Achenes culture medium and methods for promoting induction and differentiation of Chenopodium plant material

By using CRISPR/Cas9 technology to edit the CqBADH2 gene in quinoa and employing an adventitious bud culture medium with a specific hormone combination, the challenges of quinoa regeneration and genetic transformation were solved. This enabled multi-gene editing and aroma enhancement in quinoa, providing an efficient breeding solution.

CN117481033BActive Publication Date: 2025-11-28BEIJING QI BIODESIGN BIOTECHNOLOGY CO LTD +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202311480522.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-06-13
Publication Date
2025-11-28
Estimated Expiration
2043-06-13

AI Technical Summary

Technical Problem

Existing technologies have failed to effectively establish efficient in vitro regeneration and genetic transformation systems for quinoa, hindering the molecular breeding process and preventing the precise editing of multiple genes in quinoa, particularly the targeted modification of the CqBADH2 gene.

Method used

The genome of quinoa was edited using CRISPR/Cas9 technology, targeting the CqBADH2 gene. Combined with adventitious shoot culture medium, the induction and differentiation of quinoa materials were promoted. This included the use of culture medium with specific hormone combinations such as 2-3 mg/L trans-zeatin nucleoside, 0.5 mg/L triiodobenzoic acid, and 0.5-1 mg/L naphthaleneacetic acid, to achieve stable delivery and regeneration of multiple genes.

Benefits of technology

Stable editing of multiple CqBADH2 genes in quinoa was achieved, significantly improving the aroma of quinoa, providing stable regenerated plants and a targeted molecular breeding platform, and improving breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117481033B_ABST
    Figure CN117481033B_ABST
Patent Text Reader

Abstract

The present application provides a kind of adventitious bud culture medium and method for promoting induction and differentiation of Chenopodium plant material, the adventitious bud culture medium includes basic salt medium, trans-zeatin riboside and naphthalene acetic acid.The present application also provides a method for obtaining Chenopodium plant with increased aroma trait, specifically, the present application provides the use of reducing the expression of CqBADH2 gene.The present application first found that by inhibiting or reducing the expression of CqBADH2 gene in Chenopodium plant, the aroma of Chenopodium plant can be significantly improved.In addition, the present application first realized the simultaneous precise editing of multiple genes or alleles in quinoa using gene editing technology, and completed the stable delivery, which provides a good platform for targeted molecular breeding of quinoa.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This application is a divisional application of the application with the application number CN202310695459.7 and the application name "A method for obtaining non-transgenic quinoa with increased aroma" filed on June 13, 2023. TECHNICAL FIELD

[0002] The present application belongs to the field of biotechnology breeding, and relates to a method for obtaining quinoa with increased aroma, in particular to a method for obtaining breeding materials of quinoa with increased aroma by using genome editing technology to perform site-directed mutagenesis on CqBADH2.1 and CqBADH2.2 genes of betaine aldehyde dehydrogenase of main cultivated quinoa. BACKGROUND

[0003] Quinoa (Chenopodium quinoa) is an ancient crop with a history of 7,000 years, originally from the Andes Mountains, and thriving in the Inca civilization. It is a cold and drought-tolerant plant that can adapt to latitudes and altitudes. The protein content in quinoa seeds is as high as 14%, of which 48% is essential amino acid for human body. The Food and Agriculture Organization (FAO) considers quinoa as the only single plant that can meet the basic nutritional needs of human body. It is praised as the perfect "whole nutrition" for human beings and the "ideal food" for human space migration.

[0004] Quinoa is an allotetraploid, formed by hybridization of the ancestral diploid A genome (C. pallidicaule) and the B genome (C. suecicum). The complexity of its genome has hindered the development of efficient in vitro regeneration and genetic transformation systems, thus impeding molecular breeding progress. Fayza Ruzayq AI Gethami et al. established a regeneration system using quinoa cotyledonary nodes as the starting explant (Fayza Ruzayq AI Gethami and Hameda EI Sayed AhmedEI Sayed. In Vitro: Influence of Various Concentrations of Plant Growth Regulators (BAP&NAA) and Sucrose on Regeneration of Chenopodium quinoa WilldPlant. Journal of Advance in Biology & Biotechnology (2020)). Yanfang Wang et al. established a method for using Agrobacterium rhizogenes to transform quinoa leaves in situ (Yanfang Wang et al., The Establishment of Two Efficient Transformation Systems in Quinoa. Research Square. 2021), but failed to obtain stable regenerated plants.

[0005] This study marks the first time that multiple genes or alleles have been precisely edited simultaneously using CRISPR / Cas9 technology in quinoa, achieving stable delivery and providing a valuable platform for targeted molecular breeding of quinoa. Based on the genetic transformation system of this invention, mutant plants with the knockouts of CqBADH2.1 and CqBADH2.2 were obtained, exhibiting an increased aroma phenotype. Prior to this research, gene editing had only been achieved in diploid maize, soybean, and rice. This study fills a gap in quinoa crop research. Summary of the Invention

[0006] The purpose of this invention is to provide a method for obtaining quinoa plants with increased aroma, particularly a method for obtaining quinoa with increased aroma, and to solve the technical problem of obtaining stable regenerated quinoa.

[0007] A first object of the present application is to provide a method for obtaining a Chenopodium plant with increased aroma, wherein the method comprises a targeted genome modification conferring reduced expression of a CqBADH2 gene to the Chenopodium plant compared to a Chenopodium plant lacking the targeted genome modification.

[0008] Preferably, the Chenopodium plant is quinoa.

[0009] Preferably, the CqBADH2 gene comprises CqBADH2.1 having a sequence as set forth in SEQ No. 1 or a functional variant thereof, CqBADH2.2 having a sequence as set forth in SEQ No. 4 or a functional variant thereof.

[0010] Preferably, the functional variant has at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% sequence identity to its corresponding CqBADH2 nucleotide sequence.

[0011] Further preferably, the CqBADH2.1 and CqBADH2.2 are simultaneously reduced in expression.

[0012] In one embodiment, the targeted genome modification is an insertion, a deletion or a substitution.

[0013] In one embodiment, the method of genome modification comprises gene mutation, gene knockout, gene interruption, RNA interference technology, gene editing technology, introduction of an inhibitor of a gene / protein or any combination thereof.

[0014] In one embodiment, the gene editing technology comprises CRISPR / Cas, TALEN, ZFN, meganuclease or any combination thereof.

[0015] In one embodiment, the target site of the targeted genome modification comprises a nucleotide sequence of 5'-ggctccaattgcccttccta-3' (SEQ No. 9) or a complement thereof.

[0016] Preferably, the gene editing technology is CRISPR / Cas technology; wherein the Cas effector protein in the CRISPR / Cas technology is selected from the group consisting of Cas3, Cas4, Cas5, Cas5e (or CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9, Cas10, Cast10d, Cas12, Cas13, Cas14, CasX, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (or CasA), Cse2 (or CasB), Cse3 (or CasE), Cse4 (or CasC), Csc1, Csc2, Csa5, Csn1, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Cpf1, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csz1, Csx15, Csf1, Csf2, Csf3, Csf4, and Cu1966, and any combination thereof.

[0017] In one embodiment, the method comprises the steps of: introducing into a Chenopodium plant a Cas effector protein and a sgRNA targeting a CqBADH2 gene target site; and screening for plants having a targeted genome modification.

[0018] Preferably, the genome modification is produced by introducing into a Chenopodium plant a construct comprising: (a) Cas effector protein DNA, and a sgRNA sequence selected from the group consisting of SEQ No. 16 or SEQ No. 17, or a combination of both; or (b) a ribonucleoprotein (RNP) complex comprising a Cas effector protein and a sgRNA sequence selected from the group consisting of SEQ No. 16 or SEQ No. 17, or a combination of both.

[0019] Further preferably, the construct is introduced into the plant cell using a method selected from the group consisting of Agrobacterium-mediated delivery, biolistic delivery, polyethylene glycol-mediated delivery, virus-mediated delivery, nanoparticle-mediated delivery, or DNA delivery by grafting.

[0020] Further preferably, the method comprises the step of regenerating a plant having a targeted genome modification.

[0021] In one embodiment, the regenerating step comprises inoculating plant material onto shoot induction medium.

[0022] Preferably, the shoot induction medium comprises a basal salt medium and a hormone component.

[0023] Further preferably, the hormone component contains 2-3 mg / L trans-zeatin riboside (tZT), 0.5 mg / L triiodobenzoic acid (TIBA), 0.5-1 mg / L naphthalene acetic acid (NAA).

[0024] Further preferably, the hormone component contains 2 mg / L trans-zeatin riboside (tZT), 0.5 mg / L triiodobenzoic acid (TIBA), 0.5 mg / L naphthalene acetic acid (NAA).

[0025] A second object of the present application is to provide an isolated nucleotide sequence of an sgRNA, wherein the nucleotide sequence is selected from the group consisting of SEQ No. 16 or SEQ No. 17.

[0026] In one embodiment, the nucleotide sequence is used for the use of CqBADH2 gene targeted genome modification in Chenopodium plants.

[0027] A third object of the present application is to provide an isolated nucleotide sequence of a primer pair, wherein the nucleotide sequence of the primer pair has at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% sequence identity to a nucleotide sequence selected from the group consisting of SEQ No. 28 and SEQ No. 29.

[0028] In one embodiment, the nucleotide sequence is used as a primer pair for identifying or screening Chenopodium plants having an increased aroma trait, said Chenopodium plants having reduced expression of CqBADH2.1 and CqBADH2.2 within their genome.

[0029] In one embodiment, a detection kit for determining the presence or absence of a CqBADH2 genome targeted modification in a Chenopodium plant is provided, wherein the kit contains the primer pair.

[0030] A fourth object of the present application is to provide an adventitious shoot culture medium for promoting callus induction and differentiation in Chenopodium plants.

[0031] Preferably, the adventitious shoot induction medium comprises a basal salt medium and a hormone component.

[0032] Further preferably, the hormone component contains 2-3 mg / L trans-zeatin riboside (tZT), 0.5 mg / L triiodobenzoic acid (TIBA), 0.5-1 mg / L naphthalene acetic acid (NAA).

[0033] Further preferably, the hormone component contains 2 mg / L trans-zeatin riboside (tZT), 0.5 mg / L triiodobenzoic acid (TIBA), 0.5 mg / L naphthalene acetic acid (NAA).

[0034] A fifth object of the present application is to provide a method for promoting induction and differentiation of Chenopodium plant material.

[0035] In one embodiment, the Chenopodium plant material is inoculated in the adventitious bud culture medium.

[0036] The main advantage of the present application is that:

[0037] (1) The present application first discovered that by inhibiting or reducing the expression of the CqBADH2 gene of Chenopodium plant quinoa, the aroma can be significantly improved.

[0038] (2) The present application first realized the simultaneous precise editing of multiple genes or alleles in quinoa using gene editing technology, completed stable delivery, and provided a good platform for targeted molecular breeding of quinoa. BRIEF DESCRIPTION OF DRAWINGS

[0039] Figure 1 . Agrobacterium tumefaciens-mediated transient transformation state diagram of quinoa; Figure 1 of A corresponds to CqBADH2-g1 on the left upper corner, CqBADH2-g2 on the right upper corner, CqBADH2-g3 on the left lower corner, and CqBADH2-g4 on the right lower corner, and the state diagram after 72h culture at 24℃±1℃ in the dark; Figure 1 of B corresponds to CqBADH2-g1, CqBADH2-g2, CqBADH2-g3, and CqBADH2-g4 from left to right, respectively, and the state diagram after co-culture on CQ3 medium; Figure 1 of C corresponds to CqBADH2-g1, CqBADH2-g2, CqBADH2-g3, and CqBADH2-g4 from left to right, respectively, and the state diagram after 14 days on CQ3 medium.

[0040] Figure 2 . CqBADH2-g1, CqBADH2-g2, CqBADH2-g3, CqBADH2-g4, and CqBADH2-g5 enzyme digestion result diagram.

[0041] Figure 3 . Agrobacterium tumefaciens transformation culture state diagram.

[0042] Figure 4 . CqBADH2-g3 transformed plant enzyme digestion diagram, in which 138 plants were respectively in Figure 4 The bands in A-C are numbered from left to right and from top to bottom.

[0043] Figure 5 . Sequencing diagram of mutants QE12 and QE28.

[0044] Figure 6. Determination of 2-AP content in Cqbadh2 homozygous mutant mature seeds (T2 generation).

[0045] Figure 7 . Effect of different basic salts on transformation efficiency of Agrobacterium rhizogenes DETAILED DESCRIPTION

[0046] A further understanding of the application can be obtained by reference to certain specific examples given herein, which are intended to be purely exemplary of the application and are not intended to limit the scope of the application. It will be apparent to those skilled in the art that various modifications and variations can be made to the present application without departing from the spirit or scope of the application. Thus, it is intended that the present application cover modifications and variations of this application provided they come within the scope of the appended claims and their equivalents.

[0047] Example 1, Acquisition of CqBADH2.1 gene of quinoa and design of sgRNA

[0048] Using the BLAST website, the CqBADH2.1 (SEQ No. 1), CqBADH2.2 (SEQ No. 4) gene sequences, CDS sequences (SEQ No. 2, 5) and amino acid sequences (SEQ No. 3, 6) of quinoa were obtained. Details are as follows. The sgRNA was designed in the homologous segment of CqBADH2.1 and CqBADH2.2 genes. According to the website http: / / crispor.tefor.net / crispor.py, the target points were designed as follows:

[0049] Table 1: Target site design of homologous segment of CqBADH2.1 and CqBADH2.2 genes

[0050]

[0051] Note: The underlined sequence represents the PAM sequence

[0052] Example 2, selection of target points and construction of knockout vector

[0053] I. Vector construction

[0054] 1. According to the target points of CqBADH2.1 and CqBADH2.2 gene homologous segments, the corresponding target point primers were synthesized, and the primer sequences were as follows:

[0055] Table 2: Design of target primer sequences

[0056]

[0057] Note: Capital letters represent primer sequences, and lowercase letters represent sticky ends.

[0058] 2. Linking vector

[0059] First step, pKSE401 vector was cut by BsaI enzyme, band size 15429bp+ 1225bp, gel recovery skeleton part is 1529bp size band. Enzyme cutting system is: plasmid 4 ng, BsaI 2.5 μL, Buffer 5 μL, the rest is made up to 50 μL system by H2O.

[0060] Second step, after CqBADH2-g1, CqBADH2-g2, CqBADH2-g3, CqBADH2-g4, CqBADH2-g5 target primers were annealed into double-stranded DNA, they were connected with pKSE401 vector (cut by BsaI) by T4 DNA ligase, and the connection products were transformed into E. coli DH5α, and were named pKSE401-CqBADH2-g1, pKSE401-CqBADH2-g2, pKSE401-CqBADH2-g3, pKSE401-CqBADH2-g4, pKSE401-CqBADH2-g5 respectively. Annealing system: upstream primer 1 μL, downstream primer 1 μL, the rest is made up to 10 μL system by 1×Easy Taq Buffer. Annealing program: 94 ℃ denaturation for 5 min, then 90℃-80℃ gradient cycle, 1 min denaturation at 90℃, 1 min extension at 80℃, a total of 8 cycles, each cycle decreases by 1℃, 4℃ preservation. Continuous system: annealing product 1 μL, pKSE401 1 μL, T4 DNA ligase 0.5 μL, T4 DNA ligase Buffer 1 μL, H2O 6.5 μL.

[0061] After 1 d of culture, single colonies grown on the second day were verified by colony PCR, and the PCR primers were as follows:

[0062] Table 3: Verification primer design

[0063]

[0064] The single colonies with positive colony PCR identification were sequenced, and the single colonies with correct sequencing were selected, and the plasmids were extracted for subsequent experiments.

[0065] II. Selection of target

[0066] 1. Agrobacterium rhizogenes-mediated transient transformation system

[0067] The constructed pKSE401-CqBADH2-g1, pKSE401-CqBADH2-g2, pKSE401-CqBADH2-g3, pKSE401-CqBADH2-g4, pKSE401-CqBADH2-g5 five vectors were introduced into Agrobacterium rhizogenes K599 (strain resistance for Kan) respectively, and streaked on LB solid medium (10 g / L peptone + 5 g / L yeast extract + 5 g / L sodium chloride + 15 g / L agar + 25 mg / L rifampicin + 50 mg / L kanamycin, pH 7.0) and cultured overnight at 28°C in an incubator. Single colonies were inoculated in LB liquid medium (LB solid medium without agar) and cultured overnight at 28°C with 220 rpm shaking. The next day, centrifuged at 18°C, 3500 rpm for 15 min, and the supernatant was discarded, and resuspended with culture solution CQ1 (1.6 g / L B5 medium (Netherlands Duchefa G0210) + 0.5 g / L morpholinoethanesulfonic acid + 0.1 g / L glutamine + 0.1 g / L asparagine + 20 g / L sucrose + 200 μM acetyl-syringone). The concentration of the bacterial solution was determined using an Eppendorf BioPhotometer plus instrument. First, select OD 600 600 nm, add 500 μL CQ1 liquid to calibrate zero, then wash the cuvette with distilled water and dry. Add 500 μL of resuspended bacterial solution, measure OD 600 600 nm, adjust with CQ1 liquid until OD 600 600 nm = 0.5 ± 0.05.

[0068] Seeds of main cultivated quinoa varieties were surface sterilized (soaked in 75% ethanol for 30 s, then rinsed once with sterile water, followed by soaking in NaClO solution with 5% available chlorine for 30-40 min with constant gentle shaking, then rinsed five times with sterile water) and placed on germination medium CQ0 (MS basal salts with vitamins (Phytotech M519, USA) + 30 g / L sucrose + 8 g / L agar) for 10 days. The 1 / 2 hypocotyl and radicle of the seedlings were excised and placed in bacterial suspension. The Petri dishes were placed in a vacuum pump for 10 min. Then the Petri dishes were placed on a shaker at 200 rpm for 20 min. The liquid was discarded and the excess liquid was absorbed with sterile filter paper. The transformed explants were placed on co-cultivation medium CQ2 (1.6 g / L B5 medium + 0.5 g / L meso-inositol + 0.1 g / L glutamine + 0.1 g / L asparagine + 20 g / L sucrose + 200 μΜ acetosyringone + 8 g / L agar) with a layer of filter paper on the bottom. The Petri dishes were incubated in the dark at 24 ± 1 °C for 72 h. After co-cultivation, the explants were transferred to hairy root induction medium CQ3 (MS basal salts with vitamins + 0.5 g / L meso-inositol + 0.1 g / L glutamine + 0.1 g / L asparagine + 20 g / L sucrose + 8 g / L agar + 400 mg / L timentin). The Petri dishes were incubated in the dark at 25 ± 2 °C for 14 days. The culture states at different stages are shown in Fig. 1. Figure 1

[0069] 2. Target selection and identification system

[0070] Genomic DNA was extracted from 100 root hairs of each of the samples modified by introducing CqBADH2-g1, CqBADH2-g2, CqBADH2-g3, CqBADH2-g4 and CqBADH2-g5 target sites. PCR / RE (Polymerase Chain Reaction / Restriction digestion) experiments were performed using the DNA as a template. The PCR / RE analysis method is described in Shan Q. et al. Rapid and efficient gene modification in rice and Brachypodium using TALENs. Molecular Plant (2013). The primers used for PCR amplification are as follows:

[0071] Table 4: PCR / RE amplification primers

[0072]

[0073] The enzyme digestion map of PCR / RE shows that only the enzyme digestion map of CqBADH2-g3 is mutated. As shown in Fig. 2, the enzyme digestion map of CqBADH2-g3 is different from that of the wild type.​Figure 2 The arrow indicates the target band of interest. The results show that only the CqBADH2-g3 target primer can knock out CqBADH2.1 and CqBADH2.2 at the same time, and has knock-out activity.

[0074] Example 3, Transformation of pKSE401-CqBADH2-g3 vector by Agrobacterium tumefaciens method

[0075] Next, the constructed pKSE401-CqBADH2-g3 vector was introduced into Agrobacterium tumefaciens GV3101 (strain resistance Kan), and shaking culture was performed as in Example 2. Resuspension was performed using suspension culture fluid CQ4 (25 mL / L YR bulk 20x stock solution + 5 mL / L YR trace 100x stock solution + 5 mL / L YR iron salt 100x stock solution + 1 mL / L YR vitamin 1000x stock solution + 0.5 g / L morpholinoethanesulfonic acid + 2.5 mg / L copper sulfate pentahydrate + 20 g / L maltose + 2 mg / L trans-zeatin riboside + 0.5 mg / L triiodobenzoic acid + 0.5 mg / L naphthalene acetic acid + 200 μM acetyl cinnamone). The concentration of the bacterial solution was determined using an Eppendorf BioPhotometer plus instrument. First, OD 600 was selected, 500 μL of CQ1 liquid was added to the cuvette and adjusted to zero, and then the liquid was washed and the inside of the cuvette was rinsed with distilled water and dried. 500 μL of resuspended bacterial solution was added, and the OD 600 value was determined, and adjusted by CQ1 liquid until OD 600 = 0.8 ± 0.05. The preparation of the special medium stock solution is shown in the following table, and the inorganic chemicals were purchased from Shengong Biotechnology (Shanghai) Co., Ltd.

[0076] Table 5. Preparation of YR bulk 20x stock solution

[0077]

[0078] Table 6. Preparation of YR trace 100x stock solution

[0079]

[0080] Table 7. Preparation of YR vitamin 1000x stock solution (filter sterilized, aliquot, stored in -20°C refrigerator)

[0081]

[0082] Table 8. Preparation of YR iron salt 100x stock solution

[0083]

[0084] This embodiment takes the main cultivated quinoa variety Caili as an example. After the seeds of Caili are disinfected (same as embodiment 2), the seedlings (at the beginning of the germination of the seedlings) placed on the germination medium CQ0 (MS medium base salt (containing vitamins) + 30 g / L sucrose + 8 g / L agar) for 7 days are transversely cut to remove the hypocotyls, radicles and cotyledons, 3 mm of cotyledons and 2 mm of hypocotyls are retained to form a "W" shape, and the growth point is longitudinally cut by 0.5 mm. Figure 3 A). The bacteria solution is placed in a vacuum pump and pumped to 15 inHg for 10 min. Then it is placed on a shaker at 200 rpm for 3 h. In a sterile environment, the liquid is discarded and the excess bacteria solution is absorbed with sterile filter paper. The transformed explants are placed on the co-culture medium CQ5 (25 mL / L YR bulk 20x mother liquor + 5 mL / L YR trace 100x mother liquor + 5 mL / L YR iron salt 100x mother liquor + 1 mL / L YR vitamin 1000x mother liquor + 0.5 g / L morpholinoethanesulfonic acid + 2.5 mg / L copper sulfate pentahydrate + 20 g / L maltose + 2 mg / L trans-zeatin riboside + 0.5 mg / L triiodobenzoic acid + 0.5 mg / L naphthalene acetic acid + 200 uM acetosyringone + 8 g / L agarose) for 72 h of dark culture at 24℃±1℃, Figure 3 B). After co-culture, the explants are transferred to the cluster bud induction medium CQ6 (50 mL / L YR bulk 20x mother liquor + 10 mL / L YR trace 100x mother liquor + 10 mL / L YR iron salt 100x mother liquor + 1 mL / L YR vitamin 1000x mother liquor + 0.5 g / L morpholinoethanesulfonic acid + 2.5 mg / L copper sulfate pentahydrate + 20 g / L maltose + 2 mg / L trans-zeatin riboside + 0.5 mg / L triiodobenzoic acid + 0.5 mg / L naphthalene acetic acid + 7 g / L polyvinylpyrrolidone + 9 g / L agar + 400 mg / L timentin). 4-6 weeks of light culture at 24℃±1℃, light intensity 4000-6000 lx, light 16 h / d Figure 3 C). The obtained adventitious buds are divided and transferred to the adventitious bud elongation induction medium CQ7 (50 mL / L YR bulk 20x mother liquor + 10 mL / L YR trace 100x mother liquor + 10 mL / L YR iron salt 100x mother liquor + 1 mL / L YR vitamin 1000x mother liquor + 0.5 g / L morpholinoethanesulfonic acid + 2.5 mg / L copper sulfate pentahydrate + 20 g / L maltose + 0.1 mg / L benzylaminopurine + 0.01 mg / L naphthalene acetic acid + 1 g / L activated carbon + 8 g / L agar + 300 mg / L timentin). 2-4 weeks of light culture at 24℃±1℃, light intensity 4000-6000 lx, light 16 h / d, to obtain elongated adventitious buds Figure 3D-1). The obtained elongated adventitious buds were cut off and transferred to rooting medium CQ8 (MS with vitamin basic salt + 0.5 g / L morpholinoethanesulfonic acid + 0.1 g / L glutamine + 0.1 g / L asparagine + 20 g / L sucrose + 0.5 mg / L indole-3-butyric acid (Shanghai Genechem Co., Ltd. A600725) + 8 g / L agar + 200 mg / L timentin). After 2 weeks of culture at 24°C ± 1°C under light with an intensity of 4000-6000 lx and a light duration of 16 h / d, the transformed plants were obtained.

[0085] In addition, we used the same transformation method to transform the Chenopodium quinoa L. variety Qinglvi No. 2, and also obtained transformed plants. The elongated adventitious buds obtained by culturing Qinglvi No. 2 are shown in D-2. This example shows that the transformation conditions of the present application have universality. Figure 3

[0086] Example 4: Mutant detection

[0087] Genomic DNA was extracted from the transformed plants of CqBADH2-g3 in Example 3, respectively. PCR / RE experiments were performed using the DNA as a template (analysis method same as Example 2). A total of 138 samples were taken (the sample numbers are A-C, and the bands are numbered from left to right and from top to bottom, respectively), among which 4 mutants were detected, which were the 3rd, 7th, 12th and 28th bands (the sample numbers were QE3, QE7, QE12 and QE28, respectively). Figure 4 Figure 4 A), corresponding to sample numbers QE3, QE7, QE12 and QE28.

[0088] PCR detection using primers M13F and gRNA-sc-R (as in Example 2) found that 2 of them were negative, which were QE12 and QE28. Primers D-CqBADH2-F3 and D-CqBADH2-R3 were used to amplify QE12 and QE28, and the amplified products were sequenced. The sequencing results are shown in Figure 5

[0089] The sequencing results show that the mutants QE12 and QE28 of this example are double-mutant mutants of Cqbadh2.1 and Cqbadh2.2, wherein QE12 is a homozygous mutant of Cqbadh2.1 with a genotype of -1 bp and a heterozygous mutant of Cqbadh2.2 with a genotype of -2 bp; QE28 is a homozygous mutant of Cqbadh2.1 with a genotype of +1 bp and a homozygous mutant of Cqbadh2.2 with a genotype of +1 bp / -1 bp.

[0090] Example 5: 2-AP content detection

[0091] ​​​2-acetyl-1-pyrroline (2-AP) is an important volatile compound for cereal aroma. Different mutations of betaine aldehyde dehydrogenase (BADH2) can lead to the accumulation of 2-AP, thereby producing aroma. We used GC-MS metabolomics technology to quantitatively analyze 2-AP in the mature seeds (T2 generation) of Cqbadh2.1 and Cqbadh2.2 double mutants, and the content determination results are shown in Table 1. Figure 6 The results show that the 2-AP content of the two Cqbadh2 double mutants (QE12, QE28) compared with the wild type is significantly increased, that is, the Cqbadh2 double mutant can produce an increased trait of aroma.

[0092] Example 6: Quinoa root culture medium screening

[0093] According to the Agrobacterium-mediated transient transformation system in Example 2, we adjusted 1.6 g / L B5 medium (1 / 2 B5) in CQ1 and CQ2 to 3.2 g / L B5 medium (B5), 2.2 g / L MS medium (1 / 2 MS) and 4.4 g / L MS medium (MS) respectively, and the rest of the conditions remained unchanged. We used Agrobacterium tumefaciens of CqBADH2-g3 to perform root test in Qingli 2, and performed corresponding PCR detection. The results are shown in Table 2. Figure 7

[0094] The PCR results show that compared with the other three kinds of culture media, the transformation efficiency of quinoa root induced after being infected and co-cultured with 1.6 g / L B5 (1 / 2 B5) is the highest, reaching 52.5%.

[0095] Example 7: Quinoa shoot induction medium screening

[0096] Select the seeds of Qingli 2, disinfect the seeds according to the method recorded in Example 2, cut the explants after 7 days of germination on CQ0, and inoculate them on different adventitious bud induction media, 30 explants for each treatment, and repeat 3 times. Add different concentrations of trans-zeatin riboside (tZT), triiodobenzoic acid (TIBA), naphthalene acetic acid (NAA), benzylaminopurine (BA) and other common plant hormones to the YR salt (50 mL / L YR bulk 20x stock solution + 10 mL / L YR trace 100x stock solution + 10 mL / L YR iron salt 100x stock solution + 1 mL / L YR vitamin 1000x stock solution) basic medium to obtain high-efficiency bud induction hormone combinations, as shown in Table 9. Transfer every 2 weeks, and count the adventitious bud induction rate after 5 weeks.

[0097] Table 9: Effect of different hormone combinations on adventitious buds

[0098] ​

[0099] The results show that the 20 combinations have a certain effect on the induction of quinoa adventitious buds. With the increase of tZT concentration, the adventitious bud occurrence rate gradually increases, and within a certain range, increasing the concentration of tZT can increase the adventitious bud occurrence rate to a certain extent; but too high concentration of tZT will reduce the adventitious bud occurrence rate, making it continue to callus; when the ZT concentration is 2 mg / L, the callus induction rate of the explant is 98.64%, the average adventitious bud occurrence rate is close to 94.50%, and the plant maintains good uniformity and stability; when the tZT concentration reaches 3 mg / L and above, the callus tissue increases, and the number of differentiated adventitious buds decreases. In summary, the optimal concentration range of tZT is 2-3 mg / L, and the optimal concentration range of NAA is 0.5-1 mg / L. After adding TIBA, it can neutralize the vitrification phenomenon caused by tZT, and make the adventitious buds better stimulate the subsequent division, and the optimal concentration range is 0.5 mg / L. Therefore, 2 mg / L tZT + 0.5 mg / L NAA + 0.5 mg / L TIBA is the best hormone combination formula for adventitious bud induction culture. On the other hand, we compared the adventitious bud induction conditions reported in the prior art document (Zhu Mulan, et al., A quinoa cotyledon node in vitro regeneration method, CN202110221582.6 [P]. First publication date 2021-06-25) with the prior art document. Use the adventitious bud induction medium (MS salt + 1 mg / L BA + 0.1 mg / L NAA) in the prior art document instead of the adventitious bud induction medium of the present embodiment, and the rest of the processing method and materials are the same as the present embodiment. The adventitious bud culture induction rate is 23.46±3.78%, which is much lower than the induction efficiency of tZT, NAA and TIBA of the present invention. Therefore, the present invention also proposes a hormone combination with high induction efficiency.

[0100] SEQUENCE LISTING

[0101] SEQ No. 1: CqBADH2.1 LOC110700462

[0102]

[0103] SEQ No. 2: CqBADH2.1 CDS sequence

[0104]

[0105] SEQ No. 3: CqBADH2.1 amino acid sequence

[0106] MAIPSRQLFIDGEWKEPINKNRIPVINPSTEEIIGDIPAATAEDVELAVAAARRALKRNKGADWAAASGAHRAKYLRAIAKRVTERKDEFAKLEAMDCGKPLDEAAWDIDDVAGCFEYYADQAEALDAKQKAPIALPMETFKSHVLRQPIGVVGLISPWNYPLLMATWKVAPALAAGCAAILKPSEMASVTCLELADVCREVGLPPGVLNILSGYGPEAGGPLASHPDVDKVAFTGSTATGSKIMSSAAQLVKPVSLELGGKSPIIIFEDVDLDQAAEWAAFGCFWTNGQICSATSRLLVHENIAAEFLDRLVKWCKNIKIADPFEDGCRLGPVVSKGQYEKVLKFISTAKSEGATILCGGSRPEHLKKGYFIEPTIISDVSTSMQIWKDEVFGPVLCVKTFSSDEEAIELANDTQYGLGAAVLSKNLERCEKVTKALEVGIVWVNCSQPCFCQAPWGGTKRSGFGRELGEWGIENYLNIKQVTEYISDEPWGWYKNPSKL

[0107] SEQ No. 4: CqBADH2.2 LOC110686717

[0108]

[0109] SEQ No. 5: CqBADH2.2 CDS sequence

[0110]

[0111] SEQ No. 6: CqBADH2.2 amino acid sequence

[0112] MAIPSRQLFIDGEWKEPINKNRIPVINPSTEEIIGDIPAATAEDVELAVAAARKALKRNKGADWAAASGAHRAKYLRAIAKKVTERKDELAKLEAMDCGKPLDEAAWDIDDVAGCFEYYADQAEALDAKQKAPIALPMETFKSHVLRQPIGVVGLISPWNYPLLMATWKVAPALAAGCAAILKPSEMASVTCLELADVCREVGLPPGVLNILSGYGPEAGGPLASHPDVDKVAFTGSTATGSKIMSSAAQLVKPVTLELGGKSPIIVFEDVDLDQAEFLDRLVKWCKNIKIADPFEDGCRLGPVVSKGQYEKVLKFISTAKSEGATILCGGSRPEHLKKGYFIEPTIISDVSTSMQIWKDEVFGPVLCVKTFSSDEEAIALANDTQYGLGAAVLSKNLERCEKVTKALEAGIVWVNCSQPCFCQAPWGGTKRSGFGRELGEWGIENYLIIKQVTEYISDEPWGWYKNPSKL

[0113] SEQ No. 7: CqBADH2-g1

[0114] atcaacaagaatcgcattcc

[0115] SEQ No. 8: CqBADH2-g2

[0116] acttacgtgctatcgctaag

[0117] SEQ No. 9: CqBADH2-g3

[0118] ggctccaattgcccttccta

[0119] SEQ No. 10: CqBADH2-g4

[0120] tcctatggagacattcaagt

[0121] SEQ No. 11: CqBADH2-g5

[0122] cattcaagtctcatgtgctc

[0123] SEQ No. 12: T-CqBADH2-g1 F

[0124] GGAATGCGATTCTTGTTGAT

[0125] SEQ No. 13: T-CqBADH2-g1 R

[0126] atcaacaagaatcgcattcc

[0127] SEQ No. 14: T-CqBADH2-g2 F

[0128] acttacgtgctatcgctaag

[0129] SEQ No. 15: T-CqBADH2-g2 R

[0130] CTTAGCGATAGCACGTAAGT

[0131] SEQ No. 16: T-CqBADH2-g3 F

[0132] ggctccaattgcccttccta

[0133] SEQ No. 17: T-CqBADH2-g3 R

[0134] TAGGAAGGGCAATTGGAGCC

[0135] SEQ No. 18: T-CqBADH2-g4 F

[0136] ACTTGAATGTCTCCATAGGA

[0137] SEQ No. 19: T-CqBADH2-g4 R

[0138] tcctatggagacattcaagt

[0139] SEQ No. 20: T-CqBADH2-g5 F

[0140] cattcaagtctcatgtgctc

[0141] SEQ No. 21: T-CqBADH2-g5 R

[0142] GAGCACATGAGACTTGAATG

[0143] SEQ No. 22: M13F

[0144] TGTAAAACGACGGCCAGT

[0145] SEQ No. 23: gRNA-sc-R

[0146] AAAAGCACCGACTCGGTGCCA

[0147] SEQ No. 24: D-CqBADH2-F1

[0148] TCTTTCTACTCATTTCTCTTTATCCAAG

[0149] SEQ No. 25: D-CqBADH2-R1

[0150] CAAGTTCAGAGATGATTTAAAAAAGAC

[0151] SEQ No. 26: D-CqBADH2-F2

[0152] CAGTGGCTGCAGCTAGAAGG

[0153] SEQ No. 27: D-CqBADH2-R2

[0154] CCAAACATATACTACATGTGCTATCC

[0155] SEQ No. 28: D-CqBADH2-F3

[0156] AAAGCTTGAAGCCATGGATTG

[0157] SEQ No. 29: D-CqBADH2-R3

[0158] CTTCCCTAAATAAATCTGATGAC

[0159] SEQ No. 30: D-CqBADH2-F45

[0160] AAAGCTTGAAGCCATGGATTG

[0161] SEQ No. 31: D-CqBADH2-R45

[0162] TCACCTTTTATATTTTGAGGGATGG.

Claims

1. An adventitious shoot medium, characterized in that, the adventitious shoot medium consists of a basal salt medium, 2 mg / L to 3 mg / L of the trans-zeatin riboside, 0.5 mg / L of the triiodobenzoic acid, and 0.5 mg / L to 1 mg / L of the naphthalene acetic acid; wherein the basal salt medium consists of anhydrous calcium chloride and / or calcium chloride dihydrate at a concentration of 0.1255 g / L, potassium dihydrogen phosphate at 0.4 g / L, potassium nitrate at 3.535 g / L, magnesium sulfate heptahydrate at 0.185 g / L, ammonium nitrate at 1.36 g / L; cobalt chloride hexahydrate at 0.1 mg / L, potassium iodide at 3.00 mg / L, manganese sulfate monohydrate at 40.00 mg / L, boric acid at 12.00 mg / L, copper sulfate pentahydrate at 0.1 mg / L, sodium molybdate dihydrate at a concentration of 1.00 mg / L, zinc sulfate heptahydrate at 8.00 mg / L; myo-inositol at 100.00 mg / L, thiamine hydrochloride at 1.00 mg / L, pyridoxal hydrochloride at 0.50 mg / L, nicotinic acid at 0.50 mg / L, glycine at 2.00 mg / L; 36.70 mg / L of EDTA iron sodium salt.

2. The adventitious shoot medium of claim 1 for use in a method of promoting induction and differentiation of Chenopodium quinoa material.

3. The method of claim 2, characterized in that, the Chenopodium quinoa material is an explant after 7 days of germination of Chenopodium quinoa.

4. The method of claim 2 or 3, characterized in that, the method comprises inoculating Chenopodium quinoa material in the adventitious shoot medium.

Citation Information

Patent Citations

  • A method for in vitro regeneration of quinoa cotyledon nodes

    CN113016611B

  • Chenopodium quinoa willd hypocotyl in-vitro regeneration method

    CN113016610A

  • Chenopodium quinoa cotyledonary joint in-vitro regeneration method

    CN113016611A