Lactobacillus reuteri detection primer, kit and application
The quantitative detection method of Lactobacillus reuteri gyrB gene by fluorescent PCR has solved the problems of sensitivity and specificity in early iron deficiency diagnosis, realizing non-invasive and simple detection of nutritional iron deficiency in sows, and improving the health and growth performance of sows and piglets.
Patent Information
- Application Number
- CN202310003451.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-01-03
- Publication Date
- 2026-05-19
- Estimated Expiration
- 2043-01-03
AI Technical Summary
Existing technologies lack early iron deficiency diagnostic products with high sensitivity, specificity, and precision, leading to untimely iron supplementation in sows, which affects sow productivity and fetal piglet development. Furthermore, traditional testing methods require specialized equipment and cumbersome operations, causing stress to the animals.
Using primers and kits for detecting Lactobacillus reuteri, and employing a fluorescence PCR quantitative detection method, we assessed nutritional iron deficiency in sows using the Lactobacillus reuteri gyrB gene. This included the design of specific primers and probes, combined with internal standard monitoring and nucleic acid extraction-free technology, to simplify the sample processing procedure.
It enables early, accurate, and non-invasive detection of nutritional iron deficiency in sows, improving the health and growth performance of sows and piglets, reducing the frequency of weak piglets, and increasing the economic benefits for farmers.
Smart Images

Figure CN116287331B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of detection technology, specifically relating to primers, kits, and applications for detecting Lactobacillus reuteri. Background Technology
[0002] Iron not only participates in the synthesis of hemoglobin and myoglobin, regulates glucose and lipid metabolism, and maintains mitochondrial oxidative energy supply, but also plays a crucial role in stem cell proliferation and differentiation and immune regulation. Timely and appropriate iron supplementation is essential for improving the immune function and growth performance of sows and piglets.
[0003] Traditional iron deficiency monitoring and inefficient iron supplementation methods often lead to missed optimal iron supplementation windows, resulting in inadequate iron nutrition for piglets and restricted tissue and organ development and growth. This typically manifests as an increase in weak piglets, a decrease in average birth weight and litter weight, and ultimately affects postnatal growth, development, and economic performance. Early monitoring and diagnosis of iron deficiency in sows can broaden the iron supplementation window. Timely and efficient iron supplementation can effectively prevent poor development and growth restriction in piglets, improving the health and productivity of both sows and piglets.
[0004] Developing and applying early monitoring and diagnostic technologies can detect nutritional iron deficiency in sows earlier. Coupled with timely provision of high-producing sows with efficient iron supplements and seizing the iron supplementation window, timely replenishment of the iron nutritional needs of piglets can effectively prevent poor development and growth restriction in piglets, increase the birth weight and litter weight of piglets, reduce the frequency of weak piglets, and improve the health and growth performance of sows and piglets.
[0005] Currently, there is a lack of early diagnostic products for iron deficiency monitoring both domestically and internationally. Existing products for iron deficiency diagnosis include test kits or strips for indicators such as serum iron, hemoglobin (HGB), transferrin, and unsaturated iron-binding capacity (UIBC). (1) Among these, the detection of serum iron, UIBC, and transferrin requires expensive instruments and kits. (2) Although handheld devices exist for HGB detection, the indicator itself has a relatively slow response to "iron deficiency," leading to untimely iron supplementation in sows and affecting their reproductive performance. (3) The above tests require targeted invasive blood sample collection, and the complexity and stress they cause are unsuitable for monitoring the entire herd in pig farms.
[0006] The detection of serum iron and other indicators requires specialized equipment and complex procedures. Currently, most serum iron is detected using chemical colorimetric methods, including the ferroazine colorimetric method, the bispyridine colorimetric method, and the phenoxyazine colorimetric method. Transferrin detection utilizes the binding of anti-transferrin serum with the transferrin to be detected, forming an antigen-antibody complex. This complex increases light absorption and scattering turbidity; by comparing this complex with a standard curve, the transferrin content can be calculated. UIBC determination calculates serum UIBC levels by measuring the change in iron ion concentration before and after the reaction of the colorimetric detection buffer with serum. All of these methods require a spectrophotometer or a fully automated biochemical analyzer, and the procedures are relatively cumbersome.
[0007] Indicators such as hemoglobin (HGB) show a relatively delayed response to iron deficiency. Iron absorption and metabolism are precisely regulated by the body's iron homeostasis system, making iron deficiency highly insidious. When the body is iron deficient, it initially reduces the expression of hepcidin in the liver, prompting the release of iron from tissues such as the liver and spleen for heme and erythrocyte production, maintaining the stability of serum iron and hemoglobin (HGB) levels. After several weeks of sustained iron deficiency, serum iron and HGB levels drop significantly, manifesting clinical symptoms of iron deficiency, requiring 2-3 weeks of continuous iron supplementation to recover.
[0008] Methods such as serum iron, HGB, transferrin, and UIBC are direct detection methods for serum, which require collecting serum from the entire herd. This is not only cumbersome to operate, but also very likely to cause stress to animals, leading to a decline in production performance and other results. Therefore, they are not suitable for monitoring applications under the condition of the entire herd in pig farms. Summary of the Invention
[0009] The technical problem to be solved by the present invention is to provide primers, kits and applications for the detection of Lactobacillus reuteri, which have high sensitivity, good specificity and high precision, and can effectively detect early nutritional iron deficiency in sows.
[0010] The present invention includes a primer for detecting Lactobacillus reuteri, comprising an upstream primer and a downstream primer, wherein the sequence of the upstream primer is 5'-AAGCACCCTGATCCGCAAT-3' (SEQ ID NO.1) and the sequence of the downstream primer is 5'-AATTTGCCGCGCTTCGTCT-3' (SEQ ID NO.2).
[0011] This invention provides a kit for detecting Lactobacillus reuteri, comprising fluorescent reaction solution A, fluorescent reaction solution B, internal standard, negative control, nucleic acid release agent and quantitative reference, wherein the fluorescent reaction solution B contains the primers described above.
[0012] This invention employs a fluorescent PCR quantitative detection method for the Lactobacillus reuteri gyrB gene, which can detect and quantify biological targets in samples, thus providing a simple and easy method for assessing nutritional iron deficiency in sows during pregnancy.
[0013] The fluorescent reaction solution B also contains primers and probes, the sequence of which is 5'-CACGAACAGCGACTGACCATGTCT-3' (SEQ ID NO.3), with a reporter fluorescent group labeled at the 5' end and a quencher fluorescent group labeled at the 3' end;
[0014] The fluorescent reaction solution B also contains internal standard primers and internal standard probes. The internal standard primers include an internal standard upstream primer and an internal standard downstream primer. The sequence of the internal standard upstream primer is 5'-CGCTTGGATAACGACCTA-3' (SEQ ID NO.4), the sequence of the internal standard downstream primer is 5'-CAGCACCACATACTTTCAG-3' (SEQ ID NO.5), and the sequence of the internal standard probe is 5'-TCCTCTAAGCCACTGTCCACACC-3' (SEQ ID NO.6). The 5' end is labeled with a reporter fluorescent group, and the 3' end is labeled with a quencher fluorescent group.
[0015] It also contains an internal standard recombinant plasmid, designated pUC-IPC, with a working concentration of 10. 6 The recombinant plasmid contains a random internal standard sequence, 455 bp in length, with the following nucleotide sequence:
[0016] CTGGAGACTGAGGGTTGACGCGCATTCGTCATTGAACGCAGACACGGCTGAGAGAACATGGAGCGACTGCACTTGGTCGATCTGATTAGGAGTGGGGTTTATGCCCGCGGCTTATCCCCCTATCCTTGCGACACGGGAGAAGACAGATTGTCATCGATTTCGCAAGCCATGATATGTTTTGGCCCGACCAACCGCGTTTTTCTCGCGCTTGGATAACGACCTATG GTGTGGACAGTGGCTTAGAGGACATGACACGACGGGCTGAAAGTATGTGGTGCTGGGGCCCTTAGATAGCTGCATAGTTGGACCGCTAGGAATTATATCAATTCGAGATCTCCAGCCGACAAAGTAGGCTCCTAACTAACAGGGTCCAAAGGTTTATCACCGGTCCTTACTCTTTGCGGGACCTTTCTACCCATACAATATCGTCCTCCGATGATGGATCACGGAG(SEQ ID NO.7).
[0017] The reporting fluorescent group is Fam or Hex, and the quenching fluorescent group is BHQ1.
[0018] The fluorescent reaction solution A contains 1250 μL / tube, 1 tube / box. It includes PCR-Buffer, dNTPs, hot-start Taq enzyme, and UNG enzyme. The Tris-HCl concentration in the PCR-Buffer is 125–200 mM, higher than the commonly used 10 mM concentration. This ensures that the PCR reaction is not affected by the alkaline nucleic acid releasing agent, which is the core reason why this kit enables nucleic acid extraction-free operation.
[0019] The dNTPs include four deoxyribonucleosides: dATP, dUTP, dGTP, and dCTP. dUTP is used instead of the commonly used dTTP, resulting in amplified bands containing U bases in the DNA. This double-stranded structure is hydrolyzed in the presence of UNG enzymes, thus reducing contamination from residual amplification products (a major source of PCR contamination).
[0020] The final concentration of hot-start Taq enzyme in fluorescent reaction solution A is 0.2–0.3 U / μL. This enzyme needs to be activated at approximately 95°C to exercise its amplification activity.
[0021] UNG enzyme, short for uracil-N-glycosylation enzyme, can selectively hydrolyze and break uracil glycosidic bonds in DNA containing U bases, thereby eliminating residual amplification products and aerosol contamination. The optimal activity temperature of this enzyme is 50 degrees Celsius, and it is inactivated at 95 degrees Celsius. Together with hot-start Taq enzyme, it can inhibit false positives.
[0022] Fluorescent reaction solution B: 650 μL / tube, 1 tube / box. The concentrations of upstream and downstream primers are 500–750 nM, and the concentrations of primers and probes are 250–500 nM; the concentrations of internal standard primers and internal standard probes are 250–500 nM, respectively.
[0023] The internal standard contains the recombinant plasmid pUC-IPC, which is diluted to a working concentration of 10. 6 The values are per copy / ml, used as an internal standard. The negative control is a TE buffer solution. The nucleic acid release agent comprises 25–100 mM NaOH, 1–5% PEG6000, and 0.5–1 mM EDTA. In this nucleic acid release agent, NaOH can effectively lyse cells or viruses, release their contents, and denature and inactivate them. The non-ionic detergent PEG6000 further disperses proteins and nucleic acids, and EDTA can effectively inhibit the hydrolysis of DNA by nucleases.
[0024] The concentration of the cloned plasmid pUC-LR-gyrB in the quantitative reference standard was 1.37 × 10⁻⁶. 7 ~1.37×10 4 copies / ml, within this range, showed a linear correlation, with a correlation coefficient R. 2 =0.99, within this linear amplification range, the amplification efficiency is above 94%.
[0025] This invention provides the application of the aforementioned kit in the preparation of a formulation for detecting nutritional iron deficiency in sows. The detection method includes the following steps:
[0026] Add the internal standard to the sample, heat at 85℃~95℃ for a period of time, centrifuge, take the supernatant, add PCR-Mix, the PCR-Mix is a mixture of fluorescent reaction solution A and fluorescent reaction solution B, to obtain the sample to be tested; amplify the negative control, quantitative reference and the sample to be tested respectively, measure the Ct value, and determine whether the sow has nutritional iron deficiency.
[0027] The amplification cycle parameters are set as follows:
[0028]
[0029] The beneficial effects of this invention are that it aims to develop an early monitoring and diagnostic technology that can detect nutritional iron deficiency in sows earlier. Combined with timely administration of highly effective iron supplements to high-producing sows, and by seizing the optimal window for iron supplementation, it can effectively meet the iron nutritional needs of piglets, preventing poor development and growth restriction in piglets, increasing birth weight and litter weight, reducing the frequency of weak piglets, and improving the health and growth performance of both sows and piglets. The application of this technology makes iron deficiency in sows "visible," ensures adequate iron supplementation for sows, and ensures adequate growth for piglets, achieving precise and personalized prevention and control of iron deficiency in sows and piglets. This significantly improves the economic benefits for farmers, and the product has a promising market prospect, providing technical support for the precise regulation of iron nutrition in sows.
[0030] This technical solution establishes a monitoring and diagnostic method for "early iron deficiency" in pigs by detecting biomarkers in biological samples from sows with early iron deficiency. This method reflects the iron nutritional status of the pig herd earlier, more sensitively, and more accurately than traditional monitoring of indicators such as "serum iron" and "hemoglobin".
[0031] This technical solution is based on a mature real-time PCR technology platform. Generally, pig farm laboratories have mature supporting equipment and technical personnel, and can quickly undertake the testing work of this solution.
[0032] This technical solution has been optimized and developed into a reagent kit product, which standardizes and regulates the processes of sampling, processing, detection, and analysis, making it convenient to use.
[0033] This kit employs technologies such as nucleic acid extraction-free detection, internal standard monitoring, and standard curve quantification to achieve simpler and more accurate detection.
[0034] The sample tested using this technical solution is not a serum sample, but a natural fecal sample. It is convenient to collect samples from the entire herd, does not cause stress to the animals, and is easy to promote and apply in clinical practice. Attached Figure Description
[0035] Figure 1 The amplification curves of the 1-F, 1-R primers of this invention are shown.
[0036] Figure 2 The amplification curves of the 2-F,2-R primers of this invention are shown.
[0037] Figure 3 The amplification curves of the 3-F,3-R primers of this invention are shown.
[0038] Figure 4 The amplification curves of the primers and probes 1-P, 1-F, and 1-R of this invention are shown.
[0039] Figure 5 The amplification curves of the primers and probes 2-P, 2-F, and 2-R of this invention are shown.
[0040] Figure 6 The amplification curves of the primers and probes 3-P, 3-F, and 3-R of this invention are shown.
[0041] Figure 7 This is the amplification curve of the internal standard-free system of the present invention.
[0042] Figure 8 Amplification curves with internal standard IPC01 added for this invention.
[0043] Figure 9 Amplification curves with internal standard IPC03 added for this invention.
[0044] Figure 10 Amplification curves with internal standard IPC05 added for this invention.
[0045] Figure 11 The linear amplification curve and standard curve of this invention are shown. Detailed Implementation
[0046] Example 1
[0047] One detection method, the key steps of which are as follows.
[0048] (1) Sample collection: Use a flocked swab to collect fresh fecal samples from sows, place them in a sample tube containing 5 ml of nucleic acid release agent, and mix well.
[0049] (2) Internal standard setting: Add 10 μl of internal standard to each sample tube.
[0050] (3) Nucleic acid release: Place the sample tube in a metal bath or water bath and heat at 85℃~95℃ for 10 min. After a short centrifugation, take the supernatant for subsequent PCR detection.
[0051] Preparation of amplification reagents: Take out each component from the package and place at room temperature until it is completely dissolved. Shake and mix well for later use. Take the corresponding amount of reagents according to the ratio (25 μL of fluorescent reaction solution A / reaction + 15 μL of fluorescent reaction solution B / reaction), mix thoroughly to form PCR-Mix, centrifuge briefly, and add 40 μL of PCR-Mix to each reaction tube.
[0052] (4) Sample addition: Add 10 μL of negative control / quantitative reference / test sample to the corresponding PCR reaction well, cover the tube, mix well, centrifuge briefly, and transfer to the amplification area.
[0053] (5) Amplification: Place the PCR reaction tubes into the sample slots of the amplification instrument, and set the negative control, quantitative reference, and sample name in the corresponding order; select the FAM channel to detect Lactobacillus reuteri nucleic acid; select the HEX channel to detect the internal standard; set the reaction volume to 50 μL; set the cycling parameters as follows:
[0054]
[0055] Once the settings are complete, save the file and run the reaction program.
[0056] (6) Quality control: The negative control HEX channel Ct value ≤ 35, and the FAM channel has no Ct value or a typical amplification curve; the quantitative reference A to DFAM channels are all positive, and the correlation coefficient of the standard curve is R. 2 ≥0.98.
[0057] (7) Result determination: The HEX channel Ct value of the sample to be tested is ≤35; otherwise, it needs to be tested again. The corresponding quantitative measurement results are reported according to the instrument calculation value, and a further assessment of nutritional iron deficiency in sows is made based on the measured value range.
[0058] Example 2
[0059] Metagenomic studies have shown that nutritional iron deficiency in sows during gestation is closely related to the levels of characteristic gut microbiota such as *Lactobacillus johsonii*, *Lactobacillus reuteri*, and *Protella ruminicola*, and these characteristic bacterial species can be used as indicators. Bacterial 16S rRNA, gyrB, recA, pepC, and gdh genes are commonly used for species identification and bacterial detection. In this study, we established a fluorescent PCR quantitative detection method for the *Lactobacillus reuteri* gyrB gene, which can detect and quantify biological targets in samples, thus providing a simple and easy-to-use method for assessing nutritional iron deficiency in sows during gestation.
[0060] 1. Materials and Methods
[0061] 1.1 Reagents and Instruments
[0062] HotStart Taq enzyme (5 U / μL) was purchased from Tiangen Biotech Co., Ltd.; DEPC-treated water was purchased from Shanghai Bioengineering Co., Ltd.; primers, probes, and sequences were synthesized by Shanghai Jierui Bioengineering Co., Ltd.; 2×PCR Buffer (containing Mg) 2+ (such as dNTPs) are prepared by ourselves.
[0063] Eppendorf BioPhotometer D30 Nucleic Acid and Protein Analyzer; Hongshi SLAN-96S Real-Time PCR Instrument; ABI 7500 Real-Time PCR Instrument.
[0064] 1.2 Samples and Processing
[0065] Positive plasmid: Based on the full-length sequence of the gyrB gene from Lactobacillus reuteri ATCC strain 53608 in NCBI, the cloning plasmid pUC-LR-gyrB was synthesized. The concentration of pUC-LR-gyrB plasmid was determined using a nucleic acid protein analyzer. Based on the actual concentration measured, pUC-LR-gyrB was serially diluted with TE buffer to approximately 10. 9 Gradient concentrations of up to 100 copies / ml.
[0066] Internal standard plasmid: A cloned plasmid pUC-IPC containing a random internal standard sequence was synthesized. The concentration of pUC-IPC plasmid was determined using a nucleic acid protein analyzer. Based on the actual concentration measured, pUC-IPC was diluted to approximately 10⁻⁶ with TE buffer. 6 copies / ml.
[0067] Specificity test plasmids: Lactobacillus rhamnosus gyrB clone plasmid pUC-LRh-gyrB; Lactobacillus johsonii gyrB clone plasmid pUC-LJ-gyrB; Lactobacillus gasseri gyrB clone plasmid pUC-LG-gyrB; Lactobacillus plantarum gyrB clone plasmid pUC-LP-gyrB; Lactobacillus vaginalis gyrB clone plasmid pUC-LV-gyrB; Lactobacillus jensenii gyrB clone plasmid pUC-LJe-gyrB; Prevotella rumenicola gyrB clone plasmid pUC-PR-gyrB.
[0068] 1.3 Primer and probe system testing
[0069] Bioinformatics analysis was used to compare the gyrB gene sequences of 43 Lactobacillus reuteri strains registered in NCBI. Sequences from conserved intraspecific and species-specific regions were selected, and multiple sets of specific primers and probes were designed using OLIGO 7 software. Multiple sets of internal control primers and probes were also designed based on random internal control sequences. Specific sequence information is shown in Table 1. The amplification performance of each gyrB primer and probe set for the target gene was tested using dye-based and probe-based fluorescent PCR experiments, and the optimal matching internal control system was screened.
[0070] Table 1 provides primer and probe sequence information for testing.
[0071]
[0072]
[0073] 1.4 Linear Amplification Assay
[0074] Prepare the reaction system by adding 1.37 × 10⁻⁶ ppm. 7 copies / ml ~ 1.37 × 10 2 pUC-LR-gyrB positive plasmid at a concentration of copies / ml (1:10 dilution) was amplified. After amplification, the linear amplification range was determined based on the amplification standard curve.
[0075] 1.5 Analytical Sensitivity Test
[0076] Prepare the reaction system by adding 2.74 × 10⁻⁶ ppm. 3 copies / ml, 1.37×10 3 Positive plasmids at concentrations of 685 copies / ml and 685 copies / ml were amplified, with each concentration repeated 21 times. The limit of detection (LOD) (analytical sensitivity) was determined based on the detection rate (≥95%). The positive / negative determination interval (gray zone) was calculated based on the Ct value detected by the LOD.
[0077] 1.6 Precision Test
[0078] Prepare the reaction system by adding 1.37 × 10⁻⁶ ppm. 7 1.37×10 5 1.37×10 3 Positive plasmids at a concentration of copies / ml were amplified, with each concentration repeated 10 times. The coefficient of variation (CV) was calculated based on the detection Ct value.
[0079] 1.7 Specificity Test
[0080] Prepare the reaction system, add 7 portions of specific test plasmid (diluted to a suitable concentration with TE) for amplification, and set up a positive control (pUC-LR-gyrB) and a negative control (TE solution). Analyze the specificity of this method based on the detection results.
[0081] 2 Results and Analysis
[0082] 2.1 Primer and probe system screening
[0083] 2.1.1 Selection of gyrB amplification primers
[0084] The amplification efficiency of the three primer sets was tested using a dye method. Based on the detection Ct values of different template concentrations and the amplification curve morphology, the results showed that all three primer sets had good amplification efficiency. Figure 1-3 )
[0085] Amplification system: 25 μL 2×PCR Buffer, 0.5 μL each of F / R primers (40 μM), 0.5 μL HotStart Taq enzyme (5 U / μL), 1 μL Evegreen dye, 5 μL template, and ddH2O to a final volume of 25 μL. The fluorescent PCR amplification program is as follows: 95℃ for 2 minutes, 1 cycle; 95℃ for 15 seconds, 60℃ for 30 seconds (fluorescence reading), 50 cycles. Unique identifier 10 -7 10 -8 The representative template concentration is 1.37 × 10⁻⁶. 5 copies / ml, 1.37×10 4 copies / ml.
[0086] 2.1.2 gyrB probe screening
[0087] Based on the primer screening results, specific probes for each group were added, and probe matching was evaluated using probe-based fluorescent PCR. According to the detection Ct value of low-concentration template and the amplification curve morphology, the third group of primers and probes (3-LR-F-991, 3-LR-R-1128, 3-LR-P-U1049) was selected as the optimal primer and probe combination. Figure 4-6 ).
[0088] Amplification system: 25 μL 2×PCR Buffer, 0.5 μL each of F / R primers (40 μM), 0.25 μL Probe (20 μM), 0.5 μL HotStart Taq enzyme (5 U / μL), 5 μL template, and ddH2O to a final volume of 25 μL. The fluorescent PCR amplification program was as follows: 95℃ for 2 minutes, 1 cycle; 95℃ for 15 seconds, 60℃ for 30 seconds (fluorescence reading), 50 cycles. Template concentration was 1.37 × 10⁻⁶. 3 copies / ml. The unique identifier E indicates dye-based amplification results, and P indicates probe-based amplification results.
[0089] 2.1.3 Screening of Internal Standard System
[0090] Based on the primer and probe screening results, different internal standard systems (IPC01, IPC03, IPC05) were added to test the amplification performance differences between each group and the group without internal standard. The results showed that the IPC01 and IPC03 internal standard systems had little impact on the amplification of the main channel and their own curve shapes were stable. Therefore, these two were preferred as the matching internal standard monitoring systems. Figure 7-10 )
[0091] Amplification system: 25 μL 2×PCR Buffer, 0.5 μL each of 3-F / 3-R primers (40 μM), 0.25 μL 3-P (20 μM), IPC01 / IPPC03 / IPPC05 internal standard system, 0.5 μL HotStart Taq enzyme (5 U / μL), 5 μL template, and ddH2O to a final volume of 25 μL. The fluorescent PCR amplification program was as follows: 95℃ for 2 minutes, 1 cycle; 95℃ for 15 seconds, 60℃ for 30 seconds (fluorescence reading), 50 cycles. Template concentration was 1.37 × 10⁻⁶. 6 copies / ml ~ 1.37 × 10 3 copies / ml.
[0092] 2.2 Linear Amplification Range
[0093] like Figure 11 As shown, this method is effective for 1.37 × 10⁻⁶. 7 ~1.37×10 2 Gradient template amplification at copies / ml was normal. Among them, 1.37×10 7 ~1.37×10 3 A linear correlation was observed within the range of copies / ml, with a correlation coefficient R. 2 =0.99, within this linear amplification range, the amplification efficiency is above 94%. Based on the above results, the quantitative range of this method can be determined to be 1.37 × 10⁻⁹. 7 ~1.37×10 4 copies / ml.
[0094] 2.3 Analytical Sensitivity
[0095] The precision test results show (Table 2), 2.74 × 10 3 The detection rate of 13.7 copies / ml template (13.7 copies / reaction) was 100%, 1.37×10 3 The detection rate of template copies / ml (6.85 copies / reaction) was 100%, 6.85 × 10⁻⁶. 2 The detection rate of template copies / ml (3.43 copies / reaction) was 81.0%. (1.37 × 10⁻⁶) 3 The limit of detection (LOD) is 1.37 × 10⁻⁶ copies / ml. 3 The Ct value calculated for repeated testing of copies / ml template corresponds to a gray area Ct value range of 33.74 (taken as 33) to 39.61 (taken as 40). That is, Ct value ≤ 33 is considered positive, 33 < Ct value < 40 is considered suspicious, and Ct value ≥ 40 or no Ct value is considered negative. The result can be confirmed by repeated testing of the sample.
[0096] Table 2. Results of sensitivity determination.
[0097]
[0098]
[0099] 2.4 Precision
[0100] The results of the precision test (Table 3) using high, medium, and low concentration templates showed that the detection precision (CV value) of this method was 1.56–3.24%, indicating good detection repeatability.
[0101] Table 3 Precision Test Results
[0102]
[0103] 2.5 Specificity
[0104] The results of the specificity test (Table 4) showed that Lactobacillus reuteri-gyrB was not detected in any of the 7 specific plasmid samples under the premise of detection of internal standard, indicating that this method does not have cross-reaction with the above 7 intestinal flora.
[0105] Table 4 Results of Specificity Tests
[0106]
[0107] Those skilled in the art should understand that the discussion of any of the above embodiments is merely exemplary and is not intended to imply that the scope of protection of this application is limited to these examples; within the framework of this application, the technical features of the above embodiments or different embodiments can also be combined, the steps can be implemented in any order, and there are many other variations of different aspects of one or more embodiments of this application as described above, which are not provided in detail for the sake of brevity.
[0108] One or more embodiments in this application are intended to cover all such substitutions, modifications, and variations that fall within the broad scope of this application. Therefore, any omissions, modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of one or more embodiments in this application should be included within the protection scope of this application.
Claims
1. A kit for detecting Lactobacillus reuteri, characterized in that, The reagent includes fluorescent reaction solution A, fluorescent reaction solution B, internal standard, negative control, nucleic acid release agent, and quantitative reference. Fluorescent reaction solution B contains primers for detecting Lactobacillus reuteri. The primers for detecting Lactobacillus reuteri include an upstream primer and a downstream primer. The sequence of the upstream primer is 5'-AAGCACCCTGATCCGCAAT-3', and the sequence of the downstream primer is 5'-AATTTGCCGCGCTTCGTCT-3'. The fluorescent reaction solution B also contains primers and probes with the sequence 5'-CACGAACAGCGACTGACCATGTCT-3', wherein the 5' end is labeled with a reporter fluorescent group and the 3' end is labeled with a quencher fluorescent group. The fluorescent reaction solution B also contains internal standard primers and internal standard probes. The internal standard primers include an internal standard upstream primer and an internal standard downstream primer. The sequence of the internal standard upstream primer is 5'-CGCTTGGATAACGACCTA-3', the sequence of the internal standard downstream primer is 5'-CAGCACCACATACTTTCAG-3', and the sequence of the internal standard probe is 5'-TCCTCTAAGCCACTGTCCACACC-3'. The 5' end is labeled with a reporter fluorescent group, and the 3' end is labeled with a quencher fluorescent group. The reporting fluorescent group is Fam or Hex, and the quenching fluorescent group is BHQ1.
2. The kit according to claim 1, characterized in that, The fluorescent reaction solution A includes PCR-Buffer, dNTPs, hot-start Taq enzyme, and UNG enzyme. The concentration of Tris-HCl in the PCR-Buffer is 125–200 mM. The dNTPs include four deoxyribonucleosides: dATP, dUTP, dGTP, and dCTP. The final concentration of the hot-start Taq enzyme in the fluorescent reaction solution A is 0.2–0.3 U / μL.
3. The kit according to claim 1, characterized in that the fluorescence... In reaction solution B, the concentrations of the upstream and downstream primers are 500–750 nM, and the concentrations of the primers and probes are 250–500 nM; the concentrations of the internal standard primers and internal standard probes are 250–500 nM, respectively.
4. The kit according to claim 1, characterized in that, The internal standard contains the recombinant plasmid pUC-IPC, the negative control is TE buffer solution, and the nucleic acid release agent includes 25-100 mM NaOH, 1-5% PEG6000, and 0.5-1 mM EDTA.