HYNb21 nanobody, expression plasmid and expression host bacteria, and its applications
By constructing and screening the nanobody HYNb21 targeting the SARS-CoV-2 Omicron variant, the problem of existing antibodies being unable to target the RBD domain was solved, realizing an efficient and low-cost detection method suitable for the detection of the SARS-CoV-2 Omicron variant.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-01-05
- Publication Date
- 2026-03-10
AI Technical Summary
Existing antibodies are unable to effectively target the RBD domain of the SARS-CoV-2 Omicron variant, resulting in strong detection and immune evasion capabilities, rapid infectivity and transmission, and highly concealed symptoms that are difficult to detect.
A nanobody HYNb21 targeting the SARS-CoV-2 Omicron variant was developed. A phage display library was constructed, high-affinity antibodies were screened and purified, and the nanobody was expressed and purified using E. coli to prepare a detection kit.
This method achieves specific binding to the RBD domain of the SARS-CoV-2 Omicron variant, simplifying the production process, reducing costs, and improving the efficiency and accuracy of detection.
Smart Images

Figure CN116284355B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the nanobody HYNb21 targeting SARS-CoV-2 Omicron, its expression plasmid, expression host bacteria, and applications, belonging to the field of biotechnology. Background Technology
[0002] The S protein on the surface of SARS-CoV-2 is the most important surface protein of the virus and a crucial target for neutralizing antibodies and vaccine design. The S protein comprises S1 and S2 subunits. During viral infection, the receptor-binding domain (RBD) in the S1 subunit binds to human angiotensin-converting enzyme 2 (ACE2); subsequently, the S2 subunit mediates the fusion of the virus with the host cell membrane. After fusion, the virus releases its genetic material into the host cell, completing the infection process. Multiple mutations in the S protein of SARS-CoV-2 Omicron affect the viral infection process, resulting in SARS-CoV-2 Omicron's high infectivity, rapid spread, strong immune evasion ability, relatively mild symptoms, high latency, and difficulty in detection. Therefore, there is an urgent need to develop antibodies targeting the RBD domain of SARS-CoV-2 Omicron. Summary of the Invention
[0003] The purpose of this invention is to provide a nanobody HYNb21 that targets the SARS-CoV-2 Omicron variant, which can be used for the detection of the SARS-CoV-2 Omicron variant.
[0004] The technical solution adopted in this invention is: a nanobody HYNb21 targeting SARS-CoV-2 Omicron, the amino acid sequence of which is shown in SEQ ID No.1.
[0005] Preferably, the encoding gene sequence of the nanobody HYNb21 is shown in SEQ ID No. 2.
[0006] The present invention also discloses an expression plasmid for a nanobody, expressing the above-mentioned nanobody HYNb21.
[0007] Preferably, the plasmid vector is PET-22b.
[0008] The present invention also discloses an expression host bacterium for nanobodies, characterized in that the above-mentioned expression plasmid is transformed into Escherichia coli host bacteria.
[0009] The present invention also discloses the application of the above-mentioned nanobody in the detection of SARS-CoV-2 Omicron.
[0010] The present invention also discloses a kit for detecting SARS-CoV-2 Omicron, comprising the above-mentioned nanobody.
[0011] The beneficial effects of this invention are:
[0012] 1. The nanobody of the present invention is a single-domain heavy chain antibody (i.e., nanobody) that can specifically bind to the RBD domain of the SARS-CoV-2 omecron variant, and can be used for the detection of the SARS-CoV-2 omecron variant.
[0013] 2. Using the nanobody gene sequence and host cell disclosed in this invention, the nanobody can be efficiently expressed in Escherichia coli, and the production process is simple, low-cost, and high-yield. Attached Figure Description
[0014] Figure 1 Example 1: Electrophoresis diagram of nanobody gene, where the first lane from the left is the marker and the second lane is the nanobody gene.
[0015] Figure 2 Example 1 shows the colony verification PCR electrophoresis results, where the first lane from the left is the marker, and the remaining lanes contain 24 randomly selected colonies.
[0016] Figure 3 Example 4: SDS-PAGE image of purified nanobody. In the figure, control is the negative control, HYNb21(O) is the binding of nanobody HYNb21 to the RBD domain of SARS-CoV-2 Omicron variant, and HYNb21(W) is the binding of nanobody HYNb21 to the RBD domain of the original SARS-CoV-2 strain.
[0017] Figure 4 Sensor diagrams of Omicron RBD and HYNb21.
[0018] Figure 4 Each band represents a different loading concentration, with the loading amounts for the bands from bottom to top being 0.5 μg / ml, 1 μg / ml, 2 μg / ml, 4 μg / ml, and 8 μg / ml, respectively. Detailed Implementation
[0019] To further illustrate the technical means and effects of the present invention in achieving its intended purpose, the following detailed description of the specific implementation methods, structures, features, and effects of the present invention, in conjunction with the accompanying drawings and preferred embodiments, is provided below.
[0020] Example 1: Construction of a nanobody library targeting the SARS-CoV-2 Omicron RBD domain:
[0021] (1) The concentration of SARS-CoV-2 Omicron variant RBD domain (Essential China, catalog number: 40592-V49H7-B) was 500 micrograms per milliliter. For each immunization, 1 mg of SARS-CoV-2 Omicron variant RBD domain was mixed with an equal volume of Freund's adjuvant and immunized one alpaca once a week for a total of 4 immunizations. Except for the first immunization which used complete Freund's adjuvant, the remaining immunizations all used incomplete Freund's adjuvant. During the immunization process, B cells were stimulated to express antigen-specific nanobodies.
[0022] (2) After four immunizations, venous blood was collected, and serum titers were determined using an indirect ELISA method. 100 ml of peripheral blood lymphocytes were extracted from alpacas, and total RNA was extracted using the RNA extraction kit provided by QIAGEN.
[0023] (3) Following the instructions of the Super-Script III FIRST STRANDSUPERMIX kit, the extracted RNA was reverse transcribed into cDNA and the VHH chain was amplified using nested PCR. First round of PCR:
[0024] Table 1 Primer sequences for the first round of PCR
[0025] Upstream primer: GTCCTGGCTGCTCTTCTACAAGGC (SEQ ID No. 3) Downstream primer: GGTACGTGCTGTTGAACTGTTCC (SEQ ID No. 4)
[0026] Amplify the fragment between the heavy chain antibody guide peptide and antibody CH2, anneal at 54°C for 25 cycles;
[0027] Using the first-round PCR products as templates, a second round of PCR was performed:
[0028] Table 2 Primer sequences for the second round of PCR
[0029] Upstream primer: GATGTGCAGCTGCAGGAGTCTGGRGGAGG (SEQ ID No. 5) Downstream primer: GGACTAGTGCGGCCGCTGGAGACGGTGACCTGGGT (SEQ ID No. 6)
[0030] The fragment between the FR1 region of the heavy chain antibody and the long and short hinge regions (long and short fragments) was amplified, annealed at 60°C for 17 cycles, and the target fragment was recovered. Results are as follows: Figure 1 The DNA bands from left to right are: the first is a 100bp molecular marker, and the second is a nanobody gene electrophoresis band of approximately 500bp.
[0031] (4) Digest 20 μg pComb3 phage display vector (supplied by Biovector) and 10 μg VHH with restriction endonucleases (purchased from NEB) PstI and NotI, and ligate the two fragments with T4 DNA ligase (purchased from TaKaRa).
[0032] (5) The ligation product was electroporated into electrocompetent TG1 cells to construct a phage display library of SARS-CoV-2 Omicron variant RBD domain nanobodies, and the library size was determined to be 1.8*10^6 cells / year. 8 Meanwhile, the insertion rate of the constructed library was detected by colony PCR, and the insertion rate was approximately 100%. After the library construction was completed, 24 clones were randomly selected for colony PCR to determine the insertion rate. The upstream primer was TCGAGGTCGACGGTATC (SEQ ID No. 7), and the downstream primer was TGTAAAACGACGGCCAGT (SEQ ID No. 8). Figure 2 The colony PCR results are displayed. The results show that the insertion rate has reached 100%.
[0033] Example 2: Screening process for nanobodies targeting the SARS-CoV-2 Omicron RBD domain:
[0034] (1) 200 μg of the SARS-CoV-2 Omicron variant RBD domain dissolved in 100 mmol pH 8.2 NaHCO3 was coupled onto an ELISA plate and incubated overnight at 4°C. A negative control was also set up.
[0035] (2) On the second day, add 100 μL of 0.1% casein to each of the two wells and seal at room temperature for 2 hours.
[0036] (3) After 2 hours, add 100 μl of phage (8*10) 11 The TFU-immunized alpaca nanobody phage display gene library was incubated at room temperature for 1 hour.
[0037] (4) Wash 5 times with PBST (PBS contains 0.05% Tween 20) to wash away unbound phages.
[0038] (5) Phages that specifically bind to the RBD domain of the SARS-CoV-2 Omicron variant are dissociated using triethylamine (100 mM) and then used to infect E. coli TG1 bacteria in the logarithmic growth phase. Phages are then produced and purified for the next round of screening. This screening process is repeated 3-4 times. During this continuous screening process, positive clones are continuously enriched, thus achieving the goal of using phage display technology to screen for SARS-CoV-2 Omicron variant RBD domain-specific antibodies from the antibody library.
[0039] Example 3: Screening for specific single positive clones using phage enzyme-linked immunosorbent assay (ELISA):
[0040] (1) From the cell culture dishes containing phages after the above 3-4 rounds of screening, 96 single colonies were selected and inoculated into TB medium containing 100 micrograms per milliliter of ampicillin (1 liter of TB medium contains 2.3 g of potassium dihydrogen phosphate, 12.52 g of dipotassium hydrogen phosphate, 12 g of peptone, 24 g of yeast extract and 4 ml of glycerol). After growing to the logarithmic phase, IPTG was added to a final concentration of 1 mmol and cultured overnight at 28°C.
[0041] (2) Obtain crude antibody by permeation method and transfer the antibody to antigen-coated ELISA plate and place it at room temperature for 1 hour.
[0042] (3) Wash away unbound antibodies with PBST, add mouse anti-HA tag antibody, and incubate at room temperature for 1 hour.
[0043] (4) Wash away unbound antibodies with PBST, add anti-mouse alkaline phosphatase conjugate (goat anti-mouse alkaline phosphatase labeled antibody), and incubate at room temperature for 1 hour.
[0044] (5) Wash away unbound antibodies with PBST, add alkaline phosphatase colorimetric solution, and read the absorbance value at 405 nm wavelength on an ELISA instrument.
[0045] (6) When the OD value of the sample well is more than 3 times greater than the OD value of the control well, it is judged as a positive clone well.
[0046] (7) The bacteria in the positive clone wells were transferred to LB liquid medium containing 100 micrograms per milliliter of ampicillin in order to extract plasmids and perform sequencing.
[0047] The gene sequences of each clone were analyzed using the sequence alignment software VectorNTI. Clones with the same CDR1, CDR2, and CDR3 sequences were considered as the same clone, while clones with different sequences were considered as different clones. Finally, one nanobody, HYNb21, was selected. Its amino acid sequence is shown in SEQ ID NO: 1, and its nucleic acid sequence is shown in SEQ ID NO: 2.
[0048] Example 4: Expression and purification of nanobodies in host bacterium Escherichia coli:
[0049] (1) The nanobody (VHH) obtained from the previous sequencing analysis was subcloned into the expression vector PET-22b, and the recombinant plasmid that was correctly identified by sequencing was transformed into the expression host bacteria DE3. It was plated on LB solid medium containing 100 μg / mL ampicillin and incubated overnight at 37°C; (2) Single colonies were selected and inoculated into 15 mL of LB medium containing 100 μg / mL ampicillin and cultured overnight at 37°C with shaking; (3) 1 mL of overnight inoculum was inoculated into 1 mL of LB medium and cultured at 37°C with shaking. When the OD value reached 0.6-1, IPTG was added and cultured overnight at 28°C with shaking; (4) The next day, the bacteria were collected by centrifugation; (5) The bacterial cells were broken to obtain crude antibody extract; (6) The antibody protein was purified by nickel column affinity chromatography. To obtain high-purity antibody, imidazole gradient elution was used, and the final purity of the protein was over 90%. The purified SDS-PAGE is shown in [link to SDS-PAGE]. Figure 3 .
[0050] Example 5: Affinity detection of nanobodies and SARS-CoV-2 Omicron RBD domains
[0051] This assay was performed using a Biacore T200 instrument. The SPR method was employed to immobilize Omicron RBD antigen on an SA chip, with the HYNb21 nanobody as the analyte. The affinity between the antibody and the antigen was measured. Approximately 155 RU of Omicron RBD was immobilized and bound to the HYNb21 nanobody. The HYNb21 antigen-antibody binding sensor map and affinity results are shown below. Figure 4 The summary table of antigen-antibody affinity data is shown in Table 3.
[0052] Table 3 Summary of SPR Affinity Test Results
[0053]
[0054] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some modifications or alterations to the above-disclosed technical content to create equivalent embodiments without departing from the scope of the present invention. Any simple modifications, equivalent changes and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.
Claims
1. A Nanobody targeting SARS-CoV-2 Omicron HYNb21, characterized in that: The amino acid sequence of the nanobody HYNb21 is shown as SEQ ID No.
1.
2. The gene encoding the Nanobody HYNb21 according to claim 1, characterized in that: The coding gene sequence of the nanobody HYNb21 is shown as SEQ ID No.
2.
3. An expression plasmid for a Nanobody, characterized in that Expressing the nanobody HYNb21 of claim 1.
4. The expression plasmid of claim 3, wherein The plasmid vector is PET-22b.
5. An expression host cell for a Nanobody, characterized in that The expression plasmid of claim 3 or 4 is transformed into an E. coli host bacterium.
6. The use of the nanobody of claim 1 in the preparation of a reagent for detecting SARS-CoV-2 Omicron.
7. A kit for detecting SARS-CoV-2 Omicron, characterized by: The nanobody HYNb21 of claim 1.
Citation Information
Patent Citations
Single-chain antibody for resisting SARS-COV-2 virus S protein and application of single-chain antibody
CN111848789A
Targeting SARS-CoV-2 nano antibody as well as preparation method and application thereof
CN114478758A