A strain of Streptomyces alfalfa and its application

Abstract

The present invention belongs to the field of microbial technology, and specifically relates to a strain of Streptomyces alfalfa and its application. The Streptomyces alfalfa is specifically Streptomyces alfalfae TX21, and its deposit number is CGMCC No. 26479. The TX21 strain has different degrees of inhibitory effect on plant pathogenic fungi; the supernatant of the fermentation broth of the TX21 strain has the effect of promoting plant growth, and the radicle and plumule length of the rice seeds treated with the fermentation supernatant are increased to varying degrees; the fermentation supernatant can also significantly increase the chlorophyll content in the cotyledons of cucumbers, promoting their growth and development; the fresh weight and root length of the cucumber seedlings treated with the fermentation supernatant within a certain dilution multiple are also significantly increased. In addition, C6H was isolated from the supernatant of the fermentation broth of the TX21 strain. 23 N5O5S (2-methylthio cis-zeatin riboside) is the first cytokinin isolated from Streptomyces alfalfa.

Description

Technical field:

[0001] The invention belongs to the technical field of microorganisms, and particularly relates to a Streptomyces alfalfa strain and application thereof. Background technology:

[0002] The development of modern agriculture is inseparable from fertilizers. However, with the extensive use of chemical fertilizers, it not only affects the healthy growth of plants but also causes soil and water pollution, thereby endangering people's lives and health. Microbial fertilizers can drive nutrient cycles and transform various pollutants to improve soil structure and tillage properties. Among them, plant growth-promoting root bacteria (PGPR) have strong rhizosphere colonization capabilities and have multiple beneficial effects on plants. They are currently the main production strains of microbial fertilizers. They can promote plant growth in various ways, such as through direct or indirect effects such as activating nutrients, secreting plant hormones (gibberellins, auxins, etc.), and volatile substances, reducing or inhibiting the severity of plant diseases and promoting plant growth in adverse conditions (such as drought, salt land, etc.).

[0003] Common plant growth-promoting bacteria include Pseudomonas, Bacillus, Agrobacterium, Evansia, and Streptomyces. Streptomyces, a key component of plant root growth-promoting bacteria, is a valuable source of natural products. They not only produce a variety of antimicrobial substances to inhibit the growth of pathogens, but also regulate plant root development through the secretion of plant hormones and signaling substances such as auxin (IAA), cytokinin (CTK), and gibberellin (GA3), ultimately promoting plant growth and development. However, current research on Streptomyces secondary metabolites, as well as their commercialization and industrialization, primarily focuses on antimicrobial substances, while relatively little research is conducted on their growth-promoting properties. Therefore, further research is needed on their application in microbial fertilizers and plant growth regulators to support my country's strategy of reducing fertilizer use and increasing efficiency, and implementing green agricultural development. Summary of the invention:

[0004] The purpose of the present invention is to provide a Streptomyces alfalfa strain having both antibacterial and growth-promoting capabilities, thereby enriching the application of Streptomyces in microbial fertilizers and growth regulators.

[0005] One of the technical solutions provided by the present invention is a strain of Streptomyces alfalfae, which is specifically Streptomyces alfalfae TX21, which was isolated by the applicant from a soil sample in a greenhouse in the suburbs of Beijing. It was deposited on January 13, 2023 in the General Microbiology Center of the China Culture Collection Administration (address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Postal Code 100101), with a deposit number of CGMCC No. 26479.

[0006] The second technical method provided by the present invention is the application of the above-mentioned Streptomyces alfalfa, specifically its application in inhibiting plant pathogens or promoting plant growth, and further its application in preparing microbial fertilizers or growth regulators. The mycelium extract of this strain has a growth inhibitory effect on a variety of plant pathogenic fungi, and its fermentation supernatant can significantly promote the growth of cucumber seedlings, and can be used for the further development and utilization of microbial fertilizers and growth regulators.

[0007] The third technical solution provided by the present invention is the application of the aforementioned Streptomyces alfalfa, especially in the inhibition of plant pathogens;

[0008] Furthermore, the plant pathogens include but are not limited to Rhizoctonia solani, Glechoma viride, Botrytis cinerea, Alternaria alternata, poplar canker, tomato leaf mold, Colletotrichum spp., Triticum aestivum, and Rice blast fungus.

[0009] The fourth technical solution provided by the present invention is the use of the supernatant of the fermentation broth of Streptomyces alfalfae TX21 in promoting plant growth;

[0010] Furthermore, the fermentation liquid supernatant or its diluted solution is applied to the plants by seed soaking, foliage spraying, etc.;

[0011] Furthermore, the fermentation supernatant is prepared as follows: the spore suspension is inoculated into a culture medium, cultured for 5-9 days, and then the supernatant is collected by centrifugation, and the fermentation supernatant is obtained after sterilization;

[0012] Furthermore, the preparation method of the fermentation broth supernatant is as follows: 10 7 The spore suspension of cfu / ml was inoculated into the culture medium at an inoculum size of 1%, and cultured in a shaker at 28°C and 200 rpm for 7 days, followed by centrifugation at 12000 rpm for 3 minutes, and sterilized by filtration using a sterile microporous filter membrane with a pore size of 0.22 μm to obtain the fermentation supernatant.

[0013] Furthermore, the culture medium is CS medium (w / v): 5% corn flour, 4% soybean flour, 1% soluble starch, 2% glucose, 0.5% MgSO4·7H2O, 0.7% CaCO3, and the rest is water;

[0014] Furthermore, the culture medium is composed of (w / v): 5% cornstarch, 4% beef liver extract powder, 1% soluble starch, 2% glucose, 0.5% MgSO4·7H2O, 0.7% CaCO3, and the remainder is water;

[0015] Furthermore, the culture medium is composed of (w / v): 5% corn flour, 4% soybean flour, 1% soluble starch, 2% glucose, 0.5% MgSO4·7H2O, 0.7% CaCO3, 0.012% adenine sulfate, and the remainder is water;

[0016] The fifth technical solution mentioned in the present invention is the use of a mycelial extract of Streptomyces alfalfae TX21 in inhibiting the growth of plant pathogens;

[0017] The pathogens include but are not limited to: Rhizoctonia solani, Alternaria vulgaris, Botrytis cinerea, Botrytis cinerea, Tomato leaf mold, etc.

[0018] Furthermore, the mycelial extract is prepared by adding a methanol solution to the mycelial cells, disrupting the mycelial cells by ultrasonication, centrifuging the supernatant, and evaporating the methanol to obtain the mycelial extract;

[0019] Furthermore, the mycelia obtained by ultrasonic disruption and centrifugation were soaked in methanol again, and the supernatant obtained by centrifugation was combined with the extract collected by the first centrifugation;

[0020] Furthermore, the lower layer of mycelium after centrifugation of the fermentation liquid was taken, methanol solution was added thereto, the mycelium was broken with an ultrasonic cleaner, centrifuged at 12000r for 3 minutes, the supernatant was taken, and the remaining mycelium was soaked in methanol for another 4 hours, then centrifuged to collect the supernatant and combined with the first extract. After the methanol was evaporated under reduced pressure in a rotary evaporator, sterile water was added to dissolve it, and the mycelium extract was obtained.

[0021] Beneficial effects:

[0022] 1. The TX21 strain had varying degrees of inhibitory effect on the nine plant pathogenic fungi tested: the inhibition rate against Helminthosporium maydis was 50.04%, the inhibition rates against Rhizoctonia solani, Botrytis cinerea, tomato leaf mold, Colletotrichum spp. and Magnaporthe grisea were all greater than 30%, and the inhibition rates against Helminthosporium solani, poplar canker and common Alternaria were between 24.39% and 28.77%.

[0023] 2. The supernatant of the fermentation liquid of the TX21 strain has the effect of promoting plant growth: the rice seeds treated with the fermentation supernatant have a maximum radicle growth rate of 48.5%, and the growth rate of the embryo length also reaches 47.1%; the fermentation supernatant can also significantly increase the chlorophyll content in the cotyledons of cucumber, promoting its growth and development; the fresh weight and root length of cucumber seedlings treated with the fermentation supernatant within a certain dilution multiple are also significantly increased.

[0024] 3. C6H was isolated from the supernatant of TX21 fermentation broth. 23N5O5S (2-methylthio cis-zeatin riboside) is the first cytokinin isolated from Streptomyces alfalfa. Description of the drawings:

[0025] Figure 1 The bacterial morphology of strain TX21, A: TX21 mycelial morphology; B: TX21 spore morphology; C: TX21 colony morphology.

[0026] Figure 2 Phylogenetic tree.

[0027] Figure 3 Effects of different concentrations of fermentation supernatant on rice seeds.

[0028] Figure 4 Effects of different concentrations of fermentation supernatant on leaves and roots of cucumber seedlings.

[0029] Figure 5 Effects of different concentrations of fermentation supernatant on chlorophyll in cucumber cotyledons.

[0030] Figure 6 EIC and mass spectra of fermentation supernatant and isopentenyl adenine standard.

[0031] Figure 7 EIC and mass spectra of fermentation supernatant and zeatin standard.

[0032] Figure 8 EIC and mass spectra of fermentation supernatant and dihydrozeatin standard.

[0033] Figure 9 EIC and mass spectra of fermentation supernatant and levodopa adenosine standard.

[0034] Figure 10 EIC and mass spectra of fermentation supernatant and trans-zeatin riboside standard.

[0035] Figure 11 EIC and mass spectra of fermentation supernatant and dihydrozeatin riboside standard.

[0036] Figure 12 EIC and mass spectra of fermentation supernatant and 2-methylthio cis-zeatin riboside standard. Specific implementation method:

[0037] In order to make the purpose, technical solutions and advantages of this patent more clear, the following is a further detailed description of this patent in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain this patent and are not intended to limit the present invention.

[0038] Example 1 Screening and Identification of Streptomyces alfalfa TX21

[0039] Weigh 1 g of soil sample obtained from a greenhouse in the suburbs of Beijing and add it to a conical flask containing 49 ml of sterile water and glass beads. Shake on a shaker at 200 rpm for 30 min, let it stand, take the supernatant, and dilute it with sterile water to 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 200 μL of the suspension was evenly spread on Gao's No. 1 solid medium for isolation and cultured at 28°C. When single colonies appeared, they were picked and purified for culture. The strain obtained was named TX21 and the hyphae morphology was observed using a conventional microscope.

[0040] The results are as follows Figure 1 As shown, the colony of strain TX21 is dense, the aerial hyphae grow luxuriantly, are pink-white, and the base hyphae are yellow. Under ordinary microscope observation, the aerial hyphae of TX21 are dense, multi-branched and straight-chain, and the spores are elliptical and oval.

[0041] The physiological and biochemical characteristics of strain TX21 were identified with reference to the Manual of Identification of Common Bacteria (Dong Xiuzhu, Cai Miaoying. Manual of Systematic Identification of Common Bacteria. Beijing: Science Press, 2001.) and the Manual of Identification of Streptomyces (Actinomycetes Classification Group, Institute of Microbiology, Chinese Academy of Sciences. Beijing: Science Press, 1975.).

[0042]

[0043] Note: “+” indicates a positive biochemical reaction; “-” indicates a negative biochemical reaction.

[0044]

[0045]

[0046] Note: “+” indicates that it can be used; “-” indicates that it cannot be used.

[0047]

[0048] Note: “+++” indicates a faster growth rate; “++” indicates an average growth rate; and “+” indicates a poor growth rate.

[0049] Molecular biology identification:

[0050] The genome of strain TX21 was extracted using the GENMED Streptomyces bacterial genomic DNA purification kit, and the 27f (AGAGTTTGATCCTGGCTCAG) and 1492r

[0051] The target gene (TACGGCTACCTTGTTACGACTT) was amplified using the following PCR amplification system: 25 μL of mix, 1 μL of 27f, 1 μL of 1492r, 21 μL of H2O, and 2 μL of DNA. The PCR program was set as follows: 98°C for 109°C, 55°C for 159°C, and 72°C for 609°C, for 30 cycles. The amplified product was analyzed by agarose gel electrophoresis and sequenced by Beijing Qingke Biotechnology Co., Ltd. The 16S rDNA sequence is as follows:

[0052]

[0053] The sequenced 16S rDNA gene sequence was compared with the NCBI nucleic acid database by BLAST, and then a phylogenetic tree was constructed using MEGA 11 based on the neighbor method. Using the genomic DNA of strain TX21 as a template, a 169 sequence with a length of approximately 1500 bp was detected after PCR amplification and sequencing. The constructed phylogenetic tree is shown in Figure 2. Figure 2 The results showed that the strain TX21 had the highest similarity to Streptomyces alfalfae, reaching 97%. Combined with the strain's physiological and biochemical properties, such as gelatin liquefaction and starch hydrolysis, strain TX21 was identified as Streptomyces alfalfae. The isolated Streptomyces alfalfae TX21 was deposited with the General Microbiology Center of the China General Culture Collection Administration under the accession number CGMCC No. 26479.

[0054] Example 2 Determination of TX21 Antibacterial Spectrum

[0055] The antifungal spectrum of this strain was determined using the opposing plate method. Nine plant pathogenic fungi, including Rhizoctonia solani, Glechoma viride, Botrytis cinerea, Alternaria vulgaris, Populus canker, Tomato leaf mold, Colletotrichum spinulosa, Trichoderma spp., and Magnaporthe grisea, were tested to investigate the antagonistic effect of Streptomyces TX21. A 5 mm diameter cake was inoculated from the edge of a pathogen colony cultured at 25°C for 7 days and placed in the center of a PDA plate. Streptomyces TX21 was inoculated on either side of the cake at the same distance. A blank control containing only the pathogen served as the control. The plates were incubated at 25°C for three replicates. The inhibition rate was determined after the blank control filled the plate. The inhibition rate = (diameter of the control pathogen - diameter of the antagonist pathogen) / diameter of the control pathogen × 100%.

[0056] The antifungal spectrum of the strain was determined using the plate standoff method. The results showed that the strain exhibited varying degrees of inhibition against all nine tested plant pathogens. The TX21 strain exhibited an inhibition rate of 50.04% against Helminthosporium maydis, and rates greater than 30% against Rhizoctonia solani, Botrytis cinerea, Tomato leaf mold, Colletotrichum spinulosum, and Magnaporthe grisea. Furthermore, its inhibition rates against Helminthosporium solani, Populus canker, and Alternaria alternata ranged from 24.39% to 28.77%.

[0057]

[0058] Example 3 Determination of antibacterial activity of fermentation supernatant and mycelial extract of strain TX21

[0059] Preparation of fermentation supernatant of strain TX21:

[0060] Put 10 7 A spore suspension of 1 cfu / ml was inoculated into CS medium (5% corn flour, 4% soybean flour, 1% soluble starch, 2% glucose, 0.5% MgSO4·7H2O, 0.7% CaCO3) at an inoculum size of 1%. The culture was shaken at 28°C and 200 rpm for 7 days, then centrifuged at 12000 rpm for 3 minutes and sterilized by filtration through a sterile microporous filter with a pore size of 0.22 μm to obtain the fermentation supernatant, which was collected and set aside.

[0061] Preparation of mycelial extract of strain TX21:

[0062] Take 15 g of the lower layer of bacteria after centrifugation of the fermentation broth, add 30 mL of methanol solution thereto, break the bacteria with an ultrasonic cleaner, centrifuge at 12000 r for 3 min, take the supernatant (i.e., the extract), soak the remaining mycelium with 15 mL of methanol for another 4 h, then centrifuge and collect the supernatant and combine it with the first extract. After evaporating the methanol under reduced pressure in a rotary evaporator, add sterile water to dissolve it, and adjust the volume to 15 ml to obtain the mycelial extract. Place it in a 4°C refrigerator and seal it for storage.

[0063] The antibacterial effects of Streptomyces TX21 fermentation supernatant and mycelial methanol extract were determined using the hyphal growth rate method. The two test liquids were diluted with PDA medium at a ratio of 1:100 and mixed evenly to prepare plates containing antimicrobial activity. A plate containing sterile water served as a negative control. 5-mm-diameter cakes of Rhizoctonia solani, Alternaria vulgaris, Botrytis cinerea, Botrytis cinerea, and Tomato leaf mold were placed in the center of the plates. Each treatment was replicated three times. The antibacterial effects were observed at 25°C. After the control colonies filled the plates, the colony diameters were measured using the cross-hatch method, and the inhibition rate was calculated. Inhibition rate = (control colony diameter - treated colony diameter) / (control colony diameter - cake diameter) × 100%.

[0064] The results showed that the fermentation supernatant had no inhibitory effect on pathogens, while the 100-fold diluted mycelium methanol extract had the best inhibition rate against Botrytis cinerea (see the table below for details), reaching 70.64%, followed by common Alternaria alternata and poplar canker, with inhibition rates reaching more than 43%. The inhibition rate against Rhizoctonia solani and tomato leaf mold was also around 37%.

[0065]

[0066] Example 4: Detection of seed germination promotion ability

[0067] Select healthy, plump, and uniformly sized rice seeds, disinfect their surfaces with a 5‰ carbendazim solution for 90 minutes, and wash them five times with sterile water. At the same time, the fermentation supernatant prepared in Example 3, which had been fermented for 7 days, was diluted 10, 50, 100, and 200 times with sterile water, and sterile water was used as a negative control (CK). The rice seeds were then transferred to culture dishes containing supernatants of different concentrations and cultured in the dark at 25°C for 24 hours. The soaked rice seeds were then evenly placed in a culture dish (15×15 cm) covered with double-layer filter paper, and an appropriate amount of sterile water was added thereto to keep the filter paper moist. After 7 days, the radicle length and plumule length of the rice seeds were measured.

[0068] The results and analysis of the growth promotion effect of TX21 strain on rice seed germination are as follows: Figure 3 As shown, the test results showed that compared with the control group, the rice seeds treated with the fermentation supernatant had a maximum radicle growth rate of 48.5% and a germ length growth rate of 47.1%, which indicated that the fermentation supernatant of the strain had a good promoting effect on rice seed germination.

[0069]

[0070] Example 5: Detection of the ability to promote the growth of cucumber seedlings

[0071] Select the cucumber seeds of uniform size, full particle, use 75% alcohol disinfection 2min after cleaning with sterile water 5 times, be sown in the soil (soil containing black soil, vermiculite) mixed, one for every basin, after sowing one week, it is sprayed process. The fermented liquid supernatant of 9 days fermented by the same method as embodiment 3 is prepared, after 50,100,500 times of sterile water dilution, is sprayed on blade, sprayed once every 3 days, each 1ml sprays 3 times. Using sterile water as negative control, dilute 3500 times of Bihu and 1000 times of Jinpengwang as positive control, spray for the first time and measure relevant index after 2 weeks.

[0072] The growth-promoting effects are shown in the following table and Figure 4 As shown: Compared with CK and two positive treatments, the fresh weight and root length of cucumber seedlings treated with fermentation supernatant within a certain dilution multiple were significantly increased, and the first true leaf was large and thick; the results showed that the TX21 strain can significantly promote the growth of cucumber plants.

[0073]

[0074]

[0075] Example 6: Detection of Promoting Chlorophyll Synthesis in Cucumber Cotyledons

[0076] Select cucumber seeds of uniform size and full grains, and wash them 3 times with sterile water. Transfer the cucumber seeds to a culture dish (15×15 cm) covered with double-layer filter paper, evenly place 30 seeds per dish, add 10 ml of water, and culture at 25°C in the dark until the cotyledons grow. Prepare the fermentation supernatant of 9 days of fermentation according to the same method as Example 3, and dilute it 0, 50, and 200 times with sterile water. At the same time, cut off the cucumber cotyledons under the green light of the dark room, select 9 full and consistent cotyledons and place them in a double-layer filter paper culture dish, add 3 ml of the fermentation supernatant diluted 0, 50, and 200 times, respectively, and use sterile water as a negative control (CK). After culturing in the light at room temperature for 2 days, the chlorophyll content of the cotyledons was measured.

[0077] The results of the assay and analysis of the effect of strain TX21 on the chlorophyll synthesis in cucumber cotyledons are shown in the figure below. Figure 5 As shown in the figure, compared with CK, the undiluted fermentation supernatant can promote the synthesis of chlorophyll in cucumber cotyledons. The results show that the TX21 strain can significantly increase the chlorophyll content in cucumber cotyledons and promote their growth and development.

[0078] Example 7 UHPLC-HRMS identification results

[0079] 500 μL of the fermentation supernatant prepared in Example 3 was diluted with an equal volume of methanol in a 1:1 ratio and mixed thoroughly. The supernatant was centrifuged at 12,000 rpm for 3-5 min. The supernatant was filtered through a 0.22 μm filter and then detected by UHPLC-HRMS (Vanqui9h Flex UHPLC: Thermo Fi9her Scientific, Germering, Germany; Q Exactive Orbitrap MS: Thermo Fi9her Scientific, Bremen, Germany).

[0080] Mass spectrometry detection conditions: Column: Water ACQUITY UPLC BEH C18 (2.1 x 100 mm, 1.7 μm). Mobile phase: A: ultrapure water (0.1% formic acid); B: acetonitrile (0.1% formic acid), 0-20 min, 5% to 100%. Flow rate: 400 μL / min, injection volume: 5 μL. Mass spectrometry parameters: ESI+ source; cone voltage: 3.5 kV; collision voltage: NCE 35.

[0081] The experimental results are as follows Figure 6-12 show:

[0082] Figure 6-12Group A represents the EIC graphs of the fermentation supernatant samples in Example 3, which were subjected to targeted screening using the parent ions of N6-isopentenyl adenine, zeatin, dihydrozeatin, liboadenosine, zeatin riboside, dihydrozeatin riboside, and 2-methylthio-cis-zeatin riboside as calibration;

[0083] Figure 6-12 Group B represents the EIC graphs of targeted screening of standards of N6-isopentenyladenine, zeatin, dihydrozeatin, liboadenosine, zeatin riboside, dihydrozeatin riboside, and 2-methylthio-cis-zeatin riboside, using the parent ions of N6-isopentenyladenine, zeatin, dihydrozeatin, liboadenosine, zeatin riboside, dihydrozeatin riboside, and 2-methylthio-cis-zeatin riboside as calibration materials, respectively;

[0084] Figure 6-12 Group C represents the mass spectra of the fermentation supernatant sample in Example 3 subjected to targeted screening using the parent ions of N6-isopentenyl adenine, zeatin, dihydrozeatin, liboadenosine, zeatin riboside, dihydrozeatin riboside, and 2-methylthio-cis-zeatin riboside as calibration;

[0085] Figure 6-12 Group D represents the mass spectra of the standards of N6-isopentenyladenine, zeatin, dihydrozeatin, liboadenosine, zeatin riboside, dihydrozeatin riboside, and 2-methylthiocis-zeatin riboside, which are calibrated with the parent ions of N6-isopentenyladenine, zeatin, dihydrozeatin, liboadenosine, zeatin riboside, dihydrozeatin riboside, and 2-methylthiocis-zeatin riboside for targeted screening.

[0086] by Figure 6-12 The peak time screening of the standard samples of group B N6-isopentenyl adenine, zeatin, dihydrozeatin, liboadenosine, zeatin riboside, dihydrozeatin riboside and 2-methylthio cis-zeatin riboside was compared respectively. Figure 6-12 Parent ions and characteristic daughter ions in the standard mass spectra of N6-isopentenyl adenine, zeatin, dihydrozeatin, liboadenosine, zeatin riboside, dihydrozeatin riboside, and 2-methylthio cis-zeatin riboside in the fermentation supernatant of group C and group D. Figure 6-11 The mass spectrometry results of groups C and D in the results show that the parent ion and the main characteristic fragment ion 136.06 of the fermentation supernatant are inconsistent with the standard mass spectra of N6-isopentenyl adenine, zeatin, dihydrozeatin, liboadenosine, zeatin riboside, and dihydrozeatin riboside, indicating that the fermentation supernatant does not contain N6-isopentenyl adenine, zeatin, dihydrozeatin, liboadenosine, zeatin riboside, and dihydrozeatin riboside cytokinins; and according to Figure 12As shown in Figures C and D, the fermentation supernatant is consistent with the parent ion 398.14 of 2-methylthio cis-zeatin riboside and its main characteristic fragment ion 182.04, proving that it contains 2-methylthio cis-zeatin riboside. The specific results are shown in the table below:

[0087]

[0088] At the same time, according to the structural fragmentation rules of cytokinins such as zeatin, the parent ion of cytokinin was targeted for detection and its characteristic daughter ions were compared. No cytokinins other than 2-methylthio cis-zeatin nucleoside were found in the fermentation supernatant. The specific results are shown in the table below:

[0089]

[0090] Example 8 Fermentation medium optimization

[0091] Using CS medium (5% corn flour, 4% soybean flour, 1% soluble starch, 2% glucose, 0.5% MgSO4·7H2O, 0.7% CaCO3, and the rest water) as the basic culture medium, a single-factor variable design single-factor experimental plan was used to optimize the nitrogen source of the culture medium.

[0092] An equal amount of soybean powder in the CS medium was replaced with beef liver extract powder, while the other ingredients remained unchanged to form Medium A. 120 mg / L adenine sulfate was added to the CS medium to form Medium B. Fermentation supernatant was prepared according to the method in Example 3, and the content of 2-methylthio-cis-zeatin riboside in the fermentation broth was determined using UHPLC-HRMS.

[0093] The experimental results are shown in the table below. Compared with the original CS medium, the optimized A and B mediums, after fermentation with the TX21 strain, significantly increased the yield of 2-methylthio cis-zeatin riboside compared with CS. Medium B had the best effect, with the content of 2-methylthio cis-zeatin riboside reaching 532.26 μg / L, which is 2.4 times the yield of the original medium.

[0094]

[0095] Example 9 Growth promotion experiment after optimization of fermentation medium

[0096] The fermentation broths obtained from fermentation of the original CS medium, and mediums A and B using the TX21 strain in Example 8 were tested for growth-promoting effects of the supernatants obtained after optimizing the medium according to the experimental method in Example 6. After removing the cotyledons of cucumbers, 3 ml of the undiluted supernatant was added. After incubation at room temperature in the light for two days, the chlorophyll content of the cotyledons after treatment with the supernatants of the A, B, and CS fermentation broths was measured.

[0097] The experimental results are shown in the table below. Compared with the original CS medium, the chlorophyll content of cucumber cotyledons treated with the fermentation supernatant of the optimized A and B mediums was significantly increased. Medium B had the best promoting effect, with a chlorophyll content of 0.21 mg / g, which was 64.06% higher than that of the original CS medium.

[0098]

[0099] The above-described embodiments merely represent several implementation methods of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent. It should be noted that, without departing from the concept of this patent, a person skilled in the art would be able to make various variations, combinations, and improvements to the above-described embodiments, all of which fall within the scope of protection of this patent. Therefore, the scope of protection of this patent shall be determined by the claims.

Claims

1. A Streptomyces alfalfa strain, characterized in that: The Streptomyces alfalfa is specifically Streptomyces alfalfa ( Streptomyces alfalfae )TX21, the deposit number is CGMCC No.26479.

2. Streptomyces alfalfa according to claim 1 ( Streptomyces alfalfae ) TX21 application, characterized by being The Streptomyces alfalfa ( Streptomyces alfalfae ) Application of TX21 in inhibiting plant pathogens or promoting plant growth; The plant pathogenic bacteria are: Rhizoctonia solani, Glechoma viride, Botrytis cinerea, Alternaria alternata, poplar canker, tomato leaf mold, Colletotrichum spp., Trichoderma solani, or Rice blast fungus.

3. The use according to claim 2, characterized in that The Streptomyces alfalfa ( Streptomyces alfalfae ) Application of TX21 in the preparation of microbial fertilizers or growth regulators; The growth regulator is 2-methylthio cis-zeatin riboside.

4. The use according to claim 3, characterized in that The preparation method of the growth regulator is as follows: inoculating a TX21 spore suspension into a culture medium, culturing for 5-9 days, collecting the supernatant by centrifugation, and sterilizing to obtain a fermentation supernatant, wherein the supernatant contains 2-methylthio cis-zeatin riboside; The culture medium is CS culture medium, which is composed of 5% corn flour, 4% soybean flour, 1% soluble starch, 2% glucose, 0.5% MgSO4·7H2O, 0.7% CaCO3, and the rest is water; or The culture medium is composed of: 5% corn starch, 4% beef liver extract powder, 1% soluble starch, 2% glucose, 0.5% MgSO4·7H2O, 0.7% CaCO3, and the rest is water; or The culture medium consists of: 5% corn flour, 4% soybean flour, 1% soluble starch, 2% glucose, 0.5% MgSO4·7H2O, 0.7% CaCO3, 0.012% adenine sulfate, and the remainder is water.

Images