Application of XRCC5 & BCL11B gene inhibitors in the preparation of drugs for treating T-ALL
By developing inhibitors of XRCC5 and BCL11B genes, using siRNA technology to inhibit the expression of these genes, solving the drug resistance and recurrence problems in T-ALL treatment, significantly promoting the apoptosis of T-ALL cells, and providing a new and effective therapeutic strategy.
Patent Information
- Application Number
- CN202310110227.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-02-10
- Publication Date
- 2025-06-20
- Estimated Expiration
- 2043-02-10
AI Technical Summary
The prior art is difficult to effectively treat T-ALL, especially in the face of drug resistance and recurrence, targeted and immunotherapy methods are lacking.
Develop inhibitors of XRCC5 and BCL11B genes, inhibit the expression of these genes through molecular techniques such as siRNA, and thus prepare drugs for the treatment of T-ALL.
It significantly promotes the apoptosis of T-ALL tumor cells, provides a new and effective therapeutic strategy, can reduce the drug resistance problem of traditional therapeutic drugs, and has important clinical application prospects.
Smart Images

Figure CN116270709B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedicine, and particularly relates to the application of XRCC5&BCL11B gene inhibitors in the preparation of drugs for treating T-ALL. Background Art
[0002] Acute T-lymphoblastic leukemia (T-ALL) is a malignant and invasive hematological tumor, in which the malignant transformation of developing T-cell precursors is caused by the abnormal accumulation of oncogenes. Although current combination chemotherapy has significantly improved the cure rate of T-ALL, approximately 20% of children and 50% of adult patients still die from drug resistance or recurrence. In addition, compared with B-lymphocyte tumors, T-ALL has high heterogeneity and lacks targeted and immunotherapeutic means. Therefore, there is an urgent need to find new effective treatment strategies for T-ALL.
[0003] In recent years, using RNA interference technology to transduce chemically synthesized small interfering RNA (siRNA) into specific cells to silence the expression of related genes is one of the most effective means for studying gene functions and also one of the most attractive methods for targeted gene therapy. Selecting specific target genes to synthesize effective siRNAs and choosing appropriate transfection methods to make them act efficiently in host cells are the key points for implementing this targeted therapy measure. The rapid development of high-throughput sequencing technology has provided more and more accurate predictions for the diagnosis and prognosis of T-ALL patients, thus enabling more effective precision treatment for patients. Summary of the Invention
[0004] The primary object of the present invention is to provide the application of XRCC5&BCL11B gene inhibitors in the preparation of drugs for treating T-ALL;
[0005] Another object of the present invention is to provide an siRNA capable of inhibiting the expression of XRCC5 or BCL11B gene.
[0006] The objects of the present invention are achieved by the following technical solutions:
[0007] Application of XRCC5 and BCL11B gene inhibitors in the preparation of drugs for treating T-ALL.
[0008] The inhibitor is a molecule or preparation composition prepared or screened by using XRCC5 and BCL11B as targets and having an inhibitory effect on them, and can be at least one of siRNA, shRNA, dsRNA, miRNA, cDNA, antisense RNA / DNA, low molecular compounds, peptides or antibodies.
[0009] Preferably, the inhibitor is siRNA. Among them, the sense strand sequences of siRNA that inhibits XRCC5 expression are one of the following:
[0010] si-XRCC5-1, 5’-CGUGGGCUUUACCAUGAGUAATT-3’;
[0011] si-XRCC5-2, 5’-CCUCAUAUCAAGCAUAACUAUTT-3’.
[0012] The sense strand sequence of siRNA that inhibits BCL11B expression is as follows:
[0013] si-BCL11B, 5’-GCACAACAUGCAAGCAGCCCUUCAA-3’.
[0014] A drug for treating T-ALL, comprising the above siRNA that can inhibit XRCC5 expression and the siRNA that can inhibit BCL11B expression.
[0015] The present invention has the following advantages and effects compared with the prior art:
[0016] 1. The present invention first proposes the application of XRCC5 combined with BCL11B as a target in the preparation of drugs for treating T-ALL, providing a new effective treatment strategy for T-ALL.
[0017] 2. The siRNA that jointly inhibits the expression of XRCC5 and BCL11B in the present invention can significantly promote the apoptosis of T-ALL tumor cells.
[0018] 3. The siRNA sequence of the present invention is of great significance for developing new gene drugs for treating T-ALL and improving the treatment effect of T-ALL, and can significantly reduce the drug resistance problem of traditional treatment drugs, and has great application prospects and economic value. Description of the Drawings
[0019] Figure 1It is a partial experimental result diagram of Example 1; among them, A&B are the gene expression conditions and correlation analysis of XRCC5 and BCL11B in T-ALL specimens and healthy control specimens in the specimen library of Jinan University; C&D are the gene expression conditions and correlation analysis of T-ALL specimens and healthy control specimens in the GEO database; E is a statistical result diagram of the apoptosis rate analyzed in three repeated experiments after siRNA transfection of CCRF and JURKAT cells; F&G are the protein expressions of XRCC5 and BCL11B in the T-ALL cell lines CCRF and JURKAT treated with the chemotherapeutic drugs doxorubicin (DOX) and vincristine (VCR) at different time points. Detailed implementation mode
[0020] The present invention will be further described in detail below in conjunction with examples and drawings, but the implementation modes of the present invention are not limited thereto.
[0021] Example 1
[0022] (1) Add 1 ml of TRIzol reagent to 5-10×10 6 Personal T-ALL leukemia cells (cell lines CCRF-CEM and JURKAT).
[0023] (2) Total RNA extraction
[0024] 2.1 Place the treated sample on ice. After reacting for 5 minutes, add 0.2 ml of chloroform, mix well (for 15 seconds), then place on ice for 2-3 minutes, and centrifuge at low temperature and high speed (2-8 °C, 12000g) for 15-30 minutes;
[0025] 2.2 Carefully aspirate the upper layer liquid (about 50% of the total volume) and transfer it to a new 1.5 ml tube. Add 0.5 ml of isopropanol and mix well. After placing on ice for 10 minutes, centrifuge at low temperature and high speed for 10-20 minutes;
[0026] 2.3 Discard the supernatant and wash twice with 1 ml of 75% ethanol (-20 °C) (2-8 °C, 10000g). Each time, mix well for 30 seconds and then centrifuge for 5-10 minutes;
[0027] 2.4 Discard the supernatant and centrifuge once more to remove the remaining ethanol;
[0028] 2.5 Dry the washed sample in a low-temperature vacuum centrifuge for 5-10 minutes;
[0029] 2.6 Add 50 μl of ultrapure water (Biotecx BL-5700) (can be appropriately increased or decreased as the situation requires) and mix well.
[0030] 2.7 Dilute 2 μL of the RNA solution to 400 μL, and detect the optical density of the sample at a wavelength of 260 nm in an ultraviolet spectrophotometer to estimate the purity and content of the sample (1 OD A260nm = 40 μg / mL), total RNA amount = OD number × 400 μg;
[0031] 2.8 After adding 0.1 volume (5 μL) of 3M NaAC (sodium acetate) and 2 volumes of ethanol (100 μL) to the RNA sample, store it at -70 °C for later use.
[0032] (3) RT-PCR
[0033] 3.1 Mix 500 ng of RNA, 0.5 μL of oligo(dT) (0.5 μg / reaction), 0.5 μL of random primer (0.5 μg / reaction) and RNase-free double-distilled water (ddH2O) (up to 5 μL) in proportion, incubate at 70 °C for 5 minutes, and then quickly cool on ice for 5 minutes;
[0034] 3.2 Add 4.0 μL of GoScriptTM 5× reaction buffer, 1.7 μL of MgCl2 (final concentration 2.0 mM), 1.0 μL of 0.5 mM dNTP, 0.3 μL of ribonuclease inhibitor (20 U), 1.0 μL of reverse transcriptase and ddH2O, with a total volume of 15 μL;
[0035] 3.3 After mixing, incubate the 20 μL sample at 42 °C for 60 minutes, and then inactivate at 70 °C for 15 minutes;
[0036] 3.4 Finally, dilute with 80 μL of ddH2O and store at -20 °C.
[0037] (4) qRT-PCR
[0038] 4.1 Prepare a 20 μL system for qRT-PCR as follows: 10 μL of 2× Mix, 0.5 μL of forward primer (10 μM), 0.5 μL of reverse primer (10 μM), 1 μL of cDNA and 8 μL of RNase-free ddH2O;
[0039] The sequences of the primers used are as follows:
[0040] XRCC5-F: 5'-GTTCTAAAGGTCTTTGCAGCAAGA-3'
[0041] XRCC5-R: 5'-AAAAGCCACGCCGACTTGAGGA-3'
[0042] ACTB-F: 5'-TTGTTACAGGAAGTCCCTTGCC-3'
[0043] ACTB-R: 5'-ATGCTATCACCTCCCCTGTGTG-3'
[0044] 4. The program settings for qRT-PCR are as follows: After treatment at 95°C for 15 minutes, 45 cycles are carried out with 10 s at 95°C to 20 s at 60°C.
[0045] (5) siRNA transfection
[0046] 5.1 Design and synthesis of siRNA
[0047] Search for the XRCC5 gene sequence (ACCESSION NM_021141.4) and BCL11B gene sequence (ACCESSION NM_138576.4) in GenBank (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi), and then design siRNA against XRCC5 online according to the StealthTM RNAi design rules provided by Invitrogen (www.invitrogen.com). The specific sense strand sequences of the siRNA involved in the present invention are respectively:
[0048] si-XRCC5-1, 5'-CGUGGGCUUUACCAUGAGUAATT-3';
[0049] si-XRCC5-2, 5'-CCUCAUAUCAAGCAUAACUAUTT-3';
[0050] si-BCL11B, 5'-GCACAACAUGCAAGCAGCCCUUCAA-3'.
[0051] The above siRNA and siNC (siN0000001, sequence: UUC UCC GAA CGU GUC ACG UTT) are all chemically synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0052] 5.2 Prepare the T-ALL leukemia cell line CCRF-CEM or JURKAT in the logarithmic growth phase
[0053] Inoculate CCRF-CEM or JURKAT cells into RPMI1640 medium containing 10% (v / v) newborn bovine serum, 100 U / mL penicillin and 100 U / mL streptomycin, and continuously culture at 37°C in an incubator containing 5% (v / v) CO2. Subculture once every 2 - 3 days to obtain CCRF-CEM or JURKAT cells in the logarithmic growth phase.
[0054] 5.3 Neon Electroporation of siRNA
[0055] A. Collect the CCRF-CEM or JURKAT cells in the logarithmic growth phase prepared in step (2), centrifuge at 200 g for 10 min, and completely remove the supernatant; 5 B. Resuspend the CCRF-CEM or JURKAT cells with 20 μL of Buffer R and 2 μL of the corresponding 20 μM siRNA (XRCC5 group: 1 μL of si-XRCC5-1 + 1 μL of si-XRCC5-2; BCL11B group: 2 μL of si-BCL11B; XRCC5 + BCL11B group: 1 μL of si-XRCC5-1 or 1 μL of si-XRCC5-2 + 1 μL of si-BCL11B);
[0056] C. Start the JURKAT electroporation program (1450 V, 10 ms, 3 pulses);
[0057] D. After the program is completed, inoculate the transfected cell solution into a 6-well plate with a final volume of 3 mL;
[0058] E. Incubate in an incubator for 48 hours.
[0059] E. Incubate in an incubator for 48 hours.
[0060] (6) Detect the expression levels of XRCC5 and BCL11B in the transfected cells
[0061] Refer to step (1).
[0062] (7) Detect cell apoptosis
[0063] 7.1 Centrifuge and wash with pre-cooled PBS to collect the electroporated cells.
[0064] 7.2 Dilute 5×Binding Buffer with double-distilled water to 1× working solution, and resuspend the cells with 500 μL of 1× Binding Buffer.
[0065] 7.3 Add 5 μL of Annexin V-APC and 10 μL of PI to each tube.
[0066] 7.4 Gently vortex and mix well, then incubate at room temperature in the dark for 5 minutes.
[0067] 7.5 Analyze on the machine.
[0068] 7.6 Export the flow cytometry results through Flowjo software.
[0069] (8) Detect protein level expression
[0070] 8.1 Wash gently once with sterile PBS, centrifuge at 250 g for 5 min to collect cells, and add lysis buffer (containing protease inhibitor) at 1 * 10 7 cells / mL RIPA, place on ice for sufficient lysis, centrifuge at high speed at 4 °C for 10 min, collect the supernatant to obtain total protein;
[0071] 8.2 Prepare 10% SDS-PAGE gel (Table 1)
[0072] Table 1. 10% SDS-PAGE gel formulation
[0073]
[0074] 8.3 SDS-PAGE electrophoresis: The sample loading volume per well is 10 μg, constant voltage 80 V for 20 min; then change to 110 V for 70 min.
[0075] 8.4 Semi-dry transfer: Cut a 6 cm * 8 cm PVDF membrane in advance and activate it with methanol, place it in the order of sponge paper, PVDF membrane, separation gel and sponge paper to avoid generating bubbles; the transfer conditions are: constant voltage 20 V for 30 min.
[0076] 8.5 Blocking: After the transfer is completed, take out the membrane and place it in the blocking solution of 5% skim milk powder, shake on a shaker at room temperature for 1 h;
[0077] 8.6 Primary antibody incubation: Cut the PVDF membrane according to the indicated position of the protein Maker, and then put it into the diluted corresponding primary antibody, incubate on a shaker at 4 °C overnight;
[0078] 8.7 Secondary antibody incubation: Recover the primary antibody the next day, wash the membrane 4 times with 1×TBST, 8 min each time; incubate with the corresponding secondary antibody (diluted 1:10000), incubate on a shaker at room temperature for 1 h;
[0079] 8.8 ECL color development: Recover the secondary antibody, and wash the membrane 3 times with 1×TBST, 8 min each time; Prepare the developing solution according to A solution: B solution: ddH2O = 1:1:2, evenly drip the developing solution on the membrane and put it into UVI Alliance.
[0080] 8.9 Develop and take pictures in a gel imager.
[0081] The results are as Figure 1As shown. Among them, A&B is the gene expression and correlation analysis of XRCC5 and BCL11B in T-ALL specimens and healthy control specimens. It can be seen that XRCC5 and BCL11B are significantly highly expressed in T-ALL and are positively correlated. In addition, consistent results (C&D) can also be obtained by analyzing the T-ALL and healthy control samples in the GEO database. E is the statistical result graph of the apoptosis rate after analyzing the transfection of siRNA into CCRF-CEM and JURKAT cells in three repeated experiments. It can be seen that the combined siRNA of XRCC5 and BCL11B (inhibition rate 35.4±4.7%; 25.4±4.9%) can more significantly promote the apoptosis of T-ALL cells than single-gene siRNA (single XRCC5 inhibition rate 14.6±0.8%; 7.2±1.2%, single BCL11B inhibition rate 20.5±8.5%; 17.3±4.2%). F&G are the protein expressions of XRCC5 and BCL11B in the T-ALL cell lines CCRF and JURKAT treated with the chemotherapeutic drugs doxorubicin (DOX) and vincristine (VCR) at different time points. It can be seen that the expression levels of XRCC5 and BCL11B both decrease with the prolongation of the treatment time of the T-ALL cell lines induced by chemotherapeutic drugs.
[0082] The above experimental results illustrate that the XRCC5-specific siRNA provided by the present invention combined with the BCL11B-specific siRNA can more significantly induce the apoptosis of T-ALL cells.
[0083] The above embodiments are the preferred embodiments of the present invention, but the embodiments of the present invention are not limited by the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.
Claims
1. Use of inhibitors of XRCC5 and BCL11B genes in the preparation of a drug for treating T-ALL, characterized in that: The T-ALL refers to acute T-lymphoblastic leukemia; The inhibitor is siRNA. Among them, the sense strand sequence of siRNA that inhibits XRCC5 expression is one of the following: si-XRCC5-1, 5’- CGUGGGCUUUACCAUGAGUAATT -3’; si-XRCC5-2, 5’- CCUCAUAUCAAGCAUAACUAUTT -3’; The sense strand sequence of siRNA that inhibits BCL11B expression is as follows: si-BCL11B, 5’- GCACAACAUGCAAGCAGCCCUUCAA -3’.
2. A drug for treating T-ALL, characterized in that: It contains the siRNA that can inhibit XRCC5 expression and the siRNA that can inhibit BCL11B expression described in claim 1.