A recombinant hepatitis virus antigen, gene and kit

By using highly specific recombinant hepatitis virus antigens and improved sample diluents, the problems of low purity, low specificity and strong cross-reactivity of existing ELISA detection kits were solved, and the effects of simplifying result judgment, reducing sample usage and shortening detection time were achieved.

CN116284259BActive Publication Date: 2025-10-17SHANGHAI XINDANYA BIOTECHNOLOGY CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310123610.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-02-09
Publication Date
2025-10-17
Estimated Expiration
2043-02-09

AI Technical Summary

Technical Problem

The existing experimental animal mouse hepatitis virus antibody ELISA detection kit uses double antigen coating, which has low antigen purity and low specificity, resulting in strong cross-reactivity, large sample size, long detection time and complex statistical results.

Method used

The use of highly specific recombinant hepatitis virus antigen coating, combined with improved sample diluent, and a single-antigen-coated ELISA kit simplifies result judgment and reduces sample usage and detection time.

Benefits of technology

It improves the specificity of detection, reduces cross-reactions, reduces sample usage, simplifies result judgment, shortens detection time, and improves the sensitivity and simplicity of detection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116284259B_ABST
    Figure CN116284259B_ABST
Patent Text Reader

Abstract

The application provides a recombinant hepatitis virus antigen, genes and kits, and belongs to the technical field of animal disease detection. The amino acid sequence of the recombinant hepatitis virus antigen is shown as SEQ ID No. 1. The recombinant hepatitis virus antigen provided by the application has the characteristics of high purity and high specificity, can effectively reduce the cross-reaction between reagents, and has better specificity. The high-specificity protein effectively reduces the background value of negative samples, avoids the use of double-antigen detection, is simpler to detect, uses less samples, and is more conducive to the judgment of results. Compared with the same ELISA detection kit on the market, the overall performance of the kit has the advantages of short detection time, higher sensitivity, simpler result judgment and the like.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of animal disease detection, in particular to a recombinant hepatitis virus antigen, gene and kit. BACKGROUND

[0002] The existing experimental animal mouse hepatitis virus antibody ELISA detection kit is coated with double antigens (positive antigen + negative antigen), and the antigen is cultured from cells infected with the virus. The cultured antigen has low purity and specificity, and has certain cross reactivity. The double antigen plate detection consumes a large amount of sample, takes a long time (more than 120 minutes), and the result statistics are more complex (the OD value measured by the positive antigen coated hole is subtracted from the OD value measured by the negative antigen coated hole, the difference is calculated, and then the relationship between the difference and the critical value is judged to determine the positive and negative). SUMMARY

[0003] In order to solve the above problems, the present application provides a recombinant hepatitis virus antigen, gene and kit, which is coated with a recombinant antigen with high specificity. The sample diluent is improved, which can effectively reduce the background absorbance value of the sample and reduce the background color, so that the result can be directly judged from the color of the reaction plate. In addition, due to the single antigen coating, the sample consumption can be saved, the reaction time can be reduced, and the result can be judged by absorbance value, which is simple and convenient, and can well solve the defects of the prior art.

[0004] In order to achieve the above purpose, the present application provides the following technical scheme:

[0005] The present application provides a recombinant hepatitis virus antigen, and the amino acid sequence of the recombinant hepatitis virus antigen is shown in SEQ ID No. 1.

[0006] The present application also provides a gene encoding the recombinant hepatitis virus antigen of the above technical scheme, and the nucleotide sequence of the gene is shown in SEQ ID No. 2.

[0007] The present application also provides an ELISA detection kit for detecting experimental mouse hepatitis virus antibody, which comprises an enzyme-labeled plate coated with the recombinant hepatitis virus antigen of the above technical scheme.

[0008] Preferably, the coating concentration of the recombinant hepatitis virus antigen on the enzyme-labeled plate is 1 μg / ml.

[0009] Preferably, it further comprises a sample diluent, a washing solution, a positive quality control, a negative quality control, an enzyme label, a substrate solution and a termination solution.

[0010] Preferably, the sample diluent comprises 0.1M PBS buffer, 2% bovine serum albumin, 1% trehalose and 0.5% PEG6000.

[0011] Preferably, the washing solution comprises 0.1M phosphate buffer and 0.5% Tween-20.

[0012] Preferably, the positive quality control contains mouse hepatitis virus antibody positive serum diluted 1:100 by a protein stabilizer.

[0013] The negative quality control is mouse hepatitis virus antibody negative serum diluted 1:100 by a protein stabilizer.

[0014] Preferably, the enzyme marker is horseradish peroxidase-labeled anti-mouse IgG, and the concentration of the enzyme marker is 1:500-1:4000.

[0015] Preferably, the substrate solution contains 3,3',5,5'-tetramethylbenzidine, hydrogen peroxide and 0.1M sodium citrate solution.

[0016] The termination solution is 0.1-2mol / L sulfuric acid solution.

[0017] The present application has the following advantages:

[0018] (1) The recombinant protein has high purity and high specificity, which can effectively reduce the cross-reaction between reagents and has better specificity.

[0019] (2) The protein with high specificity effectively reduces the background value of negative samples, avoids the use of double antigen detection, and is simpler in detection, uses less sample, and is more conducive to the judgment of results (single antigen detection, only the OD value of the sample is compared with the critical value to judge the positive and negative results).

[0020] (3) The overall performance of the kit is compared with the same ELISA detection kit on the market, which has the advantages of shorter detection time, higher sensitivity and simpler result judgment. BRIEF DESCRIPTION OF DRAWINGS

[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced as follows.

[0022] Figure 1 Purification map of recombinant hepatitis virus antigen. DETAILED DESCRIPTION

[0023] A recombinant hepatitis virus antigen, the amino acid sequence of the recombinant hepatitis virus antigen is shown as SEQ ID No. 1, specifically as follows:

[0024] MSFVPGQENAGGRSSSVNRAGNGILKKTTWADQTERGPNNQNRGRRNQPKQTATTQPNSGSVVPHYSWFSGITQFQKGKEFQFAEGQGVPIANGIPASEQKGYWYRHNRRSFKTPDGQQKQLLPRWYFYYLGTGPHAGASYGDSIEGVFWVANSQADTNTRSDIVERDPSSHEAIPTRFAPGTVLPQGFYVEGSGRSAPASRSGSRSQSRGPNNRARSSSNQRQPASTVKPDMAEEIAA.

[0025] The application also provides a gene encoding the recombinant hepatitis virus antigen described in the above technical solution, the nucleotide sequence of the gene is shown as SEQ ID No. 2, specifically as follows:

[0026] ATGTCATTTGTACCCGGACAAGAAAATGCTGGCGGTAGATCCTCGTCCGTGAACCGTGCGGGCAACGGCATTCTGAAAAAGACCACCTGGGCGGACCAGACGGAACGTGGTCCGAACAACCAGAATCGCGGCCGCCGCAATCAGCCGAAACAGACGGCCACCACTCAACCGAATAGCGGCAGCGTGGTGCCGCACTATAGCTGGTTCAGCGGGATCACCCAGTTCCAGAAGGGCAAAGAGTTCCAGTTTGCGGAAGGTCAAGGTGTTCCGATTGCGAACGGCATCCCGGCGAGCGAACAGAAGGGTTATTGGTACCGTCATAACCGCCGTTCGTTCAAAACCCCGGACGGCCAACAAAAGCAACTCTTGCCACGTTGGTATTTCTACTACCTGGGTACCGGTCCGCACGCGGGCGCAAGCTACGGTGATTCCATTGAGGGTGTTTTTTGGGTTGCCAATAGCCAGGCTGACACCAACACCCGTTCTGATATTGTCGAGCGCGATCCGAGTTCCCATGAAGCGATCCCGACCCGTTTTGCTCCGGGTACGGTCCTGCCGCAAGGTTTTTACGTTGAGGGCTCTGGTCGTTCTGCACCGGCTAGCAGATCAGGCTCACGTAGCCAAAGCCGTGGTCCTAACAACCGTGCGCGTAGCAGCAGCAATCAGCGCCAACCAGCGAGCACCGTGAAACCGGACATGGCAGAGGAAATCGCCGCG.

[0027] In the present application, the method for preparing the recombinant mouse hepatitis virus antigen preferably comprises:

[0028] Firstly, the amino acid sequence of mouse hepatitis virus is found, the sequence is inquired into the mouse codon frequency table using codon Usage detebase database, the codon with higher frequency is selected for codon optimization, and is cloned into pET28a(+) vector through restriction enzyme sites EcoRI and SalI, to obtain pET-mouse hepatitis virus recombinant plasmid; the plasmid is transformed into BL21(DE3) E. coli, to obtain pET-mouse hepatitis recombinant bacteria; the pET-mouse hepatitis recombinant bacteria is induced with 0.1-1.0 mmol / L IPTG, and is induced at 37 DEG C for 2-6 h, the bacterial liquid is collected, centrifuged, and the supernatant is discarded, the obtained protein is washed, dissolved, and subjected to affinity purification, to obtain the recombinant mouse hepatitis virus protein with a molecular weight of 32KD, which is a recombinant mouse hepatitis virus antigen.

[0029] The application also provides an ELISA detection kit for detecting mouse hepatitis virus antibody, comprising an enzyme-labeled plate coated with the recombinant hepatitis virus antigen of the above technical solution.

[0030] In the application, the ELISA detection kit preferably further comprises sample diluent, washing liquid, positive quality control, negative quality control, enzyme label, substrate solution and termination solution.

[0031] In the application, the sample diluent preferably comprises 0.1M PBS buffer, 2% bovine serum albumin, 1% trehalose and 0.5% PEG6000.

[0032] In the application, the washing liquid preferably comprises 0.1M phosphate buffer and 0.5% Tween-20. In the application, the positive quality control preferably contains mouse hepatitis virus antibody positive serum diluted 1:100 times with protein stabilizer; the negative quality control is preferably mouse hepatitis virus antibody negative serum diluted 1:100 times with protein stabilizer. In the application, the enzyme label is preferably horseradish peroxidase-labeled anti-mouse IgG, and the concentration of the enzyme label is preferably 1:500-1:4000. In the application, the substrate solution preferably comprises 3,3',5,5'-tetramethylbenzidine, hydrogen peroxide and 0.1M sodium citrate solution; and the termination solution is preferably 0.1-2 mol / L sulfuric acid solution.

[0033] The application does not have special limitations on the use method of the ELISA detection kit, and the skilled in the art can use the conventional method.

[0034] In order to further illustrate the application, the application will be described in detail below in combination with examples, but they should not be understood as limiting the protection scope of the application.

[0035] Example 1

[0036] Preparation of kit and selection of reaction conditions

[0037] 1) Preparation of recombinant mouse hepatitis virus antigen: (gene sequence search-plasmid construction-linking product transformation of E. coli cells-induction culture of recombinant plasmid-protein purification and identification.

[0038] First, the amino acid sequence of the mouse hepatitis virus is searched, and the codon usage frequency table of the mouse is searched using the codon usage database to select the codon optimization with high frequency. The codon is cloned into the pET28a(+) vector through the restriction enzyme sites EcoRI and SalI to obtain the pET-mouse hepatitis virus recombinant plasmid; the plasmid is transformed into BL21(DE3) E. coli to obtain the pET-mouse hepatitis recombinant bacteria; the pET-mouse hepatitis recombinant bacteria is induced by 0.1-1.0 mmol / L IPTG, and the bacteria are collected after 2-6 h of induction culture at 37°C. The supernatant is discarded after centrifugation, and the obtained protein is washed, dissolved, and affinity purified to obtain a recombinant mouse hepatitis virus protein with a molecular weight of 32KD (SEQ ID No. 1);

[0039] 2) Selection of ELISA kit preparation reaction system:

[0040] A: The optimal coating concentration of the recombinant antigen and the optimal dilution concentration of the enzyme label can be determined by the chessboard method. The antigen is coated in four gradients, and the enzyme label is diluted in four gradients. The positive mouse hepatitis sample and the negative sample are tested. The OD value of the positive sample is 1.0, and the P / N value of the antigen coating concentration and the enzyme label dilution degree is the largest. The optimal selection is the best choice, and the results are shown in Table 1: when the antigen dilution multiple is 1 / 100, and the enzyme label dilution multiple is 1 / 1500, the OD of the positive sample is about 1.0, and the P / N value is greater than 2.1. Therefore, the optimal coating concentration of the mouse hepatitis virus antigen is 1 / 100 (1 μg / ml), and the dilution degree of the HRP-labeled anti-mouse IgG antibody is (1 / 1500).

[0041] Table 1 Determination results of antigen coating concentration and enzyme label dilution degree

[0042]

[0043] B: Selection of the optimal serum dilution

[0044] The enzyme-labeled plate was coated with the selected coating antigen concentration, and the positive sample and the negative sample were diluted by 1 / 10, 1 / 50, 1 / 100, and 1 / 200, respectively. The enzyme marker concentration was selected to be 1 / 1500. The dilution of the sample with the OD value of 1.0 and the P / N value of the largest sample was selected as the optimal dilution. The results are shown in Table 2: when the sample dilution is 1 / 100, the OD value is about 1.0, and the P / N value is the largest. Therefore, the optimal serum dilution is 1 / 100.

[0045] Table 2: Determination results of the optimal serum dilution

[0046]

[0047] C: Determination of the optimal sample reaction time and temperature

[0048] The enzyme-labeled plate was coated with the selected coating antigen concentration, and the sample was diluted by 1 / 100. The combination of reaction time and temperature was set to the following gradients: room temperature for 30 min, room temperature for 60 min, room temperature for 120 min, 37°C for 30 min, and 37°C for 60 min. The enzyme marker concentration was selected to be 1 / 1500. The combination of time and temperature with the OD value of 1.0 for the positive sample and the OD value of 0.1 for the negative sample was selected as the optimal. The results are shown in Table 3: both room temperature reaction for 120 min and 37°C reaction for 30 min can meet the requirements, but 37°C reaction can significantly reduce the reaction time, so the sample reaction time is selected to be 37°C reaction for 30 min.

[0049] Table 3: Determination results of the optimal reaction temperature and time

[0050]

[0051] D: Selection of the sample diluent

[0052] The enzyme-labeled plate was coated with the selected coating antigen concentration, and the sample was diluted by 1 / 100. There were four kinds of diluents: diluent 1 was 0.1M PBS buffer, diluent 2 was 0.1M PBS buffer + 2% BSA, diluent 3 was 0.1M PBS buffer + 2% BSA + 1% trehalose, and diluent 4 was 0.1M PBS buffer + 2% BSA + 1% trehalose + 0.5% PEG6000, all with a pH of 7.4. The above were mass percent. The detection was carried out according to the enzyme marker concentration and the reaction conditions determined above, and the diluent of the sample with the OD value of 1.0 for the positive sample and the OD value of 0.1 for the negative sample and the largest P / N value was selected as the optimal sample diluent. The results are shown in Table 4: diluent 4 can best meet the requirements, and the background value is significantly reduced, so PBS buffer + BSA + trehalose + PEG6000 is selected as the optimal diluent formula.

[0053] Table 4 Determination results of optimal sample dilution

[0054]

[0055]

[0056] E: Determination of kit critical value

[0057] Recombinant mouse hepatitis virus protein antigen was coated on an enzyme-labeled plate at a concentration of 1 / 100 (1 μg / ml), and the coating solution was a carbonate buffer solution with pH = 9.6; the coating was performed at 4°C overnight (12-16 hours), and then the coating was washed twice with a washing solution, and then the coating was blocked with a PBS buffer solution containing 2% BSA and 1% sucrose at 37°C for 3 hours. The coating was dried at room temperature for 12 hours.

[0058] 110 parts of serum samples (90 parts of negative serum samples and 20 parts of known positive serum samples, including 10 parts of weak positive samples) diluted by 1:100, negative and positive quality control samples were added, and the plate was sealed and reacted at 37°C for 30 min. The plate was washed with 300 μl / well of washing solution for 3 times, and then dried after the last washing. An anti-mouse IgG HRP enzyme marker was added, and the plate was reacted at 37°C for 30 min. The plate was washed with 300 μl / well of washing solution for 3 times, and then dried after the last washing. 100 μl of TMB substrate was added, and the plate was reacted at 37°C for 15 min. Then, 50 μl of a stop solution was added to stop the reaction. The absorbance value (OD value) was read under an enzyme-labeled instrument with a wavelength of 450 nm. The determination method of the critical value was determined according to the OD value of the negative sample and the OD value of the positive sample. The calculation method of the critical value was as follows: 1. CUTOFF = 0.2 + 1 × negative control OD value (note: when the negative control is less than 0.10, the value is calculated as 0.10, and when the negative control is greater than or equal to 0.10, the value is calculated as the actual value). For example, when the OD value of the negative control is 0.05 < 0.1, CUTOFF = 0.2 + 1 × 0.1 = 0.3. 2. When the OD value of the sample is greater than or equal to the CUTOFF, the sample is determined as positive. The critical value is feasible through the results of the positive and weak positive samples. The specific results are shown in Table 5 (in which samples 1-90# are negative samples, and samples 91-110# are positive samples) :

[0059] Table 5 Detection results of determination of kit critical value

[0060]

[0061]

[0062] E: Preparation and use method of the kit

[0063] Coat the enzyme plate with recombinant mouse hepatitis virus protein antigen at a concentration of 1 / 100 (1 μg / ml) in carbonate buffer solution at pH 9.6; coat overnight (12-16 hours) at 4°C, wash twice with washing solution, then block with PBS buffer solution containing 2% BSA and 1% sucrose for 3 hours at 37°C. Dry at room temperature for 12 hours.

[0064] Add the diluted serum sample, positive and negative quality control, seal the plate and react for 30 minutes at 37°C. Wash 3 times with 300 μl / well of washing solution, dry the plate after the last wash, add HRP enzyme marker containing anti-mouse IgG, react for 30 minutes at 37°C, wash 3 times with 300 μl / well of washing solution, dry the plate after the last wash, add 100 μl of TMB substrate, react for 15 minutes at 37°C, then add 50 μl of stop solution to stop the reaction. There are two ways to judge the results: 1) the color of the reaction plate can be observed by the naked eye to judge the positive and negative results of the sample, colorless and transparent is negative, yellow to yellow is weak positive to positive, 2) read the absorbance value (OD value) under the enzyme plate reader with a wavelength of 450 nm, calculate the critical value according to the results of the negative control, ≥ the critical value is a positive sample, < the critical value is a negative sample.

[0065] Example 2

[0066] The kit performance study, kit preparation and use are carried out in the following manner.

[0067] Coat the enzyme plate with recombinant mouse hepatitis virus protein antigen at a concentration of 1 / 100 (1 μg / ml) in carbonate buffer solution at pH 9.6; coat overnight (12-16 hours) at 4°C, wash twice with washing solution, then block with PBS buffer solution containing 2% BSA and 1% sucrose for 3 hours at 37°C. Dry at room temperature for 12 hours.

[0068] Add the diluted serum sample, positive and negative quality control, seal the plate and react for 30 minutes at 37°C. Wash 3 times with 300 μl / well of washing solution, dry the plate after the last wash, add HRP enzyme marker containing anti-mouse IgG, react for 30 minutes at 37°C, wash 3 times with 300 μl / well of washing solution, dry the plate after the last wash, add 100 μl of TMB substrate, react for 15 minutes at 37°C, then add 50 μl of stop solution to stop the reaction. There are two ways to judge the results: 1) the color of the reaction plate can be observed by the naked eye to judge the positive and negative results of the sample, colorless and transparent is negative, yellow to yellow is weak positive to positive, 2) read the absorbance value (OD value) under the enzyme plate reader with a wavelength of 450 nm, calculate the critical value according to the results of the negative control, ≥ the critical value is a positive sample, < the critical value is a negative sample.

[0069] A: Kit accuracy and specificity

[0070] 10 positive samples and 20 negative samples, 3 critical value samples were tested according to the above reaction procedure, the positive detection rate was 100%, the negative detection rate was 100%, and 3 critical value samples were all detected positive. The results are shown in Table 6.

[0071] Table 6 Kit accuracy and specificity test results

[0072]

[0073] B: Kit precision

[0074] According to the above reaction procedure, 1 positive sample and 1 negative sample were tested 10 times each, the mean and standard deviation SD of 10 results were calculated, and the within-batch precision CV was calculated, the CV was within 10%, and the specific results are shown in Table 7.

[0075] Table 7 Kit precision test results

[0076]

[0077]

[0078] C: Kit cross reaction

[0079] The kit was used to detect mousepox virus, mouse pneumonia virus, mouse enterovirus type III virus, mouse parvovirus, mouse Sendai virus and other antibody positive samples, and all were detected negative, and there was no cross reaction with the above mouse pathogens.

[0080] D: Sensitivity of the kit

[0081] One strong positive sample was diluted by 8 gradients, and the kit was detected according to the above procedure, each gradient was repeated 3 holes, and the commercially available kit was detected according to the requirements of its instruction manual, and the sensitivity difference of the two was compared, the results are shown in Table 8, the results show that: under the dilution of 1 / 1600, the comparative product has been detected negative, and the kit of the application can still detect positive, therefore the sensitivity of the kit is higher.

[0082] Table 8 Kit sensitivity test results

[0083]

[0084] D: Comparison of the kit with the comparative reagent

[0085] The kit and the currently commercially available kit on the market were used to detect the same 62 samples, including 5 positive samples, and the results are shown in Table 9; the results show that among the 62 samples, the comparative reagent detects 57 negative and 5 positive, and the kit of the application detects 57 negative and 5 positive, the results are consistent.

[0086] Table 9 Kit comparison study results

[0087]

[0088]

[0089] Although the above embodiments have been described in great detail, it should be understood that the application is not limited to those embodiments but encompasses any and all embodiments within the scope of the application.

Claims

1. A recombinant hepatitis virus antigen, characterized in that: The amino acid sequence of the recombinant hepatitis virus antigen is shown in SEQ ID No.

1.

2. A gene encoding the recombinant hepatitis virus antigen according to claim 1, characterized in that: The nucleotide sequence of the gene is shown in SEQ ID No.

2.

3. An ELISA test kit for detecting experimental mouse hepatitis virus antibodies, characterized in that: The invention comprises an enzyme labeling plate coated with the recombinant hepatitis virus antigen according to claim 1.

4. The ELISA detection kit according to claim 3, wherein The coating concentration of the recombinant hepatitis virus antigen on the ELISA plate is 1 μg / ml.

5. The ELISA detection kit according to claim 3, wherein It also includes sample diluent, washing solution, positive quality control, negative quality control, enzyme marker, substrate solution and stop solution.

6. The ELISA detection kit according to claim 5, characterized in that The sample diluent includes: 0.1M PBS buffer, 2% by weight of bovine serum albumin, 1% by weight of trehalose, and 0.5% by weight of PEG6000.

7. The ELISA detection kit according to claim 5, characterized in that The washing solution includes: 0.1M phosphate buffer and 0.5% Tween-20 by volume.

8. The ELISA detection kit according to claim 5, characterized in that The positive quality control product contains mouse hepatitis virus antibody positive serum diluted 1:100 times with protein stabilizer; The negative control product is mouse hepatitis virus antibody negative serum diluted 1:100 with protein stabilizer.

9. The ELISA detection kit according to claim 5, characterized in that The enzyme marker is horseradish peroxidase-labeled anti-mouse IgG, and the concentration of the enzyme marker is 1:500 to 1:4000.

10. The ELISA detection kit according to claim 5, characterized in that The substrate solution contains 3,3',5,5'-tetramethylbenzidine, hydrogen peroxide and 0.1M sodium citrate solution; The stop solution is a 0.1-2 mol / L sulfuric acid solution.

Citation Information

Patent Citations

  • Establishment and application of vaccinia virus vector-based reverse genetics system

    CN101948516A

  • Composite murine hepatitis virus detection kit, detection method and application

    CN104232797A