Use of circ_0002186 in screening drugs for lung epithelial cell aging and radiation-induced pulmonary fibrosis

Abstract

The application discloses an application of Circ_0002186 in screening of drugs for lung epithelial cell aging and radiation-induced pulmonary fibrosis, and belongs to the field of medical preparations. The application provides an application of Circ_0002186 or a substance for regulating gene expression of the Circ_0002186 in regulating radiation-induced lung injury of animals, wherein the Circ_0002186 is a CircRNA encoded by a DNA molecule with a nucleotide sequence shown in SEQ ID No. 1. The application explores the role and mechanism of Circ_0002186 in ionizing radiation-induced lung epithelial cell aging from a cell level, and explores the role of Circ_0002186 in radiation-induced pulmonary fibrosis from an animal level, and determines the potential value of Circ_0002186 as a therapeutic target, which provides a new basic theory and experimental basis for clinical prevention and treatment of radiation-induced pulmonary fibrosis.

Description

Technical Field

[0001] This invention belongs to the field of medical preparations, specifically relating to the application of Circ_0002186 in screening drugs for lung epithelial cell senescence and radiation-induced pulmonary fibrosis. Background Technology

[0002] Radiation therapy is one of the main methods for radical or palliative treatment of thoracic malignancies such as lung cancer and breast cancer, playing a crucial role in controlling tumor progression. Radiation therapy for thoracic tumors can expose lung tissue to radiation doses exceeding its biological effect threshold, leading to varying degrees of tissue damage. Radiation-induced lung injury is the most significant complication of radiation therapy. Its high incidence limits the total radiation dose to the tumor, thus reducing the effectiveness of radiation therapy. Severe radiation-induced lung injury significantly increases the risk of death, mainly including early-stage radiation pneumonitis and late-stage radiation-induced pulmonary fibrosis. Since pulmonary fibrosis is irreversible damage, once it occurs, it poses a serious threat to the patient's quality of life and life. Furthermore, current treatment for radiation-induced pulmonary fibrosis mainly relies on symptomatic therapy, lacking highly effective and low-toxicity preventative measures, which presents a significant challenge to its prevention and treatment.

[0003] Pulmonary epithelial cell senescence is considered an important physiological process leading to pulmonary fibrosis and one of the main biological responses of lung cells to ionizing radiation damage. After ionizing radiation irradiation, lung epithelial cells undergo senescence-related damage, resulting in a decrease in cell number and impaired function. Simultaneously, senescent cells continuously secrete senescence-associated secretory phenotypes (SASPs). SASP-related inflammatory cytokines can induce persistent chronic inflammation in tissues and lead to abnormal extracellular matrix deposition, inducing pulmonary fibrosis. However, the mechanism by which ionizing radiation-induced pulmonary epithelial cell senescence leads to radiation-induced pulmonary fibrosis (RIPF) remains unclear.

[0004] In recent years, a large number of studies have been conducted on ionizing radiation-induced RIPF, but there are few studies on the regulatory mechanism of lung epithelial cell senescence caused by ionizing radiation. In particular, there are few reports on the role of non-coding RNA in the regulation of lung epithelial cell senescence after ionizing radiation and its participation in the regulation of RIPF.

[0005] Circular RNA (circRNA) is a type of non-coding RNA with a covalently closed circular structure. With the development of high-throughput sequencing technology, a large number of circRNAs have been identified and functionally defined, exhibiting the following characteristics: ① circRNAs are relatively conserved across species and are widely expressed in the nucleus, cytoplasm, and exosomes of various eukaryotes. ② Compared to linear transcripts, they are resistant to the action of RNA exonucleases and their expression is more stable. ③ They are expressed in tissue-specific, cell-specific, and developmental stage-specific patterns.

[0006] The main biological functions of circRNAs currently include miRNA sponging, gene transcription regulation, protein translation, and protein modification regulation. Their specific mechanisms of action are as follows: First, as miRNA sponges. In the cytoplasm, some circRNAs can adsorb miRNAs through sponging, inhibiting miRNA activity and thus promoting target gene expression. Second, regulating gene transcription. Some circRNAs located in the cell nucleus can interact with RNA polymerase II (RNA Pol II) or transcription factors to enhance or weaken gene expression. Third, circRNAs can also interact with regulatory RBPs. By acting as protein sponges, decoys, scaffolds, or recruiting active factors, they further influence the fate of target mRNAs, thereby regulating protein translation. Fourth, regarding the regulation of post-translational modifications, because circRNAs share sequences with parental genes, they can competitively interact with enzymes to regulate post-translational modifications of proteins. This suggests that circRNAs may participate in lung injury processes by influencing cellular senescence, proliferation, activation, and apoptosis.

[0007] circRNAs are typically expressed in tissue-specific or even cell-specific ways, and the differential expression of most circRNAs is associated with certain clinical characteristics. Currently, there are two main types of circRNA therapy: loss-of-function therapy and gain-of-function therapy. In recent years, adeno-associated virus (AAV) has attracted widespread attention due to its high safety profile, good tissue tropism, and long-term stable expression. Research on circRNA function-based therapies using AAV is still limited, but its mechanism of action is well-defined, and its therapeutic prospects are very promising. Summary of the Invention

[0008] The technical problem to be solved by this invention is: how to prevent and / or treat radiation-induced lung injury.

[0009] To solve the above-mentioned technical problems, in a first aspect, the present invention provides an application, wherein the application is any one of the following:

[0010] A1) The application of Circ_0002186 or substances that regulate the expression of the Circ_0002186 gene or substances that regulate the activity or content of Circ_0002186 in regulating radiation-induced lung injury in animals.

[0011] A2) The application of Circ_0002186 or substances that regulate the expression of the Circ_0002186 gene or substances that regulate the activity or content of Circ_0002186 in the preparation of products that regulate radiation-induced lung injury in animals.

[0012] A3) The application of Circ_0002186 or substances that regulate the expression of the Circ_0002186 gene or substances that regulate the activity or content of Circ_0002186 in regulating the level of senescence in the body and / or organs and / or tissues and / or cells;

[0013] A4) The use of Circ_0002186 or substances that regulate the expression of the Circ_0002186 gene or substances that regulate the activity or content of Circ_0002186 in the preparation of products that regulate the level of aging of the body and / or organs and / or tissues and / or cells;

[0014] A5) The application of Circ_0002186 or substances that regulate the expression of the Circ_0002186 gene or substances that regulate the activity or content of Circ_0002186 in the identification or auxiliary identification of radiation-induced lung injury in animals.

[0015] A6) The application of Circ_0002186 or substances that regulate the expression of the Circ_0002186 gene or substances that regulate the activity or content of Circ_0002186 in the preparation of products for identifying or assisting in the identification of radiation-induced lung injury in animals.

[0016] A7) The application of Circ_0002186 or substances that regulate the expression of the Circ_0002186 gene or substances that regulate the activity or content of Circ_0002186 in identifying or assisting in the identification of the level of senescence in organisms and / or organs and / or tissues and / or cells.

[0017] A8) The use of Circ_0002186 or substances that regulate the expression of the Circ_0002186 gene or substances that regulate the activity or content of Circ_0002186 in the preparation of products for identifying or assisting in the identification of the level of aging in organisms and / or organs and / or tissues and / or cells;

[0018] A9) The application of Circ_0002186 or substances that regulate the expression of the Circ_0002186 gene or substances that regulate the activity or content of Circ_0002186 in the preparation of products for preventing radiation-induced lung injury in animals.

[0019] A10) The use of Circ_0002186 or substances that regulate the expression of the Circ_0002186 gene or substances that regulate the activity or content of Circ_0002186 in the preparation of products that prevent the aging of the body and / or organs and / or tissues and / or cells;

[0020] A11) The application of Circ_0002186 or substances that regulate the expression of the Circ_0002186 gene or substances that regulate the activity or content of Circ_0002186 in drug screening for radiation-induced lung epithelial cell senescence and radiation-induced pulmonary fibrosis.

[0021] A12) The application of Circ_0002186 or substances that regulate the expression of the Circ_0002186 gene or substances that regulate the activity or content of Circ_0002186 in the preparation of products for drug screening for radiation-induced lung epithelial cell senescence and radiation-induced pulmonary fibrosis.

[0022] The Circ_0002186 is a circRNA whose nucleotide sequence is encoded by the DNA molecule shown in SEQ ID No. 1.

[0023] In this invention, the radiation-induced lung injury can be lung injury caused by radiation therapy to the lungs. Specifically, it can be senescence of lung epithelial cells caused by radiation therapy or pulmonary fibrosis caused by radiation therapy.

[0024] The cells may be epithelial cells, specifically alveolar basal epithelial cells of human lung adenocarcinoma, human kidney epithelial cells, and human normal bronchial epithelial cells. In the embodiments of the present invention, the cells are specifically human lung adenocarcinoma alveolar basal epithelial cell line (A549), human kidney epithelial cell line (HEK-293T), and human normal bronchial epithelial cell line (BEAS-2B).

[0025] The tissue in question may be epithelial tissue. Specifically, it may be lung epithelial tissue.

[0026] The organ in question may be the lung.

[0027] The animal may be a mammal, such as a mouse or a human.

[0028] Furthermore, in the above applications, the substance regulating the expression of the Circ_0002186 gene or the substance regulating the activity or content of the Circ_0002186 gene is a biological material, and the biological material is any one of the following:

[0029] B1) RNA molecules that inhibit or reduce the expression of the gene encoding Circ_0002186 or RNA molecules that inhibit or reduce the activity or content of Circ_0002186;

[0030] B2) DNA molecules that express the RNA molecules described in B1);

[0031] B3), the DNA molecule encoding Circ_0002186;

[0032] B4), an expression cassette containing the DNA molecule described in B2) or B3);

[0033] B5), a recombinant vector containing the DNA molecule described in B2) or B3), or a recombinant vector containing the expression cassette described in B4);

[0034] B6) recombinant microorganisms containing the DNA molecules described in B2) or B3), or recombinant microorganisms containing the expression cassette described in B4), or recombinant microorganisms containing the recombinant vector described in B5);

[0035] B7) A transgenic animal cell line containing the DNA molecule described in B2) or B3), or a transgenic animal cell line containing the expression cassette described in B4), or a transgenic animal cell line containing the recombinant vector described in B5);

[0036] B8) Transgenic animal tissue containing the DNA molecule described in B2) or B3), or transgenic animal tissue containing the expression cassette described in B4), or transgenic animal tissue containing the recombinant vector described in B5;

[0037] B9) A transgenic animal organ containing the DNA molecule described in B2) or B3), or a transgenic animal organ containing the expression cassette described in B4), or a transgenic animal organ containing the recombinant vector described in B5).

[0038] Furthermore, in the above applications, B1) the RNA molecule is a gRNA targeting the gene encoding Circ_0002186, and the target sequence of the gRNA is the nucleotide sequence of SEQ ID No. 6. B3) The nucleotide sequence of the DNA molecule encoding Circ_0002186 is SEQ ID No. 1.

[0039] The Circ_0002186 is a circRNA whose nucleotide sequence is encoded by the DNA molecule shown in SEQ ID No. 1.

[0040] To address the aforementioned technical problems, in a second aspect, the present invention provides a method for regulating the level of radiation-induced lung injury and / or aging in the body and / or organs and / or tissues and / or cells, comprising regulating the activity or content of the Circ_0002186 in the body and / or organs and / or tissues and / or cells to achieve the purpose of regulating the level of radiation-induced lung injury and / or aging in the body and / or organs and / or tissues and / or cells.

[0041] Furthermore, the above method is selected from any of the following:

[0042] M1) By increasing the activity or content of the Circ_0002186 in the body and / or organs and / or tissues and / or cells, M1 can increase or promote the level of radiation-induced lung injury and / or aging in the body and / or organs and / or tissues and / or cells.

[0043] M2) inhibits or reduces the level of radiation-induced lung injury and / or aging in the body and / or organs and / or tissues and / or cells by inhibiting or reducing the activity or content of Circ_0002186 in the body and / or organs and / or tissues and / or cells.

[0044] Furthermore, in the above method: M2) the method includes introducing the DNA molecule described in B2) into the body and / or organs and / or tissues and / or cells to inhibit or reduce the level of radiation-induced lung injury and / or aging in the body and / or organs and / or tissues and / or cells.

[0045] To address the aforementioned technical problems, in a third aspect, the present invention provides a method for identifying or assisting in the identification of the level of radiation-induced lung injury and / or aging in an organism and / or organs and / or tissues and / or cells, comprising measuring the content of Circ_0002186 in the organism and / or organs and / or tissues and / or cells to identify or assist in the identification of the level of radiation-induced lung injury and / or aging in the organism and / or organs and / or tissues and / or cells.

[0046] In this invention, the content of Circ_0002186 in the body and / or organs and / or tissues and / or cells can be determined by RT-qPCR. The higher the content of Circ_0002186, the higher the level of radiation-induced lung injury and / or aging in the body and / or organs and / or tissues and / or cells.

[0047] To address the aforementioned technical problems, in a fourth aspect, the present invention provides a method for constructing recombinant cells, the method comprising T1) or T2):

[0048] T1) Introduce RNA molecules that inhibit or reduce the expression of the gene encoding Circ_0002186 or RNA molecules that inhibit or reduce the activity or content of Circ_0002186 into recipient cells to inhibit or reduce or downregulate the activity or content of Circ_0002186 in the recipient cells, thereby obtaining recombinant cells with a lower aging level than the recipient cells.

[0049] T2) Introduce DNA molecules that promote or enhance the expression of the gene encoding Circ_0002186 or increase the activity or content of Circ_0002186 into recipient cells to promote or enhance or upregulate the activity or content of Circ_0002186 in the recipient cells, thereby obtaining recombinant cells with a higher aging level than the recipient cells.

[0050] Further, the method described in T1) includes introducing the RNA molecule described in B1) above or the DNA molecule described in B2) above into the recipient cell to inhibit or reduce or downregulate the activity or content of Circ_0002186 in the recipient cell, thereby obtaining recombinant cells with a lower aging level than the recipient cells.

[0051] The method described in T2) includes introducing the DNA molecule shown in B3) above into the recipient cell to promote or increase or upregulate the activity or content of Circ_0002186 in the recipient cell, thereby obtaining recombinant cells with a higher aging level than the recipient cells.

[0052] To address the aforementioned technical problems, in a fifth aspect, the present invention provides recombinant cells constructed by the above-described method.

[0053] The recombinant cells obtained by the above methods can be used for drug screening, for example, the recombinant cells obtained by the method shown in T2) can be used to screen for drugs to prevent and / or treat radiation-induced lung injury; the recombinant cells obtained by the above methods can also be used for mechanism studies of radiation-induced lung injury, for example, the recombinant cells obtained by the methods shown in T1) or T2) can be used for mechanism studies of radiation-induced lung injury.

[0054] To address the aforementioned technical problems, in a sixth aspect, the present invention provides the Circ_0002186 and / or the biomaterials described herein.

[0055] The applications or methods described above are not for disease diagnosis. They are not intended to directly obtain disease diagnoses or health statuses in living humans or animals. For example, these applications or methods could be used to study the mechanisms of radiation-induced pulmonary fibrosis.

[0056] Previous studies have shown that 6 Gy γ-rays can lead to significant cellular senescence. Therefore, in the early stages of this study, a lung epithelial cell senescence model was established by irradiating the human bronchial epithelial cell line (BEAS-2B) with 6 Gy γ-rays. Using gene chip technology, Circ_0002186, whose function has not been reported, was screened out. It was highly expressed in lung epithelial cells and showed a high response to ionizing radiation-induced cellular senescence. It is speculated that Circ_0002186 is involved in the regulation of ionizing radiation-induced lung epithelial cell senescence, but its specific mechanism is currently unclear.

[0057] This study uses Circ_0002186 as a starting point to explore its role and mechanism in ionizing radiation-induced lung epithelial cell senescence at the cellular level, and to clarify its mechanism of promoting cGAS protein (cyclic GMP-AMP synthase) expression. At the animal level, it investigates the role of Circ_0002186 in radiation-induced pulmonary fibrosis and clarifies its potential value as a therapeutic target. This will provide new theoretical and experimental evidence for the clinical prevention and treatment of radiation-induced pulmonary fibrosis.

[0058] Because Circ_0002186 has high homology with humans and mice, and in vitro experiments have preliminarily demonstrated that it can promote alveolar epithelial cell senescence by regulating the key senescence gene cGAS, this study aims to use adeno-associated virus (AAV) carrying the Circ_0002186 knockdown sequence, administered via lung-specific administration, and four months after 25 Gy γ-ray chest irradiation. The study will then combine the results of experiments including general mouse condition, lung pathological tissue sections, and lung respiratory function evaluation to explore whether Circ_0002186 has the potential to serve as an effective intervention target for radiation-induced pulmonary fibrosis. Attached Figure Description

[0059] Figure 1 This is due to ionizing radiation causing senescence of alveolar epithelial cells.

[0060] Figure 2 This is a differential circRNA expression profile of lung epithelial cells after ionizing radiation.

[0061] Figure 3 This represents the expression of Circ_0002186 at different time points after ionizing radiation.

[0062] Figure 4 Circ_0002186 is involved in cellular senescence induced by ionizing radiation.

[0063] Figure 5 Knockdown of Circ_0002186 after ionizing radiation inhibits ionizing radiation-induced cell senescence.

[0064] Figure 6 Upregulation of cGAS expression by Circ_0002186 promotes lung epithelial cell senescence.

[0065] Figure 7 Mouse grouping and AAV expression status.

[0066] Figure 8 The general condition of mice after knocking down Circ_0002186.

[0067] Figure 9 Knocking down Circ_0002186 can improve the symptoms of radiation-induced pulmonary fibrosis in mice. Detailed Implementation

[0068] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0069] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0070] The human lung adenocarcinoma alveolar basal epithelial cell line (A549) and the human normal bronchial epithelial cell line (BEAS-2B) used in this study were both preserved in our laboratory and are disclosed in the literature "Duo Wang.etc. miRNA-155-5p inhibits sepsis-to-mesenchymal transition (EMT) by targeting GSK-3β during radiation-induced pulmonary fibrosis. Arch Biochem Biophys. 2021 Jan 15; 697:108699. doi:10.1016 / j.abb.2020.108699.Epub 2020 Nov 28." The public can obtain the above-mentioned biological materials from the applicant. The above-mentioned biological materials are only used for repeating the experiments of this invention and cannot be used for other purposes.

[0071] The human renal epithelial cell line (HEK-293T) and human fibroblast cell line (HFL-1) used in this study were purchased from the ATCC cell bank, with ATCC numbers HEK-293T: CRL-3216 and HFL-1: CCL-153, respectively.

[0072] All data results were analyzed using SPSS 20.0 software. Normally distributed data were analyzed using t-tests, and one-way ANOVA was used for comparisons among multiple groups. * indicates a significant difference (P < 0.05), ** indicates a highly significant difference (P < 0.01), and *** indicates a highly significant difference (P < 0.001).

[0073] Example 1: Ionizing radiation-induced senescence of lung epithelial cells

[0074] Lung epithelial basal cell line (A549) was cultured in vitro and divided into two groups: group 1 was cultured normally (NC), and group 2 was cultured at a dose of 6 Gy. 60 Cells are irradiated with Co-γ rays (IR, also known as ionizing radiation).

[0075] 1.1 Cell Culture

[0076] A549 and BEAS-2B cell culture methods: When the cell coverage in the culture dish reaches approximately 80%-100%, cell passage can be performed. The cell growth cycle is approximately 2-3 days, and 3-4 dishes can be passaged per dish. The culture medium used is DMEM complete medium (DMEM 445ml, FBS 50ml, penicillin-streptomycin mixture 5ml).

[0077] 1.1.1 Cell resuscitation

[0078] (1) Disinfect the clean bench with ultraviolet light 30 minutes in advance, and preheat the prepared complete culture medium in a 37°C water bath.

[0079] (2) Prepare a centrifuge tube in the sterilized laminar flow hood and add 5 ml of complete culture medium to the tube for later use;

[0080] (3) Remove the frozen cells from liquid nitrogen and shake them rapidly in a 37°C water bath to thaw them until no crystals are formed.

[0081] (4) Add the A549 or BEAS-2B cell suspension in the cryopreservation tube to the prepared culture medium, gently pipette to mix, and place in a low-speed centrifuge for 900 rpm for 3 min.

[0082] (5) Discard the supernatant, add 5 ml of fresh complete culture medium to the tube and gently pipette to mix, then centrifuge according to the above steps;

[0083] (6) After discarding the supernatant, add 1 ml of complete culture medium to the tube, mix well by pipetting to form a single-cell suspension, and add it to a culture dish containing 4 ml of complete culture medium. Gently mix the cell suspension and place the cells in an incubator to continue culturing.

[0084] 1.1.2 Cell passage

[0085] (1) The preparation before the experiment is the same as the steps above. When preheating the liquid, the pancreatic enzyme also needs to be preheated.

[0086] (2) After removing the cells from the incubator, wash the cells 1-2 times with PBS, discard the waste liquid, add 1 ml of trypsin to the dish, and gently shake the culture dish to ensure that the cells and trypsin are in full contact. Gently pipette the cells, and when the cells can be easily pipetted off, add 2 ml of complete culture medium to stop the digestion. Gently pipette the cells off.

[0087] (3) Place the cell suspension into a centrifuge tube and centrifuge at 900 rpm for 5 min. Discard the supernatant and add 3 ml of complete culture medium to resuspend the cells, preparing a single-cell suspension. Repeat this step twice;

[0088] (4) Add 4 ml of complete culture medium to the prepared culture dish, divide the cell suspension in (3) into the prepared culture dish evenly, mix the cell suspension in the culture dish, put it in the incubator to continue culturing, and when the cell coverage in the culture dish reaches about 80%-100%, the irradiation experiment can be carried out.

[0089] 1.2 Cell irradiation treatment

[0090] Cells in the logarithmic growth phase and in good condition were divided into two groups: a control group and an irradiation group. The control group was cultured normally (37℃, 5% CO2), while the irradiation group was irradiated with fresh complete culture medium at room temperature under 60Co γ-rays (Note: In winter, when the temperature is low, placing the cells on a foam mat can provide some insulation). After irradiation, the cells were quickly transferred to a standard cell culture environment of 37℃, 5% CO2 for continued culture. At 48 hours after irradiation, the levels of senescence marker proteins p21 and p16 were measured in both the control and irradiation groups, and the number of senescent cells was determined by SA-β-GAL staining.

[0091] 1.3 Detection of p21 and p16 content

[0092] 1.3.1 Extraction of tissue cells and tissue proteins

[0093] The steps for extracting cell proteins are as follows:

[0094] (1) Remove A549 and BEAS-2B cells from the cell culture incubator in both the control and experimental groups, and wash them three times with pre-cooled PBS buffer. Add 1 ml of PBS buffer, scrape the cells off the culture dish with a cell scraper, and collect the cells into a 1.5 ml EP tube. Centrifuge at 1000 rpm for 5 min and discard the supernatant. If the following experiments are not to be performed immediately, the cells can be temporarily stored in a -80°C freezer.

[0095] (2) Add 40-100 μl of protein lysis buffer to the EP tube containing cells, mix thoroughly with a pipette, and place on ice for lysis for 30 minutes (shake once every ten minutes using a shaker).

[0096] (3) After lysis, centrifuge at 12000 rpm for 15 min using a 4°C centrifuge. After centrifugation, transfer the supernatant to a new 1.5 ml EP tube, measure and record the protein concentration using a spectrophotometer;

[0097] (4) After thoroughly mixing the protein with 5×Loading Buffer at a ratio of 1:4, boil it in boiling water for 8-10 minutes. If the following experiments are not to be performed after boiling, it can be temporarily stored at -20℃.

[0098] The steps for extracting tissue protein are as follows:

[0099] (1) Take an appropriate amount of tissue block into a 1.5ml EP tube, add about 10 times the volume of tissue protein lysis buffer, place it on ice for 30 minutes to fully lyse, and then place it in a tissue homogenizer for thorough homogenization.

[0100] (2) After homogenization, centrifuge at 12000 rpm for 15 min using a 4℃ low-temperature centrifuge. After centrifugation, transfer the supernatant to a new 1.5 ml EP tube, measure and record the protein concentration using a spectrophotometer;

[0101] (3) After thoroughly mixing the protein with 5×Loading Buffer at a ratio of 1:4, boil it in boiling water for 8-10 minutes. If the following experiments are not to be performed after boiling, it can be temporarily stored at -20℃.

[0102] 1.3.2 Western Blot

[0103] (1) Wash the glue-making plate, glue-making rack and sample comb with pure water, and dry them in an oven or let them air dry at room temperature.

[0104] (2) Assemble the clean glue-making plate onto the glue-making frame and fix it securely. Add pure water to the glue-making tank to test the airtightness of the glue-making tank.

[0105] (3) Pour out the pure water in the glue tank and use clean filter paper to absorb the remaining water in the glue tank along one side;

[0106] (4) Prepare a suitable concentration of separating gel according to the molecular weight of the protein being tested (this experiment uses 10% separating gel. For example, each 1.0 mm gel plate requires about 5 ml of separating gel).

[0107] (5) Mix the separating gel thoroughly (be gentle in this process to avoid generating air bubbles). Using a 1ml pipette, slowly add the separating gel to one side of the gel tank until it is 2 / 3 full. Add ethanol to the gel tank to remove all air bubbles and press the surface of the separating gel to a flat surface. Let it sit at room temperature for 30 minutes until the separating gel has completely solidified.

[0108] (6) Tilt the glue-making frame to pour out the ethanol in the glue tank, and use clean filter paper to absorb the residual ethanol in the glue tank along a section.

[0109] (7) Prepare the concentrated glue (taking a 1.0mm glue-making plate as an example, each plate requires approximately 2ml of concentrated glue);

[0110] (8) Mix the stacking gel thoroughly, taking care not to generate air bubbles. Use a 1ml pipette to slowly add the gel into the gel tank along one side of the gel casting plate, and quickly insert the sample comb into the gel tank. Avoid generating air bubbles during this process. Let it stand at room temperature for 30 minutes until it is completely solidified. After that, remove the gel casting plate from the gel casting rack and perform the following experiments;

[0111] (9) According to the electrophoresis tank operation instructions, fix the gel plate in the electrophoresis tank, check the airtightness, add 1× electrophoresis solution to the tank up to the mark line, and pull out the sample comb vertically upward (be careful not to damage the stacking gel).

[0112] (10) Sample loading: According to the experimental design, add the sample into the gel wells from left to right. Add 2-3 μl of protein marker to the first well, and add the remaining samples into the wells in sequence.

[0113] (11) Cover the electrophoresis tank, connect the power supply, and perform electrophoresis (80V, 200mA, 30min). When the protein marker bands begin to separate, adjust the voltage to 120V and continue electrophoresis. After about 70min, when the blue band of the sample reaches the bottom of the gel plate, end the electrophoresis.

[0114] (12) Pre-cool the transfer buffer. Remove the gel plate from the electrophoresis apparatus and immerse it in the transfer buffer. According to the protein amount indicated by the protein marker, cut off the excess gel, leaving the molecular weight band range of the target protein;

[0115] (13) Cut a PVDF membrane of appropriate size according to the size of the separating gel (mark the upper left of the membrane to avoid confusion of direction and failure of transfer), put it in methanol for 5-10 seconds, and then take it out and soak it in the transfer solution.

[0116] (14) Making the transfer membrane "sandwich": The stacking order is as follows: white plywood, sponge, filter paper, PVDF membrane, separating adhesive, filter paper, sponge, black plywood. During the process, the PVDF membrane and adhesive should be kept moist, and there should be no air bubbles between the PVDF membrane and adhesive;

[0117] (15) Place the “sandwich” into the transfer tank, clamp the clamping plate, and confirm that the black side corresponds to the black electrode;

[0118] (16) Fill the tank with pre-cooled 1× transfer solution, connect the transfer tank to the power supply, and start the transfer process. The process conditions are 100V and the time is approximately 1.5 hours. Note that the entire transfer process should be carried out in an ice bath environment; excessively high temperatures will cause the transfer to fail.

[0119] (17) After the transfer is completed, take out the PVDF membrane and place it in TBST blocking solution containing 5% skim milk. Block it on a slow shaker for about 2-3 hours.

[0120] (18) Wash the sealed membrane three times with TBST to remove residual milk. Cut out the target protein band at the corresponding position according to the protein marker and incubate (overnight at 4°C) with the corresponding primary antibodies: recombinant Anti-p21 antibody (Abcam, USA, Ab109199) and recombinant Anti-p16 antibody (Abcam, USA, Ab51243) and internal control antibody GAPDH Antibody (Santa Cruz, USA, sc-25778);

[0121] (19) Recover the primary antibody from the incubation box and wash the membrane three times with TBST, each time for 10 min on a rapid shaker.

[0122] (20) Incubation with secondary antibody dilution solution: Place the cleaned membrane in a secondary antibody dilution solution with the corresponding properties of the primary antibody and incubate at room temperature on a slow shaker for 1-2 hours;

[0123] (21) Recover the secondary antibody, remove the protein membrane, and wash it three times with TBST, each time for 10 minutes on a shaker at room temperature.

[0124] (22) Development: Prepare the developer solution according to the developer solution instructions (prepare and use immediately), use clean filter paper to absorb the excess liquid on the membrane, spread it evenly in the dark box of the developer instrument, spread the developer solution evenly on the membrane, select the appropriate exposure time, and save the image;

[0125] (23) Based on the development results, the gray values ​​of the protein bands were analyzed using ImageJ software.

[0126] 1.4 β-Galactosidase Staining

[0127] According to the instructions of the Beyotime Cell Senescence β-Galactosidase Staining Kit, the cells to be tested were stained. The procedure is as follows:

[0128] (1) Perform cell passage, transfection, irradiation and other steps according to the experimental design;

[0129] (2) At the designed time point, remove the cells, aspirate the cell culture medium, wash the cells once with PBS, aspirate the PBS, add 1 ml of β-galactosidase staining and fixation solution, and fix at room temperature for 15 minutes.

[0130] (3) Aspirate the cell fixation solution from the culture dish and wash the cells three times with PBS buffer on a slow shaker for 10 min each time;

[0131] (4) Prepare the staining working solution according to the table below, and add 1 ml of staining working solution to each well;

[0132] Table 1. β-Galactosidase Staining Working Solution

[0133]

[0134] (5) Seal the culture dish containing the staining working solution with plastic wrap and incubate it in a 37°C oven overnight (Note: Do not incubate in a CO2 incubator, as pH will affect the staining of senescent cells).

[0135] (6) The staining was observed under a regular optical microscope the next day.

[0136] The results are as follows Figure 1 As shown, Figure 1 The results of experiments on ionizing radiation-induced senescence of alveolar epithelial cells. Figure 1 In this text, NC represents the control group cells, which are normally cultured without irradiation treatment; IR represents the irradiated group cells. Figure 1 In Figure A, the changes in aging marker proteins p21 and p16 in A549 cells were detected after ionizing radiation (measured 48 hours after ionizing radiation). Figure 1 The middle figure (B) shows the number of senescent cells detected by SA-β-GAL staining, and the right figure shows the quantitative results.

[0137] The results showed that, compared with the control group, the expression of aging marker proteins p21 and p16 was significantly increased after 48 hours of radiation irradiation. Figure 1 (A) SA-β-GAL staining showed that ionizing radiation stimulation significantly increased the number of senescent cells. Figure 1 (B). The above results suggest a 6 Gy dose. 60 Co-γ irradiation can significantly induce senescence of lung epithelial cells.

[0138] Example 2: Constructing an ionizing radiation-induced cell senescence model and identifying differentially expressed circRNA profiles.

[0139] Human bronchial epithelial cell line (BEAS-2B) was treated with a 6 Gy dose. 60Cells were irradiated with Coγ rays, and microarray sequencing was performed on unirradiated cells and cells 6 h and 48 h after irradiation to construct differentially expressed circRNA profiles.

[0140] The results are as follows Figure 2 , Figure 2 This is a differential circRNA expression profile of lung epithelial cells after ionizing radiation, in which... Figure 2 Figure A shows the number of differentially expressed circRNAs from 0h to 6h to 48h after irradiation. Figure 2 Figure B shows a heatmap of cluster analysis of differentially expressed circRNAs at 0-6h and 0-48h post-irradiation. Figure 2 Figure C shows a heatmap of cluster analysis for circRNAs with consistent changes selected from 0-6 and 0-48 h post-irradiation. After screening differentially expressed circRNAs, circRNAs with consistent changes were selected from 0-6 and 0-48 h post-irradiation, respectively. A total of 23 circRNAs showed consistent trends at 6 h and 48 h post-irradiation. Figure 2 (C). The above results suggest that circRNAs are responsive to ionizing radiation and have the potential to serve as targets for the prevention and treatment of radiation-induced lung injury.

[0141] Example 3: Circ_0002186 was significantly overexpressed after ionizing radiation.

[0142] Among 23 differentially expressed circRNAs, Circ_0002186, with a high base value and significant fold change, was selected as the research subject. To validate the microarray sequencing results, we used a 6 Gy dose in the human bronchial epithelial cell line (BEAS-2B) and the lung epithelial basal cell line (A549). 60 The relative expression level of Circ_0002186 was detected by qRT-PCR at 0h, 6h, 12h, 24h and 48h after Co γ-ray irradiation (with GAPDH as an internal reference). Figure 3 This represents the expression of Circ_0002186 at different time points after ionizing radiation. Figure 3 In the middle A, the Venn diagram shows the number of circRNAs that changed consistently at 6 h and 48 h after irradiation. Figure 3 In Figure B, the relative expression level of Circ_0002186 at different time points after ionizing radiation is shown in A549 and BEAS-2B cells. The results indicate that Circ_0002186 is significantly overexpressed after ionizing radiation.

[0143] The coding sequence of Circ_0002186 is shown in SEQ ID No. 1. Circ_0002186 is a circRNA encoded by the DNA molecule whose nucleotide sequence is SEQ ID No. 1.

[0144] The baseline information for SEQ ID No. 1, circ_0002186, is >Circ_0002186|Chr5:78415520_78421960_+

[0145] 5'- CCTCCACCAGGCG GTGTGAAGATGCCTAATGTACCCAATACACAACCAGCAATAATGAAACCAACAGAGGAACATCCAGCTTATACACAGATTGCAAAGGAACATGCATTGGCCCAAGCTGAACTTCTTAAGCGCCAGGAAGAACTAGAAAGAAAAGCCGCAGAATTAGATCGTCGGGAACGAGAAATGCAAAACCTCAGTCAAC ATGGTAGAAAAATAATTGGCCACCTCTTCCTAGCAATTTTCCTGTCGGACCTTGTTTCTATCAGGATTTTTCTGTAGACATTCCTGTAGAATTCCAAAAGACAGTAAAGCTTATGTACTACTTGTGGAATGTTCCATGCAGTAACACTGTTTCTAAATATCTTCGGATGCTTGGCTTGGTTTTGTGTTGATTC TGCAAGAGCGGTTGATTTTGG ATTGAGTATCCTGTGGTTCTTGCTTTTTACTCCTTGTTCATTTGTCTGTTGGTACAGACCACTTTATGGAGCTTTCAG-3' (underlined is the primer sequence).

[0146] The primer names and primer sequences (5'-3') for qRT-PCR detection are as follows:

[0147] Circ_0002186-F: TGCAAGAGCGGTTGATTTTGG (SEQ ID No. 2);

[0148] Circ_0002186-R: CGCCTGGTGGAGGCTGAAA (SEQ ID No. 3);

[0149] GAPDH-F: TGTGGGCATCAATGGATTTGG (SEQ ID No. 4);

[0150] GAPDH-R: ACACCATGTATTCCGGGTCAAT (SEQ ID No. 5).

[0151] qRT-PCR detection includes the following steps:

[0152] I. Extraction of Total RNA

[0153] This experiment must be conducted in an enzyme-free environment, and all consumables such as pipette tips and EP tubes must be enzyme-free.

[0154] (1) Sample collection:

[0155] Cell sample preparation: Remove cells from the cell culture incubator, discard the cell culture medium, and gently wash the cells three times with pre-chilled 1×PBS. Add 1 ml of Trizol to the dish and incubate at room temperature for 2-3 minutes to fully lyse the cells. Gently pipette to completely dissolve the adherent cells in the Trizol solution. Then transfer the solution to a 1.5 ml EP tube for later use (it can be temporarily stored at -80°C to avoid long-term storage).

[0156] Tissue sample preparation: Place approximately 50 mg of tissue sample into a 1.5 ml EP tube, add 1 ml of Trizol, and grind the tissue thoroughly with a tissue homogenizer until no obvious tissue clumps are visible to the naked eye. Centrifuge at 12000 rpm for 10 min at 4°C, and transfer the supernatant to a new enzyme-free EP tube.

[0157] (2) RNA extraction

[0158] ① Add 200 μl of chloroform to each EP tube containing 1 ml of cell lysis buffer, invert and mix for 15 seconds, incubate at room temperature for 5-10 minutes, and centrifuge at 12000 rpm for 15 minutes using a 4℃ low-temperature centrifuge.

[0159] ② At this point, the liquid in the EP tube can be observed to be divided into three layers: the upper layer is a transparent aqueous phase containing RNA; the middle layer is a white thin film containing DNA; and the lower layer is a red organic layer containing protein. Carefully and as much as possible, aspirate the upper layer of liquid and transfer it to a new EP tube (this operation requires caution to avoid aspirating the white thin film layer and the organic layer of liquid, otherwise the RNA purity will be insufficient).

[0160] ③ Add an equal volume of isopropanol solution to the EP tube containing the aqueous phase, invert and mix gently, and place on ice for 10 minutes to allow the RNA to precipitate fully.

[0161] ④ Centrifuge the precipitated RNA at 12000 rpm for 10 min at 4°C. After centrifugation, discard the supernatant; a white RNA precipitate will be visible at the bottom of the EP tube.

[0162] ⑤ Add 75% ethanol (prepared with sterile, enzyme-free water, freshly prepared) to the RNA precipitate, gently shake the EP tube to suspend the precipitate. Place the EP tube in a centrifuge at 4°C and centrifuge at 12000 rpm for 5 minutes.

[0163] ⑥ Try to remove the upper layer of ethanol solution, open the EP tube cap, place it in an enzyme-free operating table and blow it dry until the white precipitate becomes colorless and transparent (if it is not completely dry, residual ethanol will affect the results of subsequent experiments).

[0164] ⑦ Add 20 μl of sterile, enzyme-free water to the dried RNA precipitate, incubate at 37°C for 10 min to fully dissolve the RNA, and then place the RNA sample on ice to detect the concentration.

[0165] ⑧ Gently mix the RNA solution and use a spectrophotometer to measure the RNA concentration and purity (RNA purity should ideally be between 1.9 and 2.1).

[0166] ⑨ Dilute the sample to 500 ng / μl, aliquot it, and store it in a -80℃ refrigerator for later use.

[0167] II. mRNA reverse transcription

[0168] According to the instructions of the ReverTra Ace qPCR RT Master Mix with gDNA Remove Kit (Toyobo Biotechnology Co., Ltd., Japan), RNA was reverse transcribed into cDNA.

[0169] III. Real-time quantitative PCR of mRNA

[0170] Strictly follow the steps outlined in the Thunderbird SYBR qPCR Mix kit (Toyobo Biotechnology Co., Ltd., Japan):

[0171] ① Remove the kit and place it on ice to thaw and then centrifuge gently.

[0172] ② Prepare the reaction system according to the table below. The entire process must be carried out on ice (the reaction system must be prepared in the dark).

[0173] Table 2. Real-time quantitative PCR reaction system (20 μl)

[0174]

[0175] ③ Each reaction requires three replicates. After preparing the reaction mixture as described above, add it to an eight-tube array. Gently centrifuge, then place the eight-tube array into a qRT-PCR instrument and proceed with the reaction according to the following procedure.

[0176] Table 3. mRNA qRT-PCR reaction procedure

[0177]

[0178] ④ After the reaction is complete, save the experimental data in a timely manner and use the 2-ΔΔCt method to analyze the mRNA expression level of the target gene.

[0179] Example 4: Overexpression of Circ_0002186 induces cellular senescence, and knockdown of Circ_0002186 inhibits ionizing radiation-induced cellular senescence.

[0180] 4.1 Construction of overexpression vectors and cell transfection

[0181] 4.1 Construction of overexpression vectors

[0182] The construction of the overexpression vector CirCRNA_16552-pcdna3.1-circRNA mini was commissioned to Hunan Fenghui Biotechnology Co., Ltd. The overexpression vector CirCRNA_16552-pcdna3.1-circRNA mini is a recombinant expression vector obtained by inserting a DNA molecule with the nucleotide sequence of SEQ ID No. 1 between the BspDI-AgeII restriction enzyme recognition sites of the pCDNA3.1(+)-circRNA mini vector, while keeping the other nucleotide sequences of the pCDNA3.1(+)-circRNA mini vector unchanged. The recombinant expression vector CirCRNA_16552-pcdna3.1-circRNA mini can express Circ_0002186.

[0183] 4.2 Knockdown sequence

[0184] Circ_0002186 is highly homologous in humans and mice. After screening, its targeted knockdown sequence was obtained as follows:

[0185] siCirc_0002186 (siRNA): 5'-CTTTCAGCCTCCACCAGGC-3' (SEQ ID No. 6).

[0186] The NC sequence that cannot be knocked down by Circ_0002186 is: 5'-CCTAAGGTTAAGTCGCCCTCG-3' (SEQ ID No. 7).

[0187] 4.3 Transfection of overexpression vectors and siRNA

[0188] (1) Preparation of the operating table before operation is as above. Reagent preparation before operation: Lipofectamine 2000 (lip2000); preheat the DMEM (serum-free and antibiotic-free) in a 37℃ water bath; centrifuge the tubes containing siRNA (siCirc_0002186 or NC) at 3000 rpm for 5 min to avoid powder loss. Add a certain amount of DEPC water according to the recommended ratio, dissolve thoroughly, and aliquot for long-term storage at -20℃. There are three cell types to be transfected: A549, BEAS-2B, and HFL-1.

[0189] (2) Taking a 60mm dish as an example, transfection is suitable when the cell density reaches 50-60%. 30 minutes before transfection, discard the original culture medium, wash with PBS 1-2 times, and add 1.5ml of dual-free DMEM culture medium to each dish.

[0190] (3) Take an appropriate amount of 1.5 EP tubes (2 tubes / plate, EP tubes are numbered A and B) as needed. Add 245 μl of preheated dual-free DMEM medium to each of tubes A and B.

[0191] (4) Add 5 μl of lip2000 to tube B, mix well with a pipette, and incubate for 5 min; add 5 μl of the reagent to be transfected to tube A, mix well with a pipette, add to tube B, mix again, and incubate at room temperature for 20 min.

[0192] (5) Add the suspension evenly to the cells that need to be transfected, gently shake the culture medium to mix thoroughly, mark it, and put it back into the culture medium to continue culturing.

[0193] (6) 6-8 hours after transfection, replace with DMEM medium containing 10% fetal bovine serum and continue culturing.

[0194] (7) The conversion methods of the overexpression vector CirCRNA_16552-pcdna3.1-circRNA mini and the empty vector pCDNA3.1(+)-circRNA mini are the same as those in (1)-(6), except that the siRNA in step (1) is replaced with the overexpression vector CirCRNA_16552-pcdna3.1-circRNA mini and the empty vector pCDNA3.1(+)-circRNA mini.

[0195] 4.4 Measurement of P21 and P16 in Circ_0002186 cells overexpressing P21 and P16, SA-β-GAL staining, and fluorescence staining

[0196] Cells transfected with the expression vector CirCRNA_16552-pcdna3.1-circRNA mini (OE-Circ_0002186) and cells transfected with the empty vector (Vec) were collected 48 hours after transfection. The expression levels of P21 and P16 were measured, and SA-β-GAL staining and fluorescence staining (DAPI and α-SMA staining) were performed.

[0197] P21 and P16 in A549 cells and BEAS-2B cells transfected with the overexpression vector or empty vector were measured using the Western blotting method described in Example 1.

[0198] SA-β-GAL staining was performed on A549 cells and BEAS-2B cells transfected with the overexpression vector or empty vector using a β-galactosidase staining kit (Beyotime). The staining procedure was as described in 1.4 of Example 1.

[0199] HFL-1 cells transfected with the overexpression vector or empty vector were subjected to fluorescent staining using DAPI and α-SMA. The specific steps are as follows:

[0200] (1) Cell passage: Soak the coverslips in 95% alcohol beforehand, and then lay them flat in the 6-well plate. The cell passage method is the same as before.

[0201] (2) Cell treatment: The method is the same as before.

[0202] (3) Cell fixation: At the designed time points, remove the cells from the incubator, discard the original culture medium, and wash the cells three times with PBS buffer. Add 2 ml of 4% paraformaldehyde pre-cooled at 4°C and fix at room temperature for 30-40 min.

[0203] (4) Cell washing: Discard paraformaldehyde and wash cells three times with PBS buffer on a low-temperature shaker for 10 minutes each time.

[0204] (5) Cell permeabilization: Add 2 ml of pre-cooled 0.25% Triton X-100 solution to each well and let stand at room temperature for 30 min.

[0205] (6) Cell blocking: discard the cell perforation solution, add 2 ml of 3% BSA blocking solution to each well, and block at room temperature for 30 min.

[0206] (7) Incubation of primary antibody: Prepare a suitable concentration of primary antibody dilution solution according to the corresponding antibody instructions (as shown in Table 9). Use approximately 100 μL of antibody per well. Drop the antibody evenly onto the coverslip and incubate overnight in a humidified chamber at 4°C in the dark.

[0207] (8) Washing the primary antibody: Gently aspirate the primary antibody and wash three times with PBS buffer. Wash for 10 minutes each time on a low-speed shaker.

[0208] (9) Incubation of secondary antibody: Prepare fluorescent secondary antibody in advance with 3% BSA, spread the fluorescent secondary antibody evenly on the coverslip, and incubate at room temperature in the dark for 1 hour. This process must be strictly protected from light.

[0209] (10) After the secondary antibody incubation is complete, wash the cells three times with PBS on a slow shaker for 10 minutes each time. This process should be strictly protected from light.

[0210] (11) Mounting: Place a DAPI-containing mounting medium onto a glass slide, place a coverslip with the cell growth side on top of the slide, and gently press to ensure full adhesion. Store temporarily in a humidified chamber at 4°C.

[0211] (12) Review the slides: Use a laser confocal microscope to observe the expression of the target protein.

[0212] Table 9. Names and Catalog Numbers of Primary Antibodies

[0213]

[0214] The results are as follows Figure 4 As shown, Figure 4 The result of cellular senescence caused by overexpression of Circ_0002186, Figure 4 Vec refers to cells transfected with an empty vector. Figure 4 OE-Circ_0002186 is a cell type that overexpresses Circ_0002186. Figure 4 In Figure A, the changes in p21 and p16 were detected by overexpressing Circ_0002186 in A549 cells. Figure 4 In Figure B, the number of senescent cells was detected by SA-β-GAL staining after overexpression of Circ_0002186 in A549 cells. Figure 4 In the middle C, immunofluorescence is used to detect fibroblast activation. The cell nucleus is labeled with blue fluorescence (DAPI), and the fibroblast activation marker α-SMA is labeled with red fluorescence.

[0215] 4.5 Treatment of Circ_0002186 cells knocked down

[0216] The experiment was divided into three treatment groups: Group 1: Control group cells (NC) were cultured for 48 hours and then collected. The expression levels of P21 and P16 were measured (A549 and BEAS-2B cells), and fluorescent staining was performed (HFL-1 cells, stained with DAPI and α-SMA); Group 2: Control group cells (NC) were irradiated with radiation and then collected for 48 hours. The expression levels of P21 and P16 were measured (A549 and BEAS-2B cells), and fluorescent staining was performed (HFL-1 cells, stained with DAPI and α-SMA); Group 3: Circ_0002186 cells were knocked down, irradiated with radiation, cultured for 48 hours, and then collected. The expression levels of P21 and P16 were measured (A549 and BEAS-2B cells), and fluorescent staining was performed (HFL-1 cells, stained with DAPI and α-SMA).

[0217] Table 4. Treatment methods for knocking down Circ_0002186 cells

[0218]

[0219] Following the Western blotting method of Example 1, P21 and P16 were measured in A549 cells and BEAS-2B cells with knocked-down Circ_0002186, as well as in A549 cells and BEAS-2B cells used as control cells.

[0220] HFL-1 cells with knockdown of Circ_0002186 and HFL-1 cells used as control cells were fluorescently stained with DAPI and α-SMA.

[0221] The results are as follows Figure 5 As shown. Figure 5 To inhibit ionizing radiation-induced cellular senescence, Circ_0002186 was knocked down. Figure 5 NC in the middle represents control cells transfected with the NC sequence. Figure 5 In the middle IR, the cells represent the control group cells that underwent irradiation treatment. Figure 5 IR+si-16552 indicates Circ_0002186 cells that have been knocked down by irradiation. Figure 5 In the middle section, Circ_0002186 was knocked down after ionizing radiation to detect changes in aging marker proteins; Figure 5 In Figure B, immunofluorescence is used to detect fibroblast activation. Blue fluorescence is used to label the cell nucleus, and red fluorescence is used to label the fibroblast activation marker α-SMA.

[0222] Overexpression and knockdown results showed that, compared with the control group, overexpression of Circ_0002186 in A549 cells significantly increased the expression of aging-related markers p21 and p16. Figure 4 The SA-β-GAL results indicated that overexpression of Circ_0002186 significantly increased the number of stained cells. Figure 4 (B) suggests that overexpression of Circ_0002186 can induce lung epithelial cell senescence. To verify the role of Circ_0002186 in ionizing radiation-induced cell senescence, knockdown of Circ_0002186 under ionizing radiation stimulation inhibited ionizing radiation-induced lung epithelial cell senescence (B). Figure 5 (A). We also found that overexpression of Circ_0002186 promoted fibroblast activation, while interference with Circ_0002186 during ionizing radiation stimulation significantly inhibited ionizing radiation-induced fibroblast activation. Figure 4 C in the middle Figure 5 (B). The above results strongly suggest that Circ_0002186 may be involved in ionizing radiation-induced lung epithelial cell senescence.

[0223] Example 5: Circ_0002186 upregulates the expression of the pro-aging gene cGAS.

[0224] To further investigate the mechanism of action of Circ_0002186, we examined its association and interaction with the pro-aging gene cGAS. The treatment methods are as follows: A1), A2), A3), A4), and A5):

[0225] A1) Samples of A549 cells and BEAS-2B cells were collected at 0h, 6h, 12h, 24h and 48h after irradiation, and the expression level of cGAS was measured.

[0226] A2) The cGAS expression level was measured after 48 hours of culture in A549 cells (OE-Circ_0002186) and BEAS-2B cells (OE-Circ_0002186) overexpressing Circ_0002186, as well as A549 cells (Vec) and BEAS-2B cells (Vec) as control cells.

[0227] A3) The experiment was divided into three treatment groups: Group 1: Control group cells (NC) were cultured for 48 hours and the cGAS expression level was measured; Group 2: Control group cells (NC) were irradiated with radiation for 48 hours and the cGAS expression level was measured; Group 3: Circ_0002186 cells were knocked down and irradiated with radiation for 48 hours and the cGAS expression level was measured.

[0228] Table 5, Group A3) Processing methods and symbols

[0229]

[0230] A4) The cGAS knockdown treatment was divided into three groups: Group 1: Control group cells, i.e., NC cells (A549 cells), without cGAS intervention or irradiation treatment, were cultured for 48 hours and then the expression levels of cGAS, P21, and p16 were measured; Group 2: Control group cells, i.e., NC cells (A549 cells), without cGAS intervention, were irradiated and then the cells ...

[0231] The specific details of Groups 1 through 3 are shown in the table below:

[0232] Table 6, Group A4) Processing methods and symbols

[0233]

[0234] The cGAS knockdown treatment was divided into three groups: Group 1: Control group cells, i.e., NC cells (A549 cells), without cGAS intervention or irradiation treatment, were cultured for 48 hours and then the expression levels of cGAS, P21, and p16 were measured; Group 2: A549 cells overexpressing Circ_0002186, i.e., OE-Circ_0002186 cells, without cGAS intervention, were cultured for 48 hours and then the expression levels of cGAS, P21, and p16 were measured; Group 3: Cells treated with cGAS (cGAS knockdown and Circ_0002186 overexpression A549 cells), were cultured for 48 hours and then the expression levels of cGAS, P21, and p16 were measured.

[0235] The specific details of groups 1 through 3 in A5 are shown in the table below:

[0236] Table 7, Group A5) Processing methods and symbols

[0237]

[0238] The preparation methods for overexpressing Circ_0002186 cells and knocking down Circ_0002186 cells are the same as in Example 4. The method for constructing cells to interfere with cGAS is the same as the method for preparing knocking down Circ_0002186 cells in Example 4 (cGAS interference is performed using SicGAS). The only difference is that the introduced siRNA is replaced with sicGAS. (In the method for preparing A549 cells that knock down cGAS and simultaneously overexpress Circ_0002186, in addition to replacing siRNA with sicGAS, the cells to be transfected also need to be replaced with A549 cells that overexpress Circ_0002186.)

[0239] The SicGAS sequence is as follows:

[0240] ShRNA2-forward: 5'-CCGG GGAAGGAAATGGTTTCCAA CTCGAG TTGGAAACCA

[0241] TTTCCTTCC TTTTTTG-3'(SEQ ID No. 8);

[0242] ShRNA2-reverse:5'-AATTCAAAAAG GAAGGAAATGGTTTCCAA CTCGAG TTGG

[0243] AAACCATTTCCTTCC -3'(SEQ ID No.9).

[0244] The expression levels of cGAS, p21, and p16 were determined using the Western blotting method described in Example 1. The primary antibody used to determine cGAS was cGAS antibody (C-1) (purchased from Santa Cruz Biotechnology, Inc., catalog number Sc-515802).

[0245] The results are as follows Figure 6 As shown.

[0246] The results of treatment group A1) are as follows: Figure 1 As shown in A and D, Figure 6 In the figure, A represents the cGAS protein expression level in A549 cells at 0h, 6h, 12h, 24h, and 48h after irradiation with 6Gy. Figure 6 D represents the cGAS protein expression level in BEAS-2B cells at 0h, 6h, 12h, 24h, and 48h after 6Gy irradiation. The results showed that cGAS expression in both A549 and BEAS-2B cells significantly increased with time after ionizing radiation. Figure 6 (A and D in the middle), which is consistent with the changing pattern of Circ_0002186 ( Figure 3 (B)

[0247] A2) The results of the treatment group are as follows Figure 6 As shown in B and E, Figure 6 B represents the change in cGAS expression level after overexpression of Circ_0002186 (OE-Circ_0002186) in A549 cells. Figure 6 Vec in B refers to A549 cells transfected with an empty vector. Figure 6 E represents the change in cGAS expression level after overexpression of Circ_0002186 (OE-Circ_0002186 in the figure) in BEAS-2B cells. Figure 6 The Vec in BEAS-2B cells was transfected with an empty vector; the results showed that overexpression of Circ_0002186 in A549 and BEAS-2B cells significantly increased cGAS expression. Figure 6 (B and E in the middle).

[0248] A3) Results of the treatment group are as follows Figure 6 As shown in C and F, Figure 6 In the figure, C represents the cGAS protein expression level in the first, second, and third groups of the A3 treatment group when the recipient cells are A549. Figure 6In the figure, F represents the cGAS protein expression level in the first, second, and third groups of the A3 treatment group when the recipient cells are BEAS-2B. The results show that knocking out Circ_0002186 can inhibit the increase in cGAS content in A549 cells and BEAS-2B cells caused by ionizing radiation.

[0249] A4) Results of the treatment group are as follows Figure 6 As shown in G, Figure 6 The expression levels of cGAS, p21, and p16 in A549 cells treated with cGAS (G = A4), irradiated A549 cells, and irradiated A549 cells after cGAS intervention were compared. The results showed that the expression of aging-related proteins p21 and p16 was reduced in cGAS knockdown A549 cells.

[0250] A5) The results of the treatment group are as follows Figure 6 As shown in H, Figure 6 In the figure, H represents the expression levels of aging-related proteins p21 and p16 in A549 cells, A549 cells overexpressing Circ_0002186, and A549 cells with cGAS knockdown after Circ_0002186 overexpression. The results indicate that knockdown of cGAS after Circ_0002186 overexpression reduces the expression level of the aging-related protein p16. Figure 6 (H).

[0251] The results suggest that Circ_0002186 participates in ionizing radiation-induced lung epithelial cell senescence by regulating the key senescence factor cGAS.

[0252] Example 6: Intervention in Circ_0002186 to prevent radiation-induced pulmonary fibrosis

[0253] 6.1 Mouse grouping and AAV expression efficiency in mouse lungs

[0254] Male C57BL / 6J mice aged 6-8 weeks were randomly divided into 4 groups, with 10 mice in each group. Figure 7 (A) Figure 7 In the diagram, Con represents blank control mice that did not receive AAV adenovirus injection or irradiation; IR represents mice that did not receive AAV adenovirus injection but were irradiated; IR+NC represents mice injected with the NC sequence of AAV adenovirus and irradiated; and IR+si represents Circ_0002186 knockdown mice that underwent irradiation. The Circ_0002186 knockdown sequence was constructed into an adeno-associated virus (AAV) vector containing a GFP fluorescent element for detecting AAV expression. One week prior to irradiation, mice were administered the drug to their lungs using a lung drug delivery device (1×10⁻⁶). 11(vg / mouse). Mice were irradiated locally in the chest area with 25 Gy gamma rays, while the remaining areas were shielded with lead bricks. One month after irradiation, the expression of AAV in the lung tissue of mice was observed using laser confocal microscopy.

[0255] 6.1.1 Construction of recombinant adeno-associated virus vector

[0256] The process of commissioning and constructing the project by Yuan Company includes the following steps:

[0257] (1) Design of interference targets

[0258] The designed interference target (circ_0002186) and control (NC) are as follows:

[0259] circ_0002186: 5'-CTTTCAGCCTCCACCAGGC-3' (SEQ ID No. 6);

[0260] NC: 5'-CCTAAGGTTAAGTCGCCCTCG-3' (SEQ ID No. 7).

[0261] (2) Primer annealing forms double-stranded fragments with sticky ends.

[0262] The synthesized primer sequences are as follows:

[0263] Table 8. Primer Names and Sequences

[0264]

[0265] The synthesized primers were dissolved in oligo annealing buffer to a concentration of 20 μM, and 30 μl of each complementary single strand was mixed. The oligo mixture was then heated in a water bath at 95 °C for 5 min, and then allowed to cool naturally to room temperature with the lid off to form double-stranded oligo fragments. 1 μl was used for subsequent ligation reactions, and the remainder was stored at -20 °C.

[0266] (3) Preparation of linearized expression vectors

[0267] The vector pAAV-U6-shRNA / spgRNA v2.0-CMV-EGFP-WPRE (Heyuan Bio, H12663) was digested with restriction endonuclease BsmBI to obtain a linearized vector. The double-stranded fragment with sticky ends prepared in step (2) was ligated with the obtained linearized vector through a ligation reaction system to obtain a recombinant adeno-associated virus vector.

[0268] Sequencing revealed that the recombinant adeno-associated virus pAAV-circ_0002186 containing the interference target (Hsa_circ_0002186) is a recombinant expression vector obtained by replacing the fragment between the two BsmBIs (small fragment between the two BsmBIs) of the vector pAAV-U6-shRNA / spgRNA v2.0-CMV-EGFP-WPRE with the DNA molecule whose nucleotide sequence is described in Sequence 6 of the sequence listing, while keeping the other nucleotide sequences of the vector pAAV-U6-shRNA / spgRNA v2.0-CMV-EGFP-WPRE unchanged. This recombinant expression vector is named pAAV-circ_0002186, and pAAV-circ_0002186 can express circ_0002186.

[0269] The control vector pAAV-NC has a similar structure to pAAV-circ_0002186, the only difference being that the nucleotide sequence of the DNA molecule described in sequence 6 of the sequence listing is replaced with the control sequence (the DNA molecule described in sequence 7 of the sequence listing).

[0270] 6.1.2 Irradiation Method for Mice

[0271] (1) Mice were fed a standard environment for one week before irradiation;

[0272] (2) Before irradiation, use 1% sodium pentobarbital for intraperitoneal anesthesia. After complete anesthesia, use adhesive tape to fix the mouse to the irradiation device, exposing the lungs, and use lead bricks to cover the rest of the body (in winter when the temperature is low, hot water bottles should be used to keep the mouse's body temperature).

[0273] (3) The dose of 60Co γ-rays was 25 Gy, and the dose rate was 200 cGy / min;

[0274] (4) Animal experiments were approved by the Animal Protection and Use Committee of the Academy of Military Medical Sciences and conducted in accordance with the "Guidelines for Laboratory Animals in China on Animal Welfare and Ethics".

[0275] 6.1.3. Injection of mouse adeno-associated virus

[0276] The adeno-associated virus was diluted according to the adeno-associated virus instructions, with a total inhalation volume of 1×10⁻⁶ for each mouse. 11 vg / animal, inhalation volume 40μL. Procedure:

[0277] (1) Anesthetize the mice according to the method described in 7.1.2;

[0278] (2) Fix the mouse to the mouse operating table, fix its teeth to the line, and fix its limbs with rubber bands;

[0279] (3) Adeno-associated virus was slowly dripped into the lungs of mice in the experimental group using a pipette, while the control group was dripped with an empty adeno-associated virus.

[0280] (4) The degree of pulmonary fibrosis in mice was evaluated at 1 and 4 months after irradiation.

[0281] (5) Collect mouse lung tissue, part of which is used for pathological sections and part is stored in a -80℃ refrigerator for later use.

[0282] The adeno-associated virus (AAV) was prepared by Yuan Biotechnology. The method involved co-transfecting 293T cells with pAAV-circ_0002186, pAAV-RC plasmid, and Helper plasmid, followed by cell culture to obtain the culture supernatant. The supernatant was then purified to obtain the AAV virus (containing circ_0002186). The preparation method for the control group AAV was the same, except that the recombinant expression vector pAAV-circ_0002186 was replaced with the control vector pAAV-NC.

[0283] The results are as follows Figure 8 As shown, Figure 8 Mouse grouping and AAV expression status, Figure 8 A in the diagram represents the grouping of mice; Figure 8 Figure B shows the expression of AAV in mouse lung tissue at one and four months after irradiation. The results indicate that, even after pre-irradiation administration, AAV expression persisted in the mouse lungs at both one and four months post-irradiation. Figure 8 (B) The results indicate that AAV has a long-lasting effect and has the potential to serve as a long-acting drug carrier.

[0284] 6.2 Evaluation of lung injury in mice after chest irradiation

[0285] Four months after irradiation, the mice underwent the following experiments: their appearance was observed, their weight was measured, and their running distance was measured. The mice were dissected to observe changes in lung tissue and calculate the lung weight coefficient. The dissected lung tissue was also stained with H&E and Masson's stain to observe the degree of pulmonary fibrosis and the relative expression level of collagen.

[0286] (1) Mouse running distance experiment

[0287] Adjust the treadmill to a fixed incline, set the conveyor belt speed to 15 meters per minute, place the mouse in the instrument, and apply an electric shock to the tail of the instrument. After receiving the electric shock, the mouse will continue to run forward.

[0288] The experiment was stopped when the mice remained motionless at the tail end of the instrument even after receiving an electric shock, or when their forelimbs were on the conveyor belt and their hindlimbs were at the point of electric shock, and they were in a crawling position. The experiment was stopped when the mice continued running for 6 minutes.

[0289] Wherein, lung weight coefficient = lung weight ÷ body weight

[0290] (2) HE staining

[0291] The specific steps for staining using the Beyotime HE staining kit (catalog number C0105S) are as follows:

[0292] ① For paraffin sections: Dewax in xylene for 5-10 minutes. Replace with fresh xylene and dewax again for 5-10 minutes. 5 minutes with anhydrous ethanol. 2 minutes with 90% ethanol. 2 minutes with 80% ethanol. 2 minutes with 70% ethanol. 2 minutes with distilled water.

[0293] ② Hematoxylin and Eosin (HE) Staining: For the above-treated samples: a. Stain with hematoxylin staining solution for 5-10 minutes (adjust time according to staining results and requirements). b. Rinse with tap water to remove excess staining solution for about 10 minutes. c. Rinse again with distilled water (for a few seconds). d. Optional: Differentiate for about 2-30 seconds depending on the differentiation solution, then rinse with tap water for 10 minutes. e. Stain with eosin staining solution for 30 seconds to 2 minutes (adjust time according to staining results and requirements). At this point, if direct observation is required, wash twice with 70% ethanol. If dehydration, clearing, and mounting are required, proceed with the subsequent steps. After washing with 70% ethanol, dehydration, clearing, and mounting can still be performed according to the subsequent steps.

[0294] ③. Dehydration, clearing, mounting, or other staining: a. Dehydration, clearing, and mounting: 70% ethanol for 10 seconds, 80% ethanol for 10 seconds, 90% ethanol for 10 seconds, or anhydrous ethanol for 10 seconds. Clear with xylene for 5 minutes. Replace with fresh xylene and clear again for 5 minutes. Mount with neutral resin or other mounting medium. Under a microscope, the cell nuclei appear blue, while the cytoplasm appears pink or red.

[0295] (3) Masson staining

[0296] Masson staining was performed using the Solarbio Masson staining kit (catalog number G1340). The staining steps are as follows:

[0297] (1) Fix tissue with 10% formaldehyde solution, paraffin section, and routinely dewax to water. (2) Stain with hematoxylin solution for 5-10 min. (3) Rinse briefly with running water, then differentiate with 1% hydrochloric acid. (4) Rinse with running water for several minutes. (5) Stain with Masson's compound solution for 5-10 min. (6) Rinse briefly with distilled water. (7) Treat with 1% phosphotungstic acid solution for about 5 min. (8) Do not rinse with water, directly counterstain with bright green solution (or aniline blue solution) for 5 min. (9) Treat with 1% glacial acetic acid solution for 1 min. (10) Dehydrate repeatedly with 95% alcohol. (11) Dehydrate with anhydrous ethanol, clear with xylene, and mount with neutral resin.

[0298] The results are as follows Figure 8 and Figure 9As shown, Figure 8 To show the general condition of mice after knocking down Circ_0002186, Figure 8 In Figure A, the changes in mouse hair are observed four months after irradiation. Figure 8 In the middle, B represents the running distance of the mice four months after irradiation; Figure 8 In the middle, C represents the change in mouse body weight after irradiation; Figure 8 D shows the morphology and size of the mouse lungs four months after irradiation; Figure 8 E represents the lung coefficient of mice four months after irradiation; Figure 8 In the middle F, the expression of Circ_0002186 in mouse lung tissue was observed four months after irradiation. Figure 9 Knocking down Circ_0002186 can improve the symptoms of radiation-induced pulmonary fibrosis in mice. Figure 9 In the middle, A and C show the H&E staining results of lung tissue sections from mice four months after irradiation and the semi-quantitative lung scores. Figure 9 Figures B and D show the Masson staining and quantitative results of mouse lung tissue sections four months after irradiation.

[0299] Four months after irradiation, the mice's fur turned white and they became emaciated. Figure 8 (A) Significant atrophy and collapse of lung tissue ( ) Figure 8 (D), weight loss was significant ( Figure 8 (C) , increased lung weight coefficient ( Figure 8 In the middle E), the running distance of mice was significantly shortened ( Figure 8 (Middle B). HE staining, Masson's staining, histological analysis, and relative collagen expression results showed that four months after ionizing radiation, the alveolar structure of mice was severely damaged, with significant collagen deposition in the lungs and severely impaired respiratory function, successfully establishing a radiation-induced pulmonary fibrosis model. Histopathological results of mouse lung tissue sections one month after irradiation showed that after ionizing radiation, the lung tissue structure of mice in the IR and IR+NC groups gradually became denser, the alveolar septa slightly widened, alveolar cavities began to melt and partially collapse, and a small number of inflammatory cells were visible in the bronchial lumen. Figure 9 The results indicate that one month after irradiation, the mice's lungs remained in an inflammatory state, and the lung tissue structure began to transform into pulmonary fibrosis. When Circ_0002186 was knocked down in mice under ionizing radiation conditions, all of the above indicators improved, suggesting a reduction in the degree of pulmonary fibrosis and an improvement in lung function. This suggests that Circ_0002186 may serve as a target for prevention and intervention in the occurrence and development of RIPF.

[0300] 6.3 Discussion of the Experiment

[0301] In this application, Circ_0002186 exhibits high homology with humans and mice, and circRNA itself, due to its structural stability, resistance to degradation, and ease of detection, possesses the potential to become a therapeutic target and a good biomarker. Therefore, in this study, an adeno-associated virus (AAV) with a knockdown sequence of Circ_0002186 was constructed and specifically administered to the lungs of mice. Four months after irradiation, the body size and weight of mice in the IR and IR+NC groups were significantly lower than those in the NC and IR+si groups. The rough surface of the lung tissue and the smaller overall size of the lungs suggested possible alveolar collapse and lung atrophy. The lung coefficient of mice in the IR and IR+NC groups was greater than that in the NC and IR+si groups, possibly due to severe collagen deposition or pulmonary congestion leading to an increased lung coefficient. The mouse running distance test is a non-invasive test to evaluate respiratory function in mice. Mice in the IR and IR+NC groups ran significantly shorter distances than those in the NC group, while mice in the IR+si group ran significantly longer distances than those in the IR+NC group, suggesting that Circ_0002186 can effectively improve respiratory function in mice after ionizing radiation. From the H&E results, the lung tissue structure of mice in the IR and IR+NC groups was dense, showing a clear tendency towards pulmonary fibrosis. However, the lungs of mice in the IR+si group still maintained normal alveolar structure and morphology, suggesting that knocking down Circ_0002186 can effectively protect lung epithelial cells in mice after ionizing radiation, thereby improving the symptoms of radiation-induced pulmonary fibrosis. In conclusion, Circ_0002186 can serve as an effective target for intervention in the occurrence and development of radiation-induced pulmonary fibrosis.

[0302] Experiment Summary

[0303] 1. Adeno-associated virus (AAV) therapy with circRNA can induce its specific and persistent expression in mouse lung tissue.

[0304] 2. Knockdown of Circ_0002186 under ionizing radiation conditions can effectively improve the general condition of mice (e.g., hair, weight) caused by ionizing radiation.

[0305] 3. Knockdown of Circ_0002186 under ionizing radiation conditions can effectively protect the lung structure and improve the respiratory function of mice, suggesting that Circ_0002186 can be an effective intervention target for radiation-induced pulmonary fibrosis.

[0306] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. Use, the use is any one of the following: A1), the substance for regulating expression of the Circ_0002186 gene or the substance for regulating activity or content of the Circ_0002186 in the preparation of the drug for treating animal radiation lung injury is applied; A2), the substance for regulating expression of the Circ_0002186 gene or the substance for regulating activity or content of the Circ_0002186 in the preparation of the drug for identifying or assisting in identifying animal radiation lung injury is applied; A3), the substance for regulating expression of the Circ_0002186 gene or the substance for regulating activity or content of the Circ_0002186 in the preparation of the drug for preventing animal radiation lung injury is applied; The Circ_0002186 is a CircRNA encoded by a DNA molecule with a nucleotide sequence shown in SEQ ID No. 1; The substance for regulating expression of the Circ_0002186 gene or the substance for regulating activity or content of the Circ_0002186 is a biological material, and the biological material is any one of the following: B1), an RNA molecule for inhibiting or reducing expression of a gene encoding the Circ_0002186 or an RNA molecule for inhibiting or reducing activity or content of the Circ_0002186;The RNA molecule is siRNA targeting the gene encoding the Circ_0002186, and the nucleotide sequence of the siRNA is SEQ ID No. 6; B2), a DNA molecule expressing the RNA molecule of B1); B3), an expression cassette containing the DNA molecule of B2); B4), a recombinant adenovirus vector containing the DNA molecule of B2) or a recombinant adenovirus vector containing the expression cassette of B3); The radiation lung injury is radiation therapy induced lung epithelial cell senescence or radiation therapy induced pulmonary fibrosis.

2. Biological material, the biological material is any one of the following: B1), an RNA molecule for inhibiting or reducing expression of a gene encoding the Circ_0002186 or an RNA molecule for inhibiting or reducing activity or content of the Circ_0002186;The RNA molecule is siRNA targeting the gene encoding the Circ_0002186, and the nucleotide sequence of the siRNA is SEQ ID No. 6;The Circ_0002186 is a CircRNA encoded by a DNA molecule with a nucleotide sequence shown in SEQ ID No. 1; B2), a DNA molecule expressing the RNA molecule of B1); B3), an expression cassette containing the DNA molecule of B2); B4), a recombinant adenovirus vector containing the DNA molecule of B2) or a recombinant adenovirus vector containing the expression cassette of B3).

Images