min and continue for 1 min. 11.01 min, return to the initial mobile phase and equilibrate for 4 min. Flow rate: 0.4 mL / min.
[0129] Example 1: Biosynthesis of Erythronolide B (EB)
[0130] To heterologously synthesize EB in E. coli, we used BAP1, containing two polyketide synthesis plasmids pBP130 and pBP144, as the starting strain sWT for fermentation to synthesize 6-dEB. P450eryF from S. erythraea was codon-optimized in E. coli and cloned into the T7 promoter of plasmid pCDFDuet-1 to obtain the hydroxylation vector pZF84. pZF84 was transformed into sWT to obtain the recombinant strain s84 for EB synthesis. Figure 2 A). After 120 h of fermentation, two distinct peaks were detected in the fermentation product of strain s84 ( Figure 2 One of the peaks had a retention time of 22.7 min, consistent with the peaks of the standard 6-dEB and the product of the starting strain sWT. The main peak's retention time of 18.5 min fell between 6-dEB (22.7 min) and erythromycin A (16.7 min), leading us to speculate that the main peak might be the target compound EB. To verify this speculation, we extracted the fermentation product of s84 and performed LC-MS / MS analysis. As expected, two ion peaks were found in the mass spectrometry fragments: m / z 385.2577 (EB's molecular formula is C21H38O7, [M+H-H2O]+ m / z is 385.2584) and m / z 387.2739 (6-dEB's molecular formula is C21H38O6, m / z [M+H]+ = 387.2741). Figure 2 (C), subsequent NMR data further confirmed the synthesis of 6-dEB and EB (C). Figure 8-11 To quantitatively analyze the synthetic yield of EB, we purified and prepared 70 mg of EB and 50 mg of 6-dEB and determined the corresponding standard curves. Figure 12 ,13).
[0131] Example 2: In vivo and in vitro screening of eryF
[0132] To increase the yield of EB synthesis, we attempted to screen for the most suitable P450eryF gene for EB synthesis from different erythromycin-producing strains (Harrell and Miller, 2016; Chen et al., 2014). Three known P450eryF genes: SaeryF (from *S. erythraea*), AceryF (from *Actinopolyspora erythraea*), and AeeryF (from *Aeromicrobium erythreum*) were codon-optimized using *E. coli* and cloned into the expression vector pCDFDuet-1. Three expression vectors pZF71-pZF73 with N-terminal His tags were obtained and transformed into BL21(DE3) for protein expression. The proteins (SaeryF, AceryF, AeeryF) obtained after Ni2+-NTA purification and SDS-PAGE validation were used for subsequent in vitro enzymatic reactions involving C6 hydroxylation modification using 6-dEB as a substrate. Figure 14 In in vitro reactions, the affinity coefficient and catalytic efficiency of each eryF enzyme were determined by varying the concentration of the substrate 6-dEB (Table 5). The Km of SaeryF was 13.7, while the Km of AceryF and AeeryF were 17.4 μM and 19.4 μM, respectively. In terms of kcat, there was almost no difference among the three eryF enzymes. The kcat / Km of the three enzymes (SaeryF, AceryF, and AeeryF) indicate that SaeryF exhibits better catalytic properties than AceryF and AeeryF.
[0133] Table 5. Kinetic parameters of different eryFs
[0134] Kinetic parameter SaeryF AceryF AeeryF <![CDATA[K m (μM)]]> 2.55 1.05 2.48 <![CDATA[k cat (min -1 )]]> 0.284 0.222 0.260 <![CDATA[V max (μM min -1 )]]> 2.84 2.222 2.596 <![CDATA[k cat / K m (μM -1 ·my -1 )]]> 0.111 0.212 0.105
[0135] To compare the ability of SaeryF, AceryF, and AeeryF to synthesize EB through in vivo transformation of 6-dEB, we transformed pZF85 (AceryF expression plasmid) and pZF86 (AeeryF expression plasmid) into the starting strain sWT, obtaining two other EB-synthesizing strains, s85 and s86. Strains s85, s86, and s84 were subjected to shake-flask fermentation for 120 hours. Although strain sZF84 grew the fastest in the first 72 hours, the OD600 of all strains was identical after 120 hours. Figure 3 (A). s84 had the highest EB production, reaching a peak of 28.8 mg / L at 120 h, which was 1.2 times and 2.3 times higher than that of s85 (23.9 mg / L) and s86 (12.7 mg / L), respectively. Figure 3Interestingly, in s86, 6-dEB was completely converted to the product EB, while s84 and s85 retained 4.2 mg / L and 3.8 mg / L of 6-dEB, respectively. Figure 3 Both in vivo EB fermentation results and in vitro enzyme activity verification results indicate that SaeryF can synthesize the highest yield of EB, which can be used for subsequent engineering modification.
[0136] Example 3: Effect of mutant SaeryF substrate binding pocket amino acids on EB yield
[0137] To improve the catalytic performance of SaeryF, we shifted our research focus to the engineering modification of the water molecule network amino acids and substrate-binding pocket amino acids in SaeryF. Figure 4 (A) We mutated E244 and E360 to amino acid D, respectively, to obtain two single mutants, E244D and E360D, which were then transformed into sWT for fermentation verification. Since the kinetic parameters were consistent with the fermentation results, all mutant screenings were directly performed for in vivo fermentation verification. After 120 h of shake-flask culture, wild-type SaeryF synthesized 32.7 mg / L of EB, while the relative EB yields of E244D and E360D were only 17% and 38% of that of SaeryF, respectively. Conversely, E244D and E360D accumulated high concentrations of the substrate 6-dEB (over 35 mg / L). Figure 4 B).
[0138] Subsequently, we performed site-directed mutagenesis on the substrate-binding pocket amino acids. In the crystal structure of SaeryF (PDB: 1JIO), substrate 6-dEB binds to the active site by interacting with eight yellow-labeled amino acids (A74, Y75, N89, T92, I174, L175, V237, L391). Figure 4 When phenylalanine (F) replaced A74, EB production increased to 70 mg / L, 21 times that of wild-type SaeryF. However, phenylalanine (F) substitution for Y75 had little effect on EB production. Surprisingly, when N89 was replaced by glutamic acid (Q), its EB and 6-dEB production were 1.1 times and 4.1 times that of wild-type SaeryF, respectively, reaching 38 mg / L and 11 mg / L. However, the hydroxylation products of the mutant T92S decreased significantly. Figure 4(C). Since hydrophobic residues I174, L175, V237, and L391 may have significant effects on the hydrophobic environment and substrate binding, we hypothesized that mutating these amino acids might alter the catalytic properties of SaeryF. Eight designed mutants were validated through fermentation. Six mutants (I174L, I174V, L175V, V237L, V237I, and L391V) showed a decrease in EB yield to 22%–68% of the wild-type SaeryF yield. However, mutants L175I and L391I showed EB yields that were 1.1-fold and 1.6-fold higher than the wild-type, respectively. Furthermore, L391I accumulated 2.3 times more 6-dEB than wild-type SaeryF. Figure 4 D).
[0139] Example 4: Design and application of SaeryF mutants based on homology modeling
[0140] To further improve the EB yield of SaeryF, we attempted to engineer SaeryF based on homology modeling. First, using the SaeryF crystal structure (PDB: 1JIO) binding to the substrate 6-dEB as a template, we constructed homology models for AceryF and AeeryF. The amino acid sequence similarity between the template protein and AceryF and AeeryF was 88% and 69%, respectively. Figure 5 By superimposing the homology model structures of SaeryF, AceryF, and AeeryF, it can be seen that the homology model structures of AceryF and AeeryF are highly similar to the crystal structure of SaeryF, with only minor structural differences found in the TTT and β11 regions. The TTT region is directly connected to the α9 helix, which acts as a cap at the entrance of the substrate binding pocket, closing the pocket. The β11 region is adjacent to the η7 helix, which can extend into the substrate binding pocket, thus affecting substrate binding. Figure 6 Therefore, we hypothesize that mutated amino acids in the TTT and β11 regions may affect the catalytic activity of SaeryF.
[0141] To verify this hypothesis, we mutated eight amino acids in these two regions based on sequence alignment. Based on four non-conserved amino acid mutations in the TTT region, we designed five mutants. K162 in SaeryF was replaced by R in AceryF and G in AeeryF, resulting in mutants K162R and K162G. Similarly, mutants Y163R and G165S were obtained by replacing Y163 and G165 in SaeryF with R and S in AeeryF, respectively. Additionally, E166 in SaeryF was replaced by D in AceryF and AeeryF, resulting in mutant E166D. The starting strain sWT was used for in vivo fermentation and to detect changes in EB yield in the TTT region mutants. K162R showed an 80% decrease in EB yield, while K162G and G165S showed a two-fold increase in EB yield. The yields of Y163R and E166D were 2.8 times that of wild-type SaeryF. Figure 6 Using the same strategy, mutations of four amino acids in the β11 region yielded mutants such as S376H, L377_ (L377 deletion), G378A, I379V, and I379T. Figure 6 (C). Except for L377_, the other four mutants all promoted the increase of EB production. Among them, I379V had the highest EB production of 131 mg / L, which is 4 times that of wild-type SaeryF (32.7 mg / L).
[0142] Example 5: Enhancement of EB Yield by Combined Mutants
[0143] Finally, based on the optimal mutant I379V, we combined mutants such as A74F and G165S, which significantly improved EB yield, to obtain mutants I379V_A74F, I379V_G165S, and I379V_G165S_A74F, and conducted fermentation verification. The results showed that the combined mutant I379V_A74F yielded EB 25% higher than I379V, reaching 163.2 mg / L. The combined mutant I379V_G165S yielded EB 150.6 mg / L, a 15% increase compared to mutant I379V. Finally, mutant I379V_G165S_A74F achieved the highest EB yield of 184.8 mg / L, approximately 41% higher than mutant I379V, and 5.6 times higher than wild-type SaeryF (32.7 mg / L). Figure 7 ).
[0144] Mutant Result Analysis
[0145] The EB yields obtained by fermentation of mutants E244D and E360D were only 17% and 38% of those of the wild type, respectively, yet they accumulated high concentrations of the substrate 6-dEB, indicating the irreplaceable role of E244 and E360 in hydroxylation modification. We have reason to believe that the amino acids involved in hydrogen bond network formation in the mutation affect the hydroxylation efficiency.
[0146] In the mutants surrounding the substrate binding pocket, we hypothesize that the increased EB yield in mutant A74F is due to the large side-chain phenylalanine (Phe) reducing the substrate binding pocket space, enhancing the interaction between the enzyme and substrate 6-dEB, and thus affecting the catalytic efficiency of SaeryF for substrate 6-dEB. Since phenylalanine (Phe) and tyrosine (Tyr) differ by only one hydroxyl group in their side chains, this explains why the substitution of Tyr75 with phenylalanine (Phe) has little effect on EB yield. Interestingly, mutant N89Q shows a more significant increase in substrate 6-dEB yield than in product EB. Structurally, Asn89 interacts with the keto group of substrate 6-dEB via hydrogen bonds. When Gln is substituted, the amino acid side chain lengthens, potentially bringing the hydrogen bond distance between the enzyme and substrate closer, enhancing the interaction and promoting product increase.
[0147] Furthermore, while both mutants L175I and L391I showed increased EB yields by substituting leucine, it was strange that the substrate 6-dEB yield also increased in mutant L391I, while L175I showed no significant change. We hypothesize that isoleucine substitution for leucine causes changes in side-chain steric hindrance, thereby affecting substrate binding at the catalytic center and catalytic efficiency.
[0148] The majority of mutants with increased EB yields in the TTT and β11 regions demonstrated the crucial role of these regions in the catalytic efficiency of SaeryF. The I379V mutant achieved the highest EB yield of 131 mg / L, and the substitution of isoleucine with valine results in a shorter β11 region, leading to the repositioning of the adjacent η7 helix. This ultimately promotes substrate binding and recognition to some extent. To determine the reason for the increased EB yield in the mutants, we further performed protein expression and quantification analyses on several mutants with significantly increased EB yields. Figure 15 As shown, amino acid mutations have almost no effect on protein expression. This indicates that the fundamental reason for the increased EB yield in the mutant lies in its improved kinetic properties. sequence list <110> Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences <120> Hydroxylase mutants and their applications <130> 219839 <160> 7 <170> PatentIn version 3.5 <210> 1 <211> 404 <212> PRT <213> Saccharopolyspora erythraea <400> 1 Met Thr Thr Val Pro Asp Leu Glu Ser Asp Ser Phe His Val Asp Trp 1 5 10 15 Tyr Arg Thr Tyr Ala Glu Leu Arg Glu Thr Ala Pro Val Thr Pro Val 20 25 30 Arg Phe Leu Gly Gln Asp Ala Trp Leu Val Thr Gly Tyr Asp Glu Ala 35 40 45 Lys Ala Ala Leu Ser Asp Leu Arg Leu Ser Ser Asp Pro Lys Lys Lys 50 55 60 Tyr Pro Gly Val Glu Val Glu Phe Pro Ala Tyr Leu Gly Phe Pro Glu 65 70 75 80 Asp Val Arg Asn Tyr Phe Ala Thr Asn Met Gly Thr Ser Asp Pro Pro 85 90 95 Thr His Thr Arg Leu Arg Lys Leu Val Ser Gln Glu Phe Thr Val Arg 100 105 110 Arg Val Glu Ala Met Arg Pro Arg Val Glu Gln Ile Thr Ala Glu Leu 115 120 125 Leu Asp Glu Val Gly Asp Ser Gly Val Val Asp Ile Val Asp Arg Phe 130 135 140 Ala His Pro Leu Pro Ile Lys Val Ile Cys Glu Leu Leu Gly Val Asp 145 150 155 160 Glu Lys Tyr Arg Gly Glu Phe Gly Arg Trp Ser Ser Glu Ile Leu Val 165 170 175 Met Asp Pro Glu Arg Ala Glu Gln Arg Gly Gln Ala Ala Arg Glu Val 180 185 190 Val Asn Phe Ile Leu Asp Leu Val Glu Arg Arg Arg Thr Glu Pro Gly 195 200 205 Asp Asp Leu Leu Ser Ala Leu Ile Arg Val Gln Asp Asp Asp Asp Gly 210 215 220 Arg Leu Ser Ala Asp Glu Leu Thr Ser Ile Ala Leu Val Leu Leu Leu 225 230 235 240 Ala Gly Phe Glu Ala Ser Val Ser Leu Ile Gly Ile Gly Thr Tyr Leu 245 250 255 Leu Leu Thr His Pro Asp Gln Leu Ala Leu Val Arg Arg Asp Pro Ser 260 265 270 Ala Leu Pro Asn Ala Val Glu Glu Ile Leu Arg Tyr Ile Ala Pro Pro 275 280 285 Glu Thr Thr Thr Arg Phe Ala Ala Glu Glu Val Glu Ile Gly Gly Val 290 295 300 Ala Ile Pro Gln Tyr Ser Thr Val Leu Val Ala Asn Gly Ala Ala Asn 305 310 315 320 Arg Asp Pro Lys Gln Phe Pro Asp Pro His Arg Phe Asp Val Thr Arg 325 330 335 Asp Thr Arg Gly His Leu Ser Phe Gly Gln Gly Ile His Phe Cys Met 340 345 350 Gly Arg Pro Leu Ala Lys Leu Glu Gly Glu Val Ala Leu Arg Ala Leu 355 360 365 Phe Gly Arg Phe Pro Ala Leu Ser Leu Gly Ile Asp Ala Asp Asp Val 370 375 380 Val Trp Arg Arg Ser Leu Leu Leu Arg Gly Ile Asp His Leu Pro Val 385 390 395 400 Arg Leu Asp Gly <210> 2 <211> 404 <212> PRT <213> Actinopolyspora halophila <400> 2 Met Thr Thr Val Pro Asp Leu Glu Ser Asp Ser Phe His Val Asp Trp 1 5 10 15 Tyr Arg Thr Tyr Ala Glu Leu Arg Glu Thr Ser Pro Val Thr Ser Val 20 25 30 Arg Phe Leu Gly Gln Asp Ala Trp Leu Ile Thr Gly Tyr Asp Glu Ala 35 40 45 Lys Ala Ala Leu Asn Asp Leu Arg Leu Ser Ser Asp Pro Lys Lys Lys 50 55 60 Tyr Pro Gly Val Glu Val Glu Phe Pro Ala Tyr Leu Gly Phe Pro Glu 65 70 75 80 Asp Val Arg Asn Tyr Phe Ala Asn Asn Met Gly Thr Ser Asp Pro Pro 85 90 95 Thr His Thr Arg Leu Arg Lys Leu Val Ser Gln Glu Phe Thr Val Arg 100 105 110 Arg Val Glu Ala Met Arg Pro Arg Val Glu Arg Ile Thr Ser Asp Leu 115 120 125 Leu Asp Gln Leu Gly Asp Ser Gly Glu Gly Asp Val Val Asp Arg Phe 130 135 140 Ala His Pro Leu Pro Ile Lys Val Ile Cys Glu Leu Leu Gly Val Asp 145 150 155 160 Glu Arg Tyr Arg Gly Asp Phe Gly Arg Trp Ser Ser Glu Ile Leu Val 165 170 175 Met Ala Pro Glu Arg Ala Glu Ala Arg Gly Glu Ala Ala Arg Glu Ile 180 185 190 Val Asn Phe Ile Leu Glu Leu Ile Glu Arg Arg Arg Thr Glu Pro Gly 195 200 205 Asp Asp Leu Leu Ser Gly Leu Ile Arg Val Gln Asn Asp Asp Ala Asp 210 215 220 Arg Leu Ser Ala Asp Glu Leu Ala Ser Val Ser Leu Val Leu Leu Leu 225 230 235 240 Ala Gly Phe Glu Ala Ser Val Ser Leu Ile Gly Ile Gly Thr Tyr Leu 245 250 255 Leu Leu Thr His Pro Glu Gln Leu Ala Leu Val Arg Arg Asp Pro Ser 260 265 270 Ala Trp Pro Asn Ala Val Glu Glu Ile Leu Arg Cys Ile Thr Pro Pro 275 280 285 Glu Thr Thr Thr Arg Phe Ala Thr Glu Glu Leu Glu Ile Gly Gly Val 290 295 300 Thr Ile Pro Arg Tyr Ser Thr Val Leu Val Ala Gly Gly Ala Ala Asn 305 310 315 320 Arg Asp Pro Lys Gln Phe Pro Asn Pro Asp Arg Phe Asp Val Thr Arg 325 330 335 Asp Thr Arg Gly His Leu Ala Phe Gly Gln Gly Ile His Phe Cys Met 340 345 350 Gly Arg Pro Leu Ala Lys Leu Glu Gly Glu Val Ala Leu Arg Ala Leu 355 360 365 Phe Glu Arg Phe Pro Asp Leu Ser Leu Gly Val Asp Ala Asp Asp Val 370 375 380 Leu Trp Arg Arg Ser Leu Leu Leu Arg Gly Ile Asp His Leu Pro Val 385 390 395 400 Arg Leu Glu Gly <210> 3 <211> 405 <212> PRT <213> Aeromicrobium erythreum <400> 3 Met Thr Ala Leu Pro Glu Val Pro Asp Leu Asp Ser Asp Ala Phe His 1 5 10 15 Val Asp Trp Tyr Asp Thr Tyr Ala Gln Leu Arg Glu Arg Arg Pro Val 20 25 30 Thr Pro Val Arg Phe Phe Gly Gln Asp Ala Trp Leu Val Thr Gly Tyr 35 40 45 Glu Gln Ala Arg Thr Ala Leu Thr Asp Leu Arg Leu Ser Ser Asp Pro 50 55 60 Lys Ala Gln Tyr Pro Asp Val Asp Val Asp Phe Pro Ala Tyr Leu Gly 65 70 75 80 Phe Ser Asp Arg Ala Lys His Tyr Phe Val Asn Asn Met Gly Thr Ser 85 90 95 Asp Pro Pro Ser His Thr Arg Leu Arg Lys Leu Val Ala Arg Glu Phe 100 105 110 Thr Ala Arg Arg Val Met Ala Met Arg Pro Arg Val Gln Gln Ile Val 115 120 125 Asp Gly Leu Leu Asp Thr Met Ala Glu Thr Pro Asp Ala Asp Val Val 130 135 140 Ala Ser Phe Ala His Pro Leu Pro Ile Gln Val Ile Cys Glu Leu Leu 145 150 155 160 Gly Val Glu Glu Gly Arg Arg Ser Asp Phe Gly Arg Trp Ser Ala Glu 165 170 175 Ile Leu Ile Met Asp Pro Glu Arg Ala Glu Ala Arg Gly Ala Ala Ala 180 185 190 Glu Glu Val Val Asp Phe Met Leu Asp Leu Val Glu Arg Arg Arg Ala 195 200 205 Ala Pro Gly Asp Asp Leu Leu Ser Ala Leu Ile Gln Ala Arg Asp Val 210 215 220 Asp Glu Ala Arg Leu Ser Gln Asp Glu Leu Val Ser Val Ala Leu Val 225 230 235 240 Leu Leu Leu Ala Gly Tyr Glu Ala Ser Val Ser Leu Ile Gly Ile Gly 245 250 255 Ser Tyr Leu Met Leu Arg His Arg Glu Gln Leu Asp Val Leu Lys Ala 260 265 270 Asp Pro Thr Trp Pro Asn Ala Val Glu Glu Val Leu Arg Leu Tyr Ala 275 280 285 Pro Pro Glu Thr Thr Thr Arg Phe Ala Ala Gln Asp Val Glu Ile Asp 290 295 300 Gly Val Ser Ile Pro Ala Tyr Ser Met Val Leu Val Ala Gly Ala Ala 305 310 315 320 Ala Asn Arg Asp Pro Ala Arg Phe Pro Asp Pro Asp Arg Phe Asp Val 325 330 335 Arg Arg Asp Thr Lys Gly His Leu Thr Phe Gly His Gly Ile His His 340 345 350 Cys Leu Gly Arg Pro Leu Ala Met Leu Glu Gly Glu Val Ala Leu Arg 355 360 365 Ser Leu Phe Glu Arg Phe Pro Asp Val His Ala Thr Asp Leu Asp Ala 370 375 380 Val Ala Phe Arg Arg Ser Leu Leu Leu Arg Gly Ile Asp Ser Leu Pro 385,390,395,400 Val Arg Leu Gly Gly 405 <210> 4 <211> 1215 <212> DNA <213> Artificial Sequence <220> <223> SaeryF <400> 4 atgaccaccg tgccggacct ggagagcgat agcttccacg ttgactggta ccgtacctat 60 gcggagctgc gtgaaaccgc gccggtgacc ccggttcgtt ttctgggtca ggatgcgtgg 120 ctggtgaccg gttatgatga ggcgaaagcg gcgctgagcg acctgcgtct gagcagcgat 180 ccgaagaaaa agtacccggg tgttgaggtg gaattcccgg cgtatctggg ctttccggaa 240 gacgtcgta actacttcgc gaccaacatg ggtaccagcg atccgccgac ccacacccgt 300 ctgcgtaagc tggttagcca ggagtttacc gtgcgtcgtg ttgaagcgat gcgtccgcgt 360 gttgagcaaa tcaccgcgga gctgctggac gaagtgggtg atagcggcgt ggttgacatt 420 gttgatcgtt tcgcgcaccc gctgccgatc aaagtgattt gcgaactgct gggtgttgac 480 gagaagtatc gtggtgaatt tggccgttgg agcagcgaga tcctggtgat ggacccggaa 540 cgtgcggaac agcgtggtca agcggcgcgt gaagtggtta acttcattct ggacctggtg 600 gagcgtcgtc gtaccgaacc gggtgacgat ctgctgagcg cgctgatccg tgttcaggac 660 gatgacgatg gccgtctgag cgcggatgaa ctgaccagca ttgcgctggt gctgctgctg 720 gcgggttttg aggcgagcgt tagcctgatc ggtattggca cctacctgct gctgacccat 780 ccggaccaac tggcgctggt tcgtcgtgat ccgagcgcgc tgccgaacgc ggttgaggaa 840 atcctgcgtt atattgctcc gccggaaacc accacccgtt ttgcggcgga ggaagtggag 900 atcggtggcg ttgcgattcc gcagtacagc accgtgctgg ttgcgaacgg tgcggcgaac 960 cgtgacccga aacaattccc ggacccgcac cgttttgacg tgacccgtga tacccgtggc 1020 cacctgagct tcggtcaagg catccacttt tgcatgggtc gtccgctggc gaagctggag 1080 ggcgaagttg cgctgcgtgc gctgttcggt cgttttccgg cgctgagcct gggtattgat 1140 gcggacgatg tggtttggcg tcgtagcctg ctgctgcgtg gtattgacca cctgccggtt 1200 cgtctggatg gctaa 1215 <210> 5 <211> 1215 <212> DNA <213> Artificial Sequence <220> <223> AceryF <400> 5 atgaccaccg tgccggacct ggaaagcgat agcttccacg ttgactggta ccgtacctat 60 gcggagctgc gtgaaaccag cccggtgacc agcgttcgtt ttctgggtca ggacgcgtgg 120 ctgattaccg gctatgatga agcgaaagcg gcgctgaacg acctgcgtct gagcagcgat 180 ccgaagaaaa agtacccggg tgttgaggtg gaattcccgg cgtatctggg ctttccggag 240 gacgtgcgta actacttcgc gaacaacatg ggtaccagcg atccgccgac ccacacccgt 300 ctgcgtaaac tggttagcca ggagtttacc gtgcgtcgtg ttgaagcgat gcgtccgcgt 360 gttgagcgta tcaccagcga cctgctggat caactgggtg atagcggtga aggcgacgtg 420 gttgatcgtt tcgcgcaccc gctgccgatc aaagtgattt gcgagctgct gggcgttgac 480 gaacgttacc gtggtgattt tggccgttgg agcagcgaaa ttctggtgat ggcgccggaa 540 cgtgcggaag cgcgtggtga ggcggcgcgt gaaatcgtta acttcattct ggagctgatc 600 gaacgtcgtc gtaccgagcc gggtgatgat ctgctgagcg gtctgatccg tgtgcagaac 660 gacgatgcgg accgtctgag cgcggatgaa ctggcgagcg tgagcctggt tctgctgctg 720 gcgggctttg aggcgagcgt tagcctgatc ggtattggca cctatctgct gctgacccat 780 ccggagcaac tggcgctggt gcgtcgtgac ccgagcgcgt ggccgaacgc ggttgaggaa 840 attctgcgtt gcatcacccc gccggaaacc accacccgtt tcgcgaccga ggaactggag 900 attggtggcg tgaccatccc gcgttatagc accgtgctgg ttgcgggtgg cgcggcgaac 960 cgtgacccga aacagttccc gaacccggac cgttttgatg tgacccgtga tacccgtggt 1020 cacctggcgt tcggtcaagg cattcacttt tgcatgggtc gtccgctggc gaagctggag 1080 ggcgaagttg cgctgcgtgc gctgttcgaa cgttttccgg acctgagcct gggcgtggat 1140 gcggacgatg ttctgtggcg tcgtagcctg ctgctgcgtg gtatcgacca cctgccggtt 1200 cgtctggagg gctaa 1215 <210> 6 <211> 1221 <212> DNA <213> Artificial Sequence <220> <223> AeeryF <400> 6 atgaccgcgc tgccggaagt gccggacctg gatagcgacg cgttccacgt tgactggtac 60 gatacctatg cgcaactgcg tgagcgtcgt ccggtgaccc cggttcgttt ctttggtcag 120 gacgcgtggc tggtgaccgg ctatgaacaa gcgcgtaccg cgctgaccga cctgcgtctg 180 agcagcgatc cgaaggcgca atacccggat gtggacgttg atttcccggc gtatctgggt 240 tttagcgacc gtgcgaagca ctacttcgtt aacaacatgg gtaccagcga tccgccgagc 300 cacacccgtc tgcgtaaact ggtggcgcgt gagtttaccg cgcgtcgtgt tatggcgatg 360 cgtccgcgtg tgcagcaaat cgttgacggt ctgctggata cgatggcgga aaccccggac 420 gcggatgttg ttgcgagctt cgcgcacccg ctgccgatcc aagtgatttg cgagctgctg 480 ggtgttgagg aaggccgtcg tagcgacttt ggtcgttgga gcgcggaaat cctgattatg 540 gacccggagc gtgcggaagc gcgtggtgcg gcggcggagg aagtggttga cttcatgctg 600 gatctggtgg agcgtcgtcg tgcggcgccg ggtgatgatc tgctgagcgc gctgattcag 660 gcgcgtgacg ttgatgaggc gcgtctgagc caagacgaac tggtgagcgt tgcgctggtg 720 ctgctgctgg cgggctatga ggcgagcgtt agcctgatcg gtattggcag ctacctgatg 780 ctgcgtcacc gtgaacagct ggatgtgctg aaagcggacc cgaccctgtg gccgaacgcg 840 gtggaggaag ttctgcgtct gtatgctccg ccggagacca ccacccgttt tgcggcgcaa 900 gacgtggaaa tcgatggtgt tagcattccg gcgtatagca tggtgctggt tgcgggtgct 960 gcggcgaacc gtgacccggc gcgtttcccg gacccggatc gttttgacgt gcgtcgtgat 1020 accaaaggtc acctgacctt cggtcacggc atccaccact gcctgggtcg tccgctggcg 1080 atgctggagg gcgaagttgc gctgcgtagc ctgttcgaac gttttccgga tgtgcatgcg 1140 accgacctgg atgcggttgc gtttcgtcgt agcctgctgc tgcgtggcat tgatagcctg 1200 ccggttcgtc tgggtggcta a 1221 <210> 7 <211> 1110 <212> DNA <213> Artificial Sequence <220> <223> FNR <400> 7 atgaccaccg ccgtgaccgc cgccgtgagc tttccgagca ccaaaaccac cagtctgagt 60 gcccgtagta gtagtgtgat tagtccggat aaaattagct ataaaaaggt tccgctgtat 120 tatcgtaatg ttagcgccac cggcaaaatg ggtccgattc gtgcccagat tgccagtgat 180 gtggaagccc cgccgccggc accggcaaaa gttgaaaaac atagtaaaaa gatggaggaa 240 ggtattaccg ttaataagtt taaaccgaaa accccgtatg ttggtcgctg cctgctgaat 300 accaaaatta ccggcgatga tgccccgggc gaaacctggc acatggtgtt tagccatgaa 360 ggtgaaattc cgtatcgtga aggccagagc gtgggtgtga ttccggatgg cgaagataaa 420 aatggtaaac cgcataaact gcgcctgtat agtattgcaa gcagtgccct gggtgacttt 480 ggtgacgcaa aaagcgtgag tctgtgtgtg aaacgtctga tctataccaa tgatgcaggt 540 gaaaccatta agggtgtgtg tagtaatttt ctgtgtgatc tgaaaccggg cgccgaagtt 600 aaactgaccg gcccggtggg caaagaaatg ctgatgccga aagatccgaa tgcaaccatt 660 attatgctgg gcaccggcac cggtattgcc ccgtttcgta gctttctgtg gaaaatgttt 720 ttcgaaaaac acgatgatta caagttcaat ggtctggcct ggctgtttct gggtgttccg 780 accagtagta gtctgctgta taaagaagaa tttgaaaaga tgaaggagaa ggccccggat 840 aattttcgcc tggattttgc cgttagtcgt gaacagacca atgaaaaagg tgaaaaaatg 900 tatatccaga cccgcatggc acagtatgcc gtggaactgt gggaaatgct gaaaaaagat 960 aatacctatg tgtacatgtg cggcctgaaa ggtatggaaa aaggcattga tgatattatg 1020 gtgagcctgg ccgcagccga aggtattgat tggattgaat ataaacgcca gctgaaaaaa 1080 gccgaacagt ggaatgttga agtgtattaa 1110
Claims
1. A kind of origin Saccharopolyspora erythraea A mutant protein with enhanced hydroxylation activity of the hydroxylase eryF, wherein the sequence of the mutant protein is mutated based on SEQ ID NO: 1, and the mutation is: Selected from I379V, or Choose from any of the following groups: (1) I379V and A74F, (2) I379V and G165S, (3) I379V, G165S and A74F.
2. A nucleic acid molecule comprising a sequence selected from: (1) The coding sequence of the mutant protein as described in claim 1, (2) A degenerate variant that has at least 80% sequence identity with (1), (3) (1) or (2) complementary sequences.
3. A nucleic acid construct comprising the nucleic acid molecule of claim 2.
4. The nucleic acid construct as described in claim 3, characterized in that, The nucleic acid construct is a cloning vector, expression vector, or integration vector.
5. A host cell, wherein the host cell: (1) Containing, expressing, and / or secreting the mutant protein of claim 1, and / or (2) The nucleic acid molecule comprising the nucleic acid molecule of claim 2 and / or the nucleic acid construct of any one of claims 3-4.
6. The host cell as described in claim 5, characterized in that, The host cells also express 6-deoxyerythromycin B synthase (DEBS), and / or The host cells also express glycosyltransferases eryBV and / or eryCIII, and / or The host cells also express EryG and / or EryK, and / or The host cell is a bacterial cell.
7. A method for producing EB or increasing EB yield, comprising using the mutant protein of claim 1 in a system containing 6-dEB.
8. The method as described in claim 7, characterized in that, The system also contains propionyl-CoA, methylmalonyl-CoA, and 6-deoxyerythromycin B synthase (DEBS).
9. Use of the mutant protein of claim 1 or the nucleic acid molecule of claim 2 in the preparation of EB, MEB, erythromycin D, erythromycin B, erythromycin C or erythromycin A.