Application of potato auxin response gene StSAUR30231 in inhibiting enzymatic browning of fresh-cut potato

Abstract

The application discloses application of a potato auxin response gene StSAUR30231 in inhibition of enzymatic browning of fresh-cut potatoes and belongs to the technical field of molecular genetics. The nucleotide sequence of the StSAUR30231 gene is shown as SEQ ID NO. 1, and the amino acid sequence encoded by the StSAUR30231 gene is shown as SEQ ID NO. 2. In the application, the StSAUR30231 gene is connected to an expression vector, and the potato is transformed by using an agrobacterium infection. Data show that overexpression of the StSAUR30231 gene can significantly improve the browning resistance of the potato. Meanwhile, a homozygous mutant of the gene is obtained by using a CRISPR-Cas9 technology. Results show that overexpression of the StSAUR30231 significantly reduces the browning of the fresh-cut potato, and the browning resistance of the mutant is significantly lower than that of the wild type. The StSAUR30231 gene provided by the application can provide a theoretical basis for cultivating new varieties of excellent crops, and has great significance in production practice.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular genetics, and particularly relates to application of a potato auxin response gene StSAUR30231 in inhibiting enzymatic browning of fresh-cut potatoes. BACKGROUND

[0002] The information disclosed in this Background section is only for the purpose of increasing the understanding of the general background of the application and does not necessarily constitute an acknowledgement or a suggestion that this information forms the prior art already known to a person of ordinary skill in the art.

[0003] Potato is the fourth largest food crop in the world, rich in nutrients, and is known as the "King of Nutrition" (Millam, 2006; Tao et al., 2021). With the promotion of the "potato main food" strategy in China, potatoes are increasingly appearing on people's tables. Fresh-cut potatoes are increasingly favored by consumers due to their convenience, freshness, and nutritional characteristics (Wu, 2019). However, potatoes are prone to enzymatic browning after cutting, which severely reduces the sensory quality and commercial value of fresh-cut potatoes (Mosneaguta et al., 2012; Zhu et al., 2020).

[0004] In recent years, genetic engineering technology has developed rapidly, and genetic engineering is of great significance to the development of future agricultural science. Using genetic technology to direct improvement of potato traits is an effective means to improve its quality.

[0005] Within a few minutes of auxin induction, transcription can occur, and this induction does not require the synthesis of new proteins. Such genes are referred to as early or primary auxin response genes (Abel and Theologis, 1996). The SAUR gene family is the first identified early auxin response gene (McClure and Guilfoyle, 1987). In plants, some SAUR genes can promote plant growth (Li et al., 2015), promote cell elongation (Spartz et al., 2012), regulate the development of apical hooks (Park et al., 2012), and some SAUR genes negatively regulate the synthesis and transport of auxin (Kant et al., 2009), promote plant senescence, etc. (Kant et al., 2009; Hou et al., 2013; Wen et al., 2020). However, so far, there has been no report on the effect of SAUR genes on potato browning. SUMMARY

[0006] In view of the prior art, the application aims to provide an application of a potato auxin response gene StSAUR30231 in inhibiting enzymatic browning of fresh-cut potatoes. The application has found that the SAUR gene StSAUR30231 of potatoes is closely related to the anti-browning ability of potatoes, and overexpression of the StSAUR30231 gene can significantly reduce the browning of fresh-cut potatoes; and the anti-browning ability of the StSAUR30231 gene mutant is significantly lower than that of the wild type. Therefore, the StSAUR30231 gene can provide a theoretical basis for breeding new varieties of excellent crops, and has great significance in production practice.

[0007] The application is achieved by the following technical solutions:

[0008] In a first aspect of the application, the application of the StSAUR30231 gene in inhibiting enzymatic browning of fresh-cut potatoes is provided; the StSAUR30231 gene is a nucleic acid molecule as shown in i) or ii) or iii) below:

[0009] i) the nucleotide sequence is a nucleic acid molecule as shown in SEQ ID NO. 1;

[0010] ii) a nucleic acid molecule having 90% or more identity with the nucleotide sequence of i) and expressing the same functional protein;

[0011] iii) a nucleic acid molecule other than i) encoding the amino acid sequence as shown in SEQ ID NO. 2.

[0012] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA, etc. The cDNA sequence of the StSAUR30231 gene is as shown in SEQ ID NO. 1; the amino acid sequence of the encoded protein is as shown in SEQ ID NO. 2.

[0013] The term "identity" used herein refers to sequence similarity with the natural nucleic acid sequence. The identity can be evaluated by computer software, for example, the BLAST algorithm can be used (Altschul et al. 1990. Journal of Molecular Biology 215:403-410; Karlin and Altschul. 1993. Proceedings of the National Academy of Sciences 90:5873-5877).

[0014] In a second aspect, the application provides an application of a protein encoded by the StSAUR30231 gene in inhibiting enzymatic browning of fresh-cut potatoes.

[0015] (A1) a protein consisting of the amino acid sequence shown in SEQ ID NO. 2 in the sequence listing;

[0016] (A2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein defined in (A1).

[0017] The protein defined in (A1) and (A2) can be artificially synthesized or synthesized by first synthesizing the encoding gene and then performing biological expression.

[0018] In order to facilitate the purification of the protein in (A1), a tag can be connected to the amino-terminal end or carboxyl-terminal end of the protein in (A1). The tag can be Poly-Arg (usually 6 RRRRR), Poly-His (usually 6 HHHHHH), FLAG (DYKDDDDK), Strep-tag II (WSHPQFEK) or c-myc (EQKLISEEDL).

[0019] In a third aspect, the application provides an application of a recombinant expression vector, a transgenic cell line or a genetically engineered bacterium containing the StSAUR30231 gene in inhibiting enzymatic browning of fresh-cut potatoes.

[0020] The recombinant expression vector can be constructed using existing plant expression vectors. The plant expression vectors include binary Agrobacterium vectors and vectors that can be used for plant microprojectile bombardment, such as pGreen0029, pCAMBIA3301, pCAMBIA1300, pBI121, pBin19, pCAMBIA2301, pCAMBIA1301-UbiN or other derived plant expression vectors. When the gene is used to construct a recombinant expression vector, any one of the enhanced, constitutive, tissue-specific or inducible promoters can be added before the transcription initiation nucleotide, such as the cauliflower mosaic virus (CaMV) 35S promoter, the ubiquitin gene Ubiquitin promoter (pUbi), the stress inducible promoter rd29A, etc., which can be used alone or in combination with other plant promoters; in addition, when the gene of the application is used to construct a recombinant expression vector, an enhancer can also be used, including a translation enhancer or a transcription enhancer.

[0021] In a fourth aspect of the present application, the StSAUR30231 gene, the protein encoded by the StSAUR30231 gene, the recombinant expression vector containing the StSAUR30231 gene, the transgenic cell line or the genetically engineered bacteria are used in any one of the following (1) or (2):

[0022] (1) plant breeding;

[0023] (2) regulating the browning resistance of plants.

[0024] In the above use, the plant is preferably potato.

[0025] In a fifth aspect of the present application, a method for inhibiting the enzymatic browning of fresh-cut potato is provided, which comprises the step of overexpressing the StSAUR30231 gene in potato.

[0026] In the above method, the overexpression of the StSAUR30231 gene in potato can be achieved by introducing the StSAUR30231 gene exogenously or upregulating the expression of the StSAUR30231 gene in the potato genome. The method for upregulating the expression of the StSAUR30231 gene in the potato genome comprises introducing a DNA fragment capable of activating or increasing the transcription level or translation level or protein activity of the StSAUR30231 gene, or controlling the synthesis of specific small RNA molecules to upregulate the accumulation of StSAUR30231 gene mRNA.

[0027] The specific small RNA molecules include microRNA (miRNA), small interfering RNA (siRNA) or artificial microRNA (amiRNA).

[0028] In a sixth aspect of the present application, a method for breeding potato with improved browning resistance is provided, which comprises the following steps:

[0029] The StSAUR30231 gene is introduced into the starting potato plant to overexpress the StSAUR30231 gene, and a transgenic potato plant is obtained; the browning resistance of the transgenic potato plant is higher than that of the starting potato plant.

[0030] In the above breeding method, the method for introducing the StSAUR30231 gene into the starting potato plant comprises the polyethylene glycol method, the Agrobacterium-mediated method or the gene gun bombardment method.

[0031] In a seventh aspect of the present application, a method for breeding a potato with reduced browning capacity is provided, comprising the following steps: inhibiting the expression of StSAUR30231 gene in the potato genome, and screening a potato plant with reduced browning capacity.

[0032] In the above method, the method for inhibiting the expression of StSAUR30231 gene in the potato genome comprises: mutating or knocking out all or part of the sequence of StSAUR30231 gene in the potato genome; or interfering with the expression of StSAUR30231 gene using interfering RNA; or silencing StSAUR30231 gene using a gene silencing system.

[0033] In an eighth aspect of the present application, a method for obtaining a potato plant carrying the StSAUR30231 gene is provided, comprising the following steps:

[0034] obtaining a plant cell containing StSAUR30231 gene by transgenic or genome editing means; and regenerating seedlings from the obtained plant cell.

[0035] Advantages of the present application:

[0036] The present application first clones the auxin response gene StSAUR30231 of potato, and transfers the gene into potato by Agrobacterium-mediated potato transformation method. It is proved through analysis that the browning degree of transgenic potato overexpressing StSAUR30231 gene is significantly reduced. The present application describes the biological significance of potato gene StSAUR30231, and provides useful data for quality improvement of other crops, which has great significance in production practice. BRIEF DESCRIPTION OF DRAWINGS

[0037] Figure 1 (a) is the browning of Kexin No. 4 (K4) and Kexin No. 13 (K13) potato 3 days after cutting; Figure 1 (b) is the expression amount change of StSAUR30231 gene of K4 and K13 potato 3 days after cutting.

[0038] Figure 2 (a) is the PCR identification of potato StSAUR30231 gene overexpression integration; Figure 2 (b) is the expression amount determination of potato StSAUR30231 overexpression.

[0039] Figure 3 (a) is the PCR identification of potato strain with CRISPR knockout of exogenous gene StSAUR30231; Figure 3 (b) is the second generation sequencing of potato strain with CRISPR knockout of exogenous gene StSAUR30231.

[0040] Figure 4 (a) is the fresh-cut browning phenotype of transgenic potato; Figure 4 (b) is the L* value of transgenic potato.

[0041] Figure 5 (a) is the polyphenol oxidase (PPO) activity of transgenic potato; Figure 5 (b) is the expression level of PPO gene.

[0042] Figure 6 is the tyrosine content of transgenic potato.

[0043] Figure 7 (a) is the 1,1-diphenyl-2-trinitrobenzene hydrazine (DPPH) free radical scavenging rate; Figure 7 (b) is the peroxidase (POD) activity; Figure 7 (c) is the malondialdehyde (MDA) content. DETAILED DESCRIPTION

[0044] It should be noted that the following detailed description is exemplary and is intended to provide further explanation of the present application. Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as would be understood by one of ordinary skill in the art to which the present application pertains.

[0045] As mentioned above, potato is prone to enzymatic browning after cutting, which seriously reduces the sensory quality and commodity value of fresh-cut potato. At present, there are few reports on using genetic engineering to improve the browning resistance of potato.

[0046] Therefore, the present application provides a potato SAUR gene StSAUR30231. After site-directed editing of the gene using the CRISPR-Cas system, the browning degree of potato is enhanced, and overexpression of the gene significantly improves the browning resistance of potato.

[0047] The present application first screens the StSAUR30231 gene according to the transcriptome sequencing (RNA-seq) of Xinke 4 (easily browning potato) and Xinke 13 (not easily browning potato), clones the full-length cDNA of StSAUR30231 gene from tetraploid “Desiree” potato, and performs functional verification in potato. Thus, the present application is proposed.

[0048] In order for those skilled in the art to more clearly understand the technical solutions of the present application, the technical solutions of the present application will be described in detail below in conjunction with specific examples.

[0049] The test materials used in the embodiments of the present application are all conventional test materials in the art, and can be purchased through commercial channels. The experimental methods not specified in detail are carried out according to the conventional test methods or according to the operation instructions recommended by the suppliers. Among them:

[0050] The potato materials used in the present application, potato Kexin No. 4, potato Kexin No. 13 and "Desiree" potato, are all existing potato varieties. The public can obtain them from the applicant within 20 years from the date of application for the purpose of repeating the present application.

[0051] Example 1: Method for obtaining potato anti-browning gene

[0052] In the present application, the easily browning variety potato Kexin No. 4 (K4) and the non-easily browning variety potato Kexin No. 13 (K13) are selected as experimental materials Figure 1 a), which are stored at 4℃ after fresh cutting, and sampled at 0 days and 3 days after cutting, and frozen in liquid nitrogen. The total RNA of the above samples is extracted according to the RNA extraction kit of Kangweishijie Company, and sent to Huada Gene for transcription sequencing. Transcriptome data analysis finds that compared with 0 days after cutting, 121 differential genes are not expressed or have no change in expression amount in Kexin No. 4 potato, but are significantly up-regulated in Kexin No. 13 potato. GO enrichment analysis is performed on these genes, and the "hormone response" pathway is screened, and StSAUR30231 with a higher differential fold (FC = 5.8) is selected as a candidate gene for research, and the expression pattern of the gene is determined again by qPCR Figure 1 b), confirming that the expression amount of the gene in the non-easily browning variety K13 is significantly higher than that in the easily browning variety K4, and we speculate that the StSAUR30231 gene may be related to the enzymatic browning of potato.

[0053] qPCR reaction, primers as follows:

[0054] StActin-F: CCTGTTCTACTCACCGAAGCACCTC; (SEQ ID NO. 3)

[0055] StActin-R: AGCATATCCCTCATAGATTGGGACA. (SEQ ID NO. 4)

[0056] StSAUR30231-F1: GGGTTGTCTTCCAGTATTGGTA; (SEQ ID NO. 5)

[0057] StSAUR30231-R1: GTGGCATGAGTTTCTTTGTCAA. (SEQ ID NO. 6)

[0058] qPCR reaction system and procedure are shown in Table 1.

[0059] Table 1: qPCR reaction system

[0060]

[0061] Example 2: Cloning of StSAUR30231 gene sequence

[0062] (1) Primer sequence

[0063] According to the potato genome database (http: / / http: / / spuddb.uga.edu / ), the CDS sequence of StSAUR30231 gene (PGSC0003DMG400030231) was searched, and primers were designed to amplify the full-length sequence of the gene CDS. The primer sequences are as follows:

[0064] StSAUR30231-F2:

[0065] 5'-gagaacacgggggactctagaATGGGTAGTGGAGATCACAAACACC-3'; (SEQ ID NO. 7)

[0066] StSAUR30231-R2: 5'-ggactgaccacccggggatccGGCCTTGTAGCACCAAGCAT-3'. (SEQ ID NO. 8)

[0067] (2) RNA extraction

[0068] Take the "Desiree" potato tuber sample, grind into powder in liquid nitrogen, use the OmniPlant RNA Kit (DNase I) kit of Kangwei Century Company to extract total RNA of the sample, the specific method is as follows:

[0069] 1. Homogenization treatment: Take 50-100 mg of plant tissue and grind it into powder in liquid nitrogen, add 500 μL of Buffer RLS (check whether β-mercaptoethanol is added before use), immediately vortex vigorously to mix.

[0070] 2. Centrifuge at 12,000 rpm (13,400 x g) for 2 min at 4°C.

[0071] 3. Transfer the supernatant to the filter column (Spin Columns FS) that has been loaded into the collection tube, centrifuge at 12,000 rpm at 4°C for 1 min, carefully aspirate the supernatant in the collection tube and transfer it to a new RNase-Free centrifuge tube (self-provided), try to avoid the tip touching the cell debris precipitate in the collection tube.

[0072] 4). Slowly add 0.5 times supernatant volume of absolute ethanol, mix well (precipitate may appear at this time), transfer the resulting solution and precipitate into the spin columns (Spin Columns RM) placed in the collection tubes. If the entire solution cannot be added to the spin columns at one time, please transfer in two times. Centrifuge at 12,000 rpm for 1 min at 4°C, discard the waste liquid, and place the spin columns back into the collection tubes.

[0073] 5). Add 350 μL Buffer RW1 to the spin columns RM, centrifuge at 12,000 rpm for 1 min at 4°C, discard the waste liquid, and place the spin columns back into the collection tubes.

[0074] 6). Prepare DNase I mixture: take 52 μL RNase-Free Water, add 8 μL 10x Reaction Buffer and 20 μL DNase I (1 U / μL) to it, mix well, and prepare a final volume of 80 μL of reaction solution.

[0075] 7). Directly add 80 μL of DNase I mixture to the spin columns, and incubate at 20-30°C for 15 min.

[0076] 8). Add 350 μL Buffer RW1 to the spin columns RM, centrifuge at 12,000 rpm for 1 min at 4°C, discard the waste liquid, and place the spin columns back into the collection tubes.

[0077] 9). Add 500 μL Buffer RW2 (check whether absolute ethanol is added before use) to the spin columns RM, centrifuge at 12,000 rpm for 1 min at 4°C, discard the waste liquid, and place the spin columns back into the collection tubes.

[0078] 10). Repeat step 9.

[0079] 11). Centrifuge at 12,000 rpm for 2 min at 4°C.

[0080] 12). Place the spin columns RM into new RNase-Free Centrifuge Tubes (1.5 mL), and add 30-50 μL RNase-Free Water dropwise to the middle part of the spin membrane, and place at room temperature for 2 min, centrifuge at 12,000 rpm for 1 min at 4°C, and store the resulting RNA solution at -70°C to prevent degradation.

[0081] (3) Reverse transcription (cDNA first strand synthesis)

[0082] The above sample RNA was reverse transcribed using the HiFiScript cDNA Synthesis Kit of Kangwei Century, and the system is shown in Table 2. After mixing, incubate at 42°C for 15 min, 85°C for 5 min, centrifuge briefly, and cool on ice. The product is used for subsequent gene cloning.

[0083] Table 2: cDNA first strand synthesis reaction system

[0084]

[0085] (4) PCR amplification of target gene StSAUR30231

[0086] Using the cDNA obtained above as a template, StSAUR30231-F2 (SEQ ID NO. 7) and StSAUR30231-R2 (SEQ ID NO. 8) as amplification primers, the PCR reaction system shown in Table 3 was prepared to clone the CDS sequence (390 bp) of StSAUR30231. The PCR reaction program is 98°C, 2 min; 98°C, 10 s; 98°C, 30 s; 72°C, 30 s, cycle 35 times; 72°C, 10 min.

[0087] Table 3: PCR reaction system

[0088]

[0089]

[0090] The PCR amplification product was detected by 1% agarose gel electrophoresis, and then the full-size gold Quick Gel Extraction Kit was used to cut and recover the target band.

[0091] Example 3: Construction of plant expression vector PBI-StSAUR30231

[0092] The expression vector PBI121 was linearized using XbaI and BamH1 restriction enzymes, and then the target fragment obtained by gel recovery was connected with the linearized vector PBI121 using the ClonExpress II One Step Cloning Kit of Novagen. The connection system is shown in Table 4. Mix, connect at 37°C for 30 min, cool on ice, and store at -20°C.

[0093] Table 4: Homologous recombination linkage system

[0094] Table 4 Reaction mixture of homologous recombination linkage

[0095]

[0096] The connection product was then transformed into E. coli DH5a. After the strain grew, single colonies were picked and cultured at 37°C, 200 rpm overnight, then identified by PCR with the corresponding primers, and the bacterial liquid of positive clones was sent to a sequencing company (Shenguo Bio) for sequencing. The plasmid of the strain with correct sequencing was extracted, and then the recombinant plasmid was heat-shocked and transformed into Agrobacterium AGL1+VirG.

[0097] (5) Single colonies were picked for bacterial liquid PCR identification, and the recombinant plasmid successfully transformed into Agrobacterium was obtained.

[0098] Example 4: Construction of CRISPR Cas9 knockout vector of StSAUR30231 gene

[0099] The CRISPR vector pCAMBIA1301 was used as the basic vector, CRISPR-P 2.0 (https: / / github.com / charlesxuLab / CRISPR-P) was used to design sgRNA sequences, and g1 and g2, g3 and g4 were respectively connected to two pCAMBIA1301 vectors to construct expression vectors. http: / / crispr.hzau.edu.cn / CRISPR2 / ) to be as follows g1: CCATCAACACGGTCATGGGATAA, (SEQ ID NO. 9)

[0100] g2: GAAATGATAGGCATCCCAAAGGG; (SEQ ID NO. 10)

[0101] g3: AAAGGGTTGTCTTCCAGTATTGG, (SEQ ID NO. 11)

[0102] g4: CCAGTATTGGTAGGTCATGATGG. (SEQ ID NO. 12)

[0103] Example 5: Genetic transformation of potato

[0104] (1) Potato transformation medium

[0105] (1) Potato transformation medium

[0106] Mediums were prepared according to the method of Li et al. (Li et al., 2016). M1 medium: MS + 0.2 mg / L NAA (a-naphthalene acetic acid) + 0.02 mg / L GA3 (gibberellin) + 2.5 mg / L ZT (zeatin); M2: M1 medium + 100 mg / L Tim (timetzine) + 50 mg / L Kan (kanamycin); M3 medium: MS + 0.02 mg / L NAA (a-naphthalene acetic acid) + 0.02 mg / L GA3 (gibberellin) + 2.0 mg / L ZT (zeatin) + 100 mg / L Tim (timetzine) + 50 mg / L Kan (kanamycin); M4 medium: MS + 100 mg / L Tim (timetzine) + 50 mg / L Kan (kanamycin).

[0107] (2) Genetic transformation of potato

[0108] Genetic transformation of potato was performed according to the method of Li et al. (Li et al., 2016). Vigorous Desiree potato seedlings were selected and their stems were cut into about 0.5 cm explants, which were then infected in Agrobacterium (OD 600 = 0.6-0.8) for 20 min, and then placed in M1 medium at 28°C in the dark for 2 d. The explants were then transferred to M2 medium and cultured in an artificial climate box at 23°C, light intensity 1500 lux, light cycle 16 h / 8 h for 10-12 d. The well-grown calli were transferred to M3 medium and cultured for about 1 month (during which the stems were transferred to new M3 medium every 2 weeks). The regenerated shoots were then cut off and transferred to M4 medium.

[0109] (3) Planting of potato

[0110] The rooting lines overexpressing and knocking out StSAUR30231 genes were planted in sterile soil and cultured in a tissue culture room (temperature 23°C, humidity 70%, light intensity 1500 lux). After 5 months of growth, the leaves were harvested when they turned yellow and withered (reached commercial maturity).

[0111] Example 6: Positive identification of transgenic potato

[0112] 1. Positive identification of potato overexpressing StSAUR30231

[0113] 1.1 PCR identification of integration of potato StSAUR30231 gene overexpression

[0114] (1) The genomic DNA of potato leaves was extracted using NuClean Plant Genomic DNA Kit from Kangweishiji Company, and the specific steps were as follows:

[0115] 1) Take about 100 mg of fresh plant tissue or about 20 mg of dry weight, add liquid nitrogen and grind thoroughly.

[0116] 2) Collect the ground powder into a centrifuge tube (provided), add 400 μL Buffer LP1 and 6 μL RNase A (10 mg / mL), vortex for 1 min, and let stand at room temperature for 10 min to allow complete lysis.

[0117] 3) Add 130 μL Buffer LP2, mix well, and vortex for 1 min.

[0118] 4) Centrifuge at 12,000 rpm (13,400 x g) for 5 min, and transfer the supernatant to a new centrifuge tube (provided).

[0119] 5) Add 1.5 volumes of Buffer LP3 (check before use that anhydrous ethanol has been added), mix well (e.g. 500 μL of filtrate + 750 μL of Buffer LP3).

[0120] 6) Transfer the solution and the pellet obtained in the previous step to the adsorption column placed in a collection tube, centrifuge at 12,000 rpm for 1 min, discard the waste in the collection tube, and place the adsorption column back in the collection tube.

[0121] 7) Add 500 μL of Buffer GW2 to the adsorption column, centrifuge at 12,000 rpm for 1 min, discard the waste in the collection tube, and place the adsorption column back in the collection tube.

[0122] 8) Repeat step 7.

[0123] 9) Centrifuge at 12,000 rpm for 2 min, discard the waste in the collection tube. Let the adsorption column stand at room temperature for a few minutes to dry completely.

[0124] 10) Place the adsorption column in a new centrifuge tube, and add 50-100 μL of Buffer GE dropwise to the middle of the adsorption membrane, let stand at room temperature for 2-5 min, centrifuge at 12,000 rpm for 1 min, and collect the DNA solution. Store the DNA at -20°C.

[0125] (2) PCR identification of the extracted wild-type and overexpressed potato DNA was performed using primers StSAUR30231-F2 and StSAUR30231-R2 (as described in Example 1), and the results are shown in Figure (2a). The recombinant plasmid and wild-type (WT) genomic DNA were used as positive control (PC) and negative control (NC), respectively.

[0126] 1.2 Determination of the expression level of overexpressed potato tuber StSAUR30231

[0127] The wild type and overexpression potato tuber RNA was extracted, reverse transcribed into cDNA, and then the expression amount of StSAUR30231 was detected by fluorescence quantitative PCR using UltraSYBR Mixture of Kangweishijie Company Figure 2 b), the reaction system is shown in Table 1, and the reaction procedure is as follows: 95℃, 10min; 95℃, 15s; 60℃, 1min, 38 cycles; 95℃, 15s; 60℃, 1min; 95℃, 15s; 60℃, 15s. StActin-F and StActin-R genes are the internal reference genes of potato, and the primer sequences are as described in Example 1.

[0128] As can be seen from Figure (2b), compared with the wild type, the StSAUR30231 gene in the tubers of overexpression potato lines 0E1 and OE2 is overexpressed by 4-5 times.

[0129] 2, Detection of CRISPR knockout potato lines of StSAUR30231

[0130] (1) PCR detection

[0131] According to the method of extracting DNA in 1.1, the rooted potato leaf DNA was extracted, and the rooted potato seedlings were subjected to PCR positive identification using the following primer pairs. cas9-F: GTTCATCAAGCCGATTCTGG (SEQ ID NO. 13); cas9-R: GCTTCCTGCTCAGCCTCCC (SEQ ID NO. 14). The recombinant plasmid and wild type (WT) genomic DNA were used as positive control (PC) and negative control (NC), respectively, and the detection results are as follows Figure 3 a).

[0132] (2) Second generation sequencing

[0133] The above positive lines were subjected to second generation sequencing using the following primers to detect the mutation type. StSAUR30231-F3: TTACCATTCAACAACACCCTCAAA (SEQ ID NO. 15); StSAUR30231-R3: ACCAAGCATGGTGGTTATGGT (SEQ ID NO. 16). The second generation sequencing results are as follows Figure 3 b), it can be seen that m1 and m2 are both homozygous mutants, and m2 is a frameshift mutant.

[0134] 3, Brown phenotype identification of potato tubers overexpressing and knocking out StSAUR30231 gene

[0135] 3.1 Verification of brown phenotype of transgenic potato

[0136] After fresh-cut treatment, part of the harvested wild-type and transgenic tubers were sampled for physiological index determination, and the other part was stored in a 4°C refrigerator and the browning degree was observed. As can be seen from Figures (4a-b), compared with wild-type (WT), the browning degree of potato (OE1, OE2) after overexpression of StSAUR30231 gene was significantly reduced, while the knockout lines (m1, m2) showed a phenotype of aggravated browning.

[0137] 3.2 Determination of browning-related physiological indexes of transgenic potatoes

[0138] Polyphenol oxidase (PPO) is a key enzyme for enzymatic browning of potatoes (Queiroz et al., 2008), and tyrosine is the main substrate for enzymatic browning of potatoes (Goyer and Pelle, 2018), so we determined the PPO activity and its gene expression and tyrosine content of transgenic potatoes. The PPO activity was determined according to the method of Dong et al. (2015) with slight modifications; the tyrosine content was determined according to the method of Meng et al. (2021). The results showed that overexpression of StSAUR30231 reduced the PPO activity and gene expression of potato tubers, and reduced the tyrosine content; while the PPO activity and gene expression of knockout lines were increased, and the tyrosine content was increased Figure 5 a-b; Figure 6 ).

[0139] Antioxidant capacity is also an important factor affecting the browning and quality of fresh-cut fruits and vegetables (Toivonen and Brummell, 2008). Therefore, we also determined the DPPH radical scavenging rate, POD activity and MDA content of transgenic potato tubers. The method for determining the DPPH radical scavenging rate was modified according to the method of Kenny and O'Beirne (2010), the method for determining the POD activity was modified according to the method of Yang et al. (2009), and the method for determining the MDA content was modified according to the method of Barman et al. (2014). The results showed that overexpression (mutation) of StSAUR30231 significantly increased (decreased) the DPPH radical scavenging rate and POD activity of potatoes, decreased (increased) the MDA content, and reduced (increased) the membrane lipid peroxidation level Figure 7 a-c).

[0140] In summary, StSAUR30231 gene can significantly inhibit the browning of fresh-cut potatoes, and its mechanism includes reducing PPO activity and its gene expression, reducing the content of tyrosine, and improving antioxidant capacity.

[0141] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. The present application can have various modifications and changes for those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application. SEQUENCE LISTING <110> Shandong Agricultural University <120> Application of potato auxin response gene StSAUR30231 in inhibiting enzymatic browning of fresh-cut potato <130> 2021 <160> 16 <170> PatentIn version 3.5 <210> 1 <211> 390 <212> DNA <213> Solanum tuberosum L. <400> 1 atgggtagtg gagatcacaa acaccaccat caccatttga atttgcatgt tcaagtgcat 60 ctacctcaca tccattttca ccatcaccat caccatcaac acggtcatgg gataaaagaa 120 atgataggca tcccaaaggg ttgtcttcca gtattggtag gtcatgatgg tgaggaacaa 180 cacaagttca taatcccagt gatatacatt aaccatccac ttttcacaca attgttgaaa 240 ggtaatgaag aagagtgtga acttcatcat gatggtccta tgaatatccc ttgtcatatc 300 gaagaatttc gatacgttga aggtatgatt gacaaagaaa ctcatgccac cggacaccat 360 aaccaccatg cttggtgcta caaggcctga 390 <210> 2 <211> 129 <212> PRT <213> Solanum tuberosum L. <400> 2 Met Gly Ser Gly Asp His Lys His His His His His Leu Asn Leu His 1 5 10 15 Val Gln Val His Leu Pro His Ile His Phe His His His His His His 20 25 30 Gln His Gly His Gly Ile Lys Glu Met Ile Gly Ile Pro Lys Gly Cys 35 40 45 Leu Pro Val Leu Val Gly His Asp Gly Glu Glu Gln His Lys Phe Ile 50 55 60 Ile Pro Val Ile Tyr Ile Asn His Pro Leu Phe Thr Gln Leu Leu Lys 65 70 75 80 Gly Asn Glu Glu Glu Cys Glu Leu His His Asp Gly Pro Met Asn Ile 85 90 95 Pro Cys His Ile Glu Glu Phe Arg Tyr Val Glu Gly Met Ile Asp Lys 100 105 110 Glu Thr His Ala Thr Gly His His Asn His His Ala Trp Cys Tyr Lys 115 120 125 Ala <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <400> 3 cctgttctac tcaccgaagc acctc 25 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <400> 4 agcatatccc tcatagattg ggaca 25 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <400> 5 gggttgtctt ccagtattgg ta 22 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <400> 6 gtggcatgag tttctttgtc aa 22 <210> 7 <211> 46 <212> DNA <213> Artificial Sequence <400> 7 gagaacacgg gggactctag aatgggtagt ggagatcaca aacacc 46 <210> 8 <211> 41 <212> DNA <213> Artificial Sequence <400> 8 ggactgacca cccggggatc cggccttgta gcaccaagca t 41 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <400> 9 ccatcaacac ggtcatggga taa 23 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <400> 10 gaaatgatag gcatcccaaa ggg 23 <210> 11 <211> 23 <212> DNA <213> Artificial Sequence <400> 11 aaagggttgt cttccagtat tgg 23 <210> 12 <211> 23 <212> DNA <213> Artificial Sequence <400> 12 ccagtattgg taggtcatga tgg 23 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <400> 13 gttcatcaag ccgattctgg 20 <210> 14 <211> 19 <212> DNA <213> Artificial Sequence <400> 14 gcttcctgct cagcctccc 19 <210> 15 <211> 24 <212> DNA <213> Artificial Sequence <400> 15 ttaccattca acaacaccct caaa 24 <210> 16 <211> 21 <212> DNA <213> Artificial Sequence <400> 16 ACCAAGCATGGTGGTTATGGT 21

Claims

1. StSAUR30231 Application of a gene in inhibiting enzymatic browning of fresh-cut potato; the StSAUR30231 Gene is a nucleic acid molecule as shown in i) or ii): i) the nucleotide sequence is the nucleic acid molecule as shown in SEQ ID NO. 1 ; ii) a nucleic acid molecule encoding the amino acid sequence as shown in SEQ ID NO. 2, except i).

2. StSAUR30231 Use of a protein encoded by a gene in inhibiting enzymatic browning of fresh-cut potatoes; the protein being a protein as defined in any one of (A1) or (A2): (A1 ) a protein consisting of the amino acid sequence as shown in SEQ ID NO. 2 of the sequence listing; (A2) a fusion protein obtained after attaching a tag to the N-terminus and / or C- terminus of the protein defined in (A1 ).

3. comprising StSAUR30231 The recombinant expression vector of the gene, the transgenic cell line or the genetically engineered bacteria are applied to inhibit the enzymatic browning of fresh-cut potatoes. The StSAUR30231 Gene is a nucleic acid molecule as indicated in i) or ii): i) the nucleotide sequence is the nucleic acid molecule as shown in SEQ ID NO. 1 ; ii) a nucleic acid molecule encoding the amino acid sequence as shown in SEQ ID NO. 2, except i).

4. StSAUR30231 gene, StSAUR30231 protein encoded by the gene, a cell containing StSAUR30231 application of the recombinant expression vector of the gene, the transgenic cell line or the genetically engineered bacteria in improving the browning resistance of potatoes; The StSAUR30231 The gene is a nucleic acid molecule as indicated in i) or ii): i) the nucleotide sequence is the nucleic acid molecule as shown in SEQ ID NO. 1 ; ii) a nucleic acid molecule encoding the amino acid sequence as shown in SEQ ID NO. 2, except i). StSAUR30231 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

2.

5. A method of inhibiting enzymatic browning of fresh cut potatoes, characterized in that, comprising steps for overexpression of genes in potato StSAUR30231 steps for overexpression of genes in potato The StSAUR30231 The gene is a nucleic acid molecule as indicated in i) or ii): i) the nucleotide sequence is the nucleic acid molecule as shown in SEQ ID NO. 1 ; ii) a nucleic acid molecule encoding the amino acid sequence as shown in SEQ ID NO. 2, except i).

6. A method for breeding a potato having improved resistance to browning, characterized by, comprising the following steps Will StSAUR30231 The gene was transferred into the potato starting plant, enabling... StSAUR30231 Gene overexpression was used to obtain transgenic potato plants; the transgenic potato plants showed higher resistance to browning than the original potato plants. The StSAUR30231 Gene is a nucleic acid molecule as indicated in i) or ii): i) the nucleotide sequence is the nucleic acid molecule as shown in SEQ ID NO. 1 ; ii) a nucleic acid molecule encoding the amino acid sequence as shown in SEQ ID NO. 2, except i).

7. The breeding method according to claim 6, characterized by, Methods for introducing genes into potato starting plants include polyethylene glycol, Agrobacterium-mediated or biolistic methods. StSAUR30231 Methods for introducing genes into potato starting plants include polyethylene glycol, Agrobacterium-mediated or biolistic methods.

Images