Nucleic acid molecules, kits and methods for detecting monkeypox virus
Through the fluorescence quantitative PCR method, the monkeypox virus was detected using specially designed primers and probes, which solved the problem of time-consuming and high false positive rates in the prior art, and achieved rapid and sensitive quantitative detection of monkeypox virus, reducing detection costs and increasing the detection lower limit.
Patent Information
- Application Number
- CN202310114135.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-02-14
- Publication Date
- 2025-08-29
- Estimated Expiration
- 2043-02-14
AI Technical Summary
The methods for detecting monkeypox virus in the prior art have problems such as time-consuming, high false positive rate, high operational requirements and difficulty in quantitative analysis, especially in the detection of monkeypox virus in Vero cell seed bank.
The fluorescence quantitative PCR method was used to amplify and detect the OPG118 gene region targeting monkeypox virus using specially designed primers and probes. Combined with fluorescence quantitative PCR technology with reporter fluorophores and quenched fluorophores, high specificity and high sensitivity quantitative detection of monkeypox virus were achieved.
Fast, sensitive and specific monkeypox virus detection is achieved, and the quality monitoring of samples can be completed in a short time, reducing detection costs, and increasing the detection lower limit to 10 copies/reactions, reducing false positive results.
Smart Images

Figure CN116287451B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of sequencing, and in particular to a nucleic acid molecule, a kit and a method for detecting monkeypox virus. Background Art
[0002] Oncolytic virus products are biological products. In the process of producing oncolytic virus products, oncolytic virus products need to be amplified in African green monkey kidney cells (Vero cells). In the process of purchasing cells or cell passaging, monkeypox virus may contaminate the cells and continuously replicate in subsequent production, posing a potential infection risk to human biological products. Therefore, it is very necessary to use appropriate methods to detect monkeypox virus for Vero cell seed banks and subsequent products.
[0003] The methods for detecting viruses in the prior art include cell culture method, conventional polymerase chain reaction (PCR) method and dye-based quantitative PCR method. Among them, the cell culture method requires the sample to be tested to be incubated with cells for a period of time, and then the results are determined by immunostaining. This method is time-consuming. At the same time, the monkeypox virus in the positive control group belongs to the virus with a biosafety risk level of 3, which is difficult to import and needs to be operated in a biosafety laboratory corresponding to the P3 level, and has high requirements for experimental conditions. The conventional PCR method uses a pair of primers to perform PCR on the sample to be tested, and then the PCR product is analyzed and determined by agarose gel electrophoresis. This method is a qualitative experiment and is not suitable for quantitative analysis. The dye-based quantitative PCR method uses a pair of primers and a fluorescent dye. Since the fluorescent dye binds to the PCR product non-specifically, non-specific signals will appear in some special samples or in the late stage of PCR amplification under accidental circumstances, resulting in false positives.
[0004] In view of this, the present invention provides novel nucleic acid molecules, kits, methods and systems for detecting monkeypox virus, which can conveniently and quantitatively detect trace amounts of monkeypox virus with high specificity and high sensitivity. SUMMARY OF THE INVENTION
[0005] The present disclosure provides a fluorescent quantitative PCR method that can quickly, sensitively and specifically detect whether a sample (such as an African green monkey kidney cell (Vero cell) seed bank and an HSV-1 oncolytic virus seed bank) contains monkeypox virus.
[0006] In one aspect, the present disclosure provides a nucleic acid molecule for detecting monkeypox virus, comprising: a primer pair for amplifying a nucleic acid fragment within the nucleotide sequence of the monkeypox virus, wherein the nucleotide sequence of the monkeypox virus is selected from the OPG118 gene region and its adjacent regions, and optionally a probe for hybridizing with the positive strand or antisense strand of the nucleic acid fragment amplified by the primer pair.
[0007] In some embodiments, primers are designed for the OPG118 gene, a fragment thereof, or a spanning region thereof with an adjacent region. In some specific embodiments, the primers amplify a fragment of the OPG118 gene as shown in SEQ ID NO: 10 (SEQ ID NO: 10: ACCAACTATATTACCTCATCAGTTAGCTACTTTAGATTATCTAGTTAGAACTATCATAGATGAGAACAGAAGCGTGTTATTGTTCCATATTATGGGATCGGGTAAAACAATAATCGCTTTGTTGTTCGCCTTG).
[0008] In some embodiments, the primer pair is a forward primer having a nucleotide sequence set forth as nnCAACTATATTACCTCATCAGTTAGCTACT (SEQ ID NO: 5) and a reverse primer having a nucleotide sequence set forth as nnAGGCGAACAACAAAGCGA (SEQ ID NO: 6), wherein n is A, T, C, G, or none. In some embodiments, the primer pair is a forward primer having a nucleotide sequence set forth as ACCAACTATATTACCTCATCAGTTAGCTACT (SEQ ID NO: 2) and a reverse primer having a nucleotide sequence set forth as CAAGGCGAACAACAAAGCGA (SEQ ID NO: 3).
[0009] In some embodiments, the probe has a nucleotide sequence of nnTAGATGAGAACAGAAGCGTGTTATTGTTCnn (SEQ ID NO: 7), where n is A, T, C, G, or none. Preferably, the first nucleotide at the 5' end of the probe is not G. In some embodiments, the probe has a nucleotide sequence of CATAGATGAGAACAGAAGCGTGTTATTGTTCCA (SEQ ID NO: 4).
[0010] In some embodiments, the probe is linked to a reporter fluorescent moiety at the 5' end and a quencher fluorescent moiety at the 3' end, or vice versa.
[0011] In some embodiments, the reporter fluorescent group is selected from FAM, FITC, VIC, TET, JOE, ROX, Cy5, Cy3, 5-TAMRA and HEX. In some embodiments, the quencher fluorescent group is selected from MGB, Dabcyl, Eclipse, BHQ0, BHQ1, BHQ2 and BHQ3.
[0012] In some embodiments, the probe is linked to a reporter fluorescent group FAM at the 5' end and a quencher fluorescent group MGB at the 3' end.
[0013] In one aspect, the present disclosure provides a kit for detecting monkeypox virus, comprising a nucleic acid molecule for detecting monkeypox virus. Optionally, the kit further comprises other reagents, such as reagents for PCR amplification, reagents for nucleic acid extraction, etc.
[0014] In one aspect, the present disclosure provides a method for detecting monkeypox virus, which is implemented using a nucleic acid molecule for detecting monkeypox virus. The method may not be used for detection purposes, but for quality control of detection samples. In some embodiments, the method is used to detect the presence of monkeypox virus in a seed bank, culture or extract of Vero cells. In some embodiments, the method is used to detect the presence of monkeypox virus in a seed bank, culture or extract of an oncolytic virus.
[0015] In some embodiments, the detection of monkeypox virus is performed by polymerase chain reaction (PCR). In some embodiments, the PCR is fluorescent quantitative PCR.
[0016] In one aspect, the present disclosure provides use of a nucleic acid molecule for detecting monkeypox virus in the manufacture of a preparation (eg, a kit) for detecting monkeypox virus. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] The following figures are included to further illustrate certain aspects and features of the invention. The invention may be better understood by reference to one or more of these figures in combination with the detailed description of specific embodiments (including examples).
[0018] Figure 1 This is the overall experimental flow chart.
[0019] Figure 2 The standard curve drawn when fluorescent qPCR was performed using primers / probe (MPXV F3 / R5 / P3) and MPXV-1000 plasmid as a PCR amplification template was basically consistent with the standard curve drawn when fluorescent qPCR was performed using MPXV-1000 plasmid as a PCR amplification template and additional Vero cell genomic DNA.
[0020] Figure 3 The standard curve drawn when fluorescent qPCR was performed using primers / probe (MPXV F3 / R5 / P3) and MPXV-1000 plasmid as a PCR amplification template was basically consistent with the standard curve drawn when fluorescent qPCR was performed using MPXV-1000 plasmid as a PCR amplification template and additional VG301 genomic DNA.
[0021] Figure 4 The figure shows the results of agarose gel electrophoresis verification of the amplified products obtained when PCR was performed using primers / probe (MPXV F3 / R5 / P3) and MPXV-1000 plasmid as a PCR amplification template with and without the addition of additional Vero cell genomic DNA.
[0022] Figure 5 The figure shows the results of agarose gel electrophoresis verification of the amplified products obtained when PCR was performed using primers / probe (MPXV F3 / R5 / P3) and MPXV-1000 plasmid as a PCR amplification template with and without the addition of additional VG301 genomic DNA.
[0023] Figure 6 This is the MPXV-1000 plasmid map and the location of the primer probe, where the gray part on the right represents the monkeypox virus fragment. DETAILED DESCRIPTION
[0024] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as those generally understood by those of ordinary skill in the art to which the invention belongs. In addition, unless the context otherwise requires, terms in the singular should include plural forms, and terms in the plural should include singular forms. More specifically, as used in this specification and the appended claims, unless the context otherwise clearly indicates, the singular forms "one", "an" and "the / said" include plural referents. Unless otherwise stated, the use of "or" means "and / or". In addition, the use of the term "comprising" and other forms (such as "including" and "containing") is not restrictive.
[0025] The term "oncolytic virus" refers to a large class of viruses that can selectively lyse cancer cells. Currently, there are many oncolytic viruses that have been approved for marketing or are in clinical trials, including Imlygic (herpes simplex virus), Delytact (herpes simplex virus), H101\H102\H103 (adenovirus), Pelareorep (reovirus), BS001 (herpes simplex virus type II), VG200s series, VG301 (herpes simplex virus type I), VG161 (herpes simplex virus type I), etc. VG301 is the world's first HSV-1 (herpes simplex virus type I) oncolytic virus carrying a bispecific antibody. VG161 is a new type of anti-tumor immune-enhancing herpes simplex oncolytic virus type I, which also carries the genes of IL12, IL15 / 15RA (IL15 and IL15 receptor α subunit) and PD-L1 blocking peptide (PDL1B)
[0026] Primers and probes targeting monkeypox virus (MPXV) genomic sequences
[0027] Monkeypox virus (MPV) belongs to the genus Orthopoxvirus in the family Poxviridae. Its genome is approximately 197 kb long and consists of a double-stranded DNA sequence containing an identical but oppositely oriented inverted terminal repeat (INR) at each end. The virus contains 190 open reading frames (ORFs), four of which are located within the INR. The complete genomic sequence of MPV can be found in NCBI entry number NC_063383 and GenBank entry number MT903340.
[0028] Various primers and probe sequences can be designed for different segments of the monkeypox virus genome. In one embodiment, the OPG118 gene of the monkeypox virus can be selected as a nucleotide sequence representing the monkeypox virus to design primers and probe sequences.
[0029] Primers and probes for detecting monkeypox virus can be designed based on the nucleotide sequences representing monkeypox virus selected above. In one embodiment, primers and probes can be designed using the Primer-Blast program of NCBI (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / index.cgi?LINK_LOC=BlastHome).
[0030] Primers and probes can be fully matched to the target sequence to be detected. However, based on the working principles of primers and probes, as long as the specificity, sensitivity, and recovery rate of the detection are not compromised, primers and probes can also have single or consecutive nucleotide mismatches with the target sequence to be detected. In specific embodiments, primers (whether forward or reverse) can contain 1-2 mismatches at the 5' end, and probes can contain 1-2 mismatches at the 5' and / or 3' ends.
[0031] In a more specific embodiment, the primer pair can be: a forward primer having a nucleotide sequence set forth as nnCAACTATATTACCTCATCAGTTAGCTACT (SEQ ID NO: 5) and a reverse primer having a nucleotide sequence set forth as nnAGGCGAACAACAAAGCGA (SEQ ID NO: 6), wherein n is A, T, C, G, or none. In a further embodiment, the primer pair can be: a forward primer having a nucleotide sequence consisting of nnCAACTATATTACCTCATCAGTTAGCTACT (SEQ ID NO: 5) and a reverse primer having a nucleotide sequence consisting of nnAGGCGAACAACAAAGCGA (SEQ ID NO: 6), wherein n is a, t, c, g, or none. In a further embodiment, the primer pair can be: a forward primer having a nucleotide sequence set forth as ACCAACTATATTACCTCATCAGTTAGCTACT (SEQ ID NO: 2) and a reverse primer having a nucleotide sequence set forth as CAAGGCGAACAACAAAGCGA (SEQ ID NO: 3). In a further embodiment, the primer pair can be: a forward primer consisting of a nucleotide sequence consisting of ACCAACTATATTACCTCATCAGTTAGCTACT (SEQ ID NO: 2) and a reverse primer consisting of a nucleotide sequence consisting of CAAGGCGAACAACAAAGCGA (SEQ ID NO: 3).
[0032] In some embodiments, the probe may have a nucleotide sequence as shown in nnTAGATGAGAACAGAAGCGTGTTATTGTTCnn (SEQ ID NO: 7), wherein n is A, T, C, G, or none. In a further embodiment, the probe may have a nucleotide sequence consisting of nnTAGATGAGAACAGAAGCGTGTTATTGTTCnn (SEQ ID NO: 7), wherein n is A, T, C, G, or none. In a further embodiment, the probe may have a nucleotide sequence consisting of nnTAGATGAGAACAGAAGCGTGTTATTGTTCCA (SEQ ID NO: 8), wherein n is A, T, C, G, or none. In a further embodiment, the probe may have a nucleotide sequence consisting of CATAGATGAGAACAGAAGCGTGTTATTGTTCnn (SEQ ID NO: 9), wherein n is A, T, C, G, or none. In a further embodiment, the probe may have a nucleotide sequence as shown in CATAGATGAGAACAGAAGCGTGTTATTGTTCCA (SEQ ID NO: 4). In a further embodiment, the probe may be a nucleotide sequence consisting of CATAGATGAGAACAGAAGCGTGTTATTGTTCCA (SEQ ID NO: 4).
[0033] In a further embodiment, the probe may be linked to a reporter fluorescent group at the 5' end and a quencher fluorescent group at the 3' end; or linked to a quencher fluorescent group at the 5' end and a reporter fluorescent group at the 3' end. In a further embodiment, the reporter fluorescent group is selected from the group consisting of Alexa Fluor 350, Alexa Fluor 405, Pacific Blue, DAPI, AMCA, Cascade Blue, EviTag™ Quantum Dots-Lake Placid Blue, Fluoroblue, Image-Blue, Marina Blue, Cy2, Alexa Fluor 430, Alexa Fluor 488, Alexa Fluor 488 Fluorescent Nanogold, Alexa Fluor 500, Alexa Fluor 514, fluorescein isothiocyanate (FITC), fluorescein, HNP, 5-FAM, 6-FAM, BODIPY FL, CMNB-caged fluorescein, Cyanine 2, DTAF, DTAF / FITC, dUTP-biotin and avidin FITC, dUTP-FITC, EviTag™ Quantum Dots-Adirondack Green, EviTag™ Quantum Dots-Catskill Green, fluorescein-5-EX succinimidyl ester, Hi FITC, JOE, MFP488, Oregon Green 488, Oregon Green 514, Qdot 525, TET, CAL Gold 540, NL493, GFP, Cy3, Cy3B, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 555, R-phycoerythrin, B-phycoerythrin, HNP / Fast Red TR, 5-TAMRA, Atto 550, CAL Orange 560, Cyanine 3, DyLight 547, EviTagTM Quantum Dots-Birch Yellow, EviTagTM Quantum Dots-Hops Yellow, HEX (hexachloro-6-methylfluorescein), NED, Qdot 565, 570, TRITC, VIC, NL557, Cy3.5, Alexa Fluor 568, ROX, DyeMer 488 / 605, DyeMer488 / 615, CAL Red 590, CAL Red 610, Cyanine 3.5, DyeMer 488 / 605, DyeMer488 / 615, EviTag™ Quantum Dots-Fort Orange, Lissamine Rhodamine, MFP555, Qdot 585, Qdot 605, ROX, R-phycoerythrin-Texas Red, Rhodamine Red-X, TMR Red, Cy5, Cy5.5, CypHer5E, Alexa Fluor 594, Alexa Fluor 594 Fluorescent Nanogold, Alexa Fluor 610, Alexa Fluor 610–R-PE, Alexa Fluor 633, Alexa Fluor 635, Alexa Fluor 647, Alexa Fluor 647–R-phycoerythrin, Alexa Fluor 660, Texas Red, DyeMer 488 / 630, Allophycocyanin, PI, Allophycocyanin-cyanin 5, Allophycocyanin-cyanin 5.5, Atto647, CAL Red 635, Cyanine 5, DyLight 647, DyeMer 488 / 630, Dyomics 647, Lightcycler Red-640, PBXL-1, PBXL-3, Perichlorophyll-Chlorophyll (PerCP), PerCP-Cy5.5, Qdot655, Quantum Red, In a further embodiment, the quenching fluorescent group is selected from the group consisting of Dabcyl, MGB, Eclipse, BHQ0, BHQ1, BHQ2 and BHQ3, but is not limited thereto.
[0034] In some embodiments, the modification of the 5' reporter fluorescent group is selected from Acrydite, Aldehyde, Alexafluor 350, Alexa fluor 405, Alexa fluor 430, Alexa fluor 488, Alexa fluor 514, Alexa fluor 532, Alexa fluor 546, Alexa fluor 555, Alexa fluor 568, Alexa fluor 594, Alexa fluor 647, Alexa fluor 660, Alexa fluor 680, Alexa fluor 700, Alexafluor 750, amino C6, amino linker C12, AMCA, BHQ1, BHQ2, biotin, 493 / 503, BODIPY 530 / 550, BODIPY 550 / 560, BODIPY 558 / 569, BODIPY 564 / 570, BODIPY 576 / 589, BODIPY 581 / 591, BODIPY 630 / 650, CY-3, CY-5, DABCYL, Digoxigenin, FAM, FITC, HEX, JOE, Phosphate, Rhodamine Green-X / Rhodamine Green TM Rhodamine -X, ROX, Spacer 18, TAMRA, TET, Texas Red-X, Thiol-C6 SS.
[0035] In some embodiments, the modification of the 3' quencher fluorescent group is selected from Alexa Fluor 488*, Alexa Fluor 532*, Alexa Fluor 546*, Alexa Fluor 555*, Alexa Fluor 594*, Alexa Fluor 647*, Alexa Fluor 660*, Alexa Fluor 750*, AMCA, amino linker BHQ1, BHQ2, biotin, CY-3, CY-5, DABCYL, digoxin, 530 / 550*, 493 / 503*, 558 / 569*, 564 / 570*, 576 / 589*, 581 / 591*, 630 / 650-X*, Eclipse, FAM, FITC, HEX, JOE, Phosphate, ROX, Rhodamine Green, Rhodamine Red, TAMRA, TET, Texas Red-X, Thiol-C6 SS.
[0036] Detection methods and test objects of monkeypox virus
[0037] The probes and primers of the present invention described above can be used to implement the detection of monkeypox virus. In a specific embodiment, detection can be performed by polymerase chain reaction (PCR). More specifically, the probes and primers of the present invention described above can be used for detection by fluorescent quantitative PCR (qPCR). In some embodiments, DNA extracted from the sample to be tested is added as a template, fluorescent qPCR is performed, and the presence of monkeypox virus in the sample is detected by detecting the amplification signal. In some embodiments, the sample is a seed bank, culture or extract of Vero cells. For example, African green monkey kidney cells can be lysed, total DNA can be extracted as a template, and fluorescent qPCR is performed using the primers / probes (MPXVF3 / R5 / P3) of the present invention to detect the presence of monkeypox virus in African green monkey kidney cells by detecting the amplification signal. In other embodiments, the sample is a seed bank, culture or extract of an oncolytic virus. For example, total DNA of an oncolytic virus seed bank can be extracted as a template, and fluorescent qPCR is performed using the primers / probes (MPXV F3 / R5 / P3) of the present invention to detect the presence of monkeypox virus in the oncolytic virus by detecting the amplification signal.
[0038] The sample can be any sample containing / mixed with or suspected of containing / mixed with monkeypox virus, including cell samples, virus samples, body fluid samples, tissue samples, or mixed samples thereof, etc. In some embodiments, the sample is a cell sample, body fluid sample, tissue sample, or biopsy sample from a human.
[0039] In a specific embodiment, the cell sample can be a mammalian cell sample. In a more specific embodiment, the mammalian cell can be any common mammalian cell in the art, such as Vero cells, CHO cells, HEK293 cells, etc. In a more specific embodiment, the cell sample can be a cell bank (Master Cell Bank, MCB).
[0040] In a specific embodiment, the virus sample may be derived from any common virus in the art such as herpes simplex virus (HSV), hepatitis virus, enterovirus, coxsackie virus, influenza virus, avian influenza virus, measles virus, varicella-zoster virus, hantavirus, Japanese encephalitis virus, dengue virus, Epstein-Barr virus, cytomegalovirus, rabies virus, human immunodeficiency virus, new coronavirus. For example, the virus sample may be derived from a variety of oncolytic viruses, and is not limited to one or more oncolytic viruses. It will be understood by those skilled in the art that the nucleic acid or method of the present invention can be used to detect a wide range of oncolytic virus products or samples for humans. In a more specific embodiment, the HSV may be a recombinant oncolytic HSV-1 virus. In a more specific embodiment, the recombinant oncolytic HSV-1 virus may be a VG301 virus. In a more specific embodiment, the virus sample may be a virus library (Master Virus Bank, MVB).
[0041] Beneficial effects of the present invention
[0042] 1. Short time. From DNA extraction of the test sample to qPCR result analysis, it usually takes one day to complete.
[0043] 2. Experimental reagents are easily available and testing costs are low. DNA extraction kits, primer probes, and supporting PCR detection reagents are increasingly domestically produced, making them easy to purchase and costing around 30-40 yuan per sample.
[0044] 3. High specificity. Fluorescent probe quantitative PCR requires two primers and one probe to simultaneously bind to the target sequence in order for the signal to be gradually amplified and detected by the quantitative PCR instrument. Fluorescent dye quantitative PCR, on the other hand, uses only two primers, and the dye binds non-specifically to the amplified DNA fragments. The Vero seed bank samples contain a large number of Vero cell genomes, and non-specific amplified fragments are present in the late stages of the PCR reaction. In this case, the signal captured by fluorescent dye PCR has a certain probability of being a false positive.
[0045] 4. Combined with the MPXV-1000 plasmid, monkeypox virus can be quantified with high sensitivity. The design and synthesis of a plasmid containing the monkeypox virus genome avoids the difficulty of procuring the pathogen and facilitates subsequent plasmid amplification and storage. By calculating the plasmid copy number and performing simultaneous PCR with the test sample, a standard curve can be used for virus quantitative analysis. This method has a dynamic detection range of 1 billion to 100 million copies / reaction, with a detection limit of 10 copies / reaction, compared to approximately 50 copies / reaction for current methods in the field.
[0046] Example
[0047] Example 1: Construction of plasmids and design of primers and probes based on representative nucleotide sequences of monkeypox virus
[0048] A partial nucleotide sequence containing the monkeypox virus genome was inserted into a vector to construct an MPXV-1000 plasmid, the sequence of which is shown in SEQ ID NO: 1.
[0049] A series of primers (forward primers and reverse primers) and probes were designed using the NCBI Primer-Blast program (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / index.cgi?LINK_LOC=BlastHome), and these primers and probes were synthesized by Genewiz.
[0050] Example 2: DNA extraction from Vero cells and VG301 virus
[0051] Vero cells (Vero cells) obtained from the African Green Monkey Kidney Cell Bank (MCB, Lot #C057-M-210919) were used as mammalian cells for virus propagation. Vero cells were cultured in T182 flasks and trypsinized. Genomic DNA was extracted from 3 million cells using the DNeasy blood and tissue plus kit (Qiagen: 69506) and dissolved in 50 μL of ddH₂O. The concentration of the resulting DNA solution was measured using a Thermo Nanodrop One and adjusted to 200 ng / μL with ddH₂O.
[0052] VG301 virus was obtained from the VG301 virus library (MVB, Lot#C057-MVB-20210909). 200 μL of VG301 virus seed liquid was taken, and its genomic DNA was extracted using a DNeasy blood and tissue plus kit (Qiagen: 69506) and dissolved in 50 μL ddH2O.
[0053] Example 3: Fluorescence quantitative PCR (qPCR) and selection of excellent primers / probes
[0054] Prepare a serial dilution of the plasmid MPXV-1000 for the standard curve. Prepare a premix by combining the following components:
[0055] Table 1: Composition of fluorescent qPCR master mix
[0056]
[0057] The premix prepared as above was dispensed into a 96-well plate, sealed with a sealing film, and placed in a fluorescent quantitative PCR instrument. The FAM channel was selected to collect signals. The reaction program was as follows: 50°C for 2 minutes, 1 cycle; 95°C for 10 minutes, 1 cycle; 95°C for 15 seconds, 60°C for 1 minute, 45 cycles.
[0058] Determination of the addition of 1 × 10 8 ~1×10 1 The number of PCR cycles required for the fluorescence of each well containing the MPXV-1000 plasmid as a PCR amplification template to reach a preset threshold of 0.2 is referred to as the cycle threshold (Ct value). A standard curve is plotted with the initial MPXV-1000 plasmid copy number on the horizontal axis and the Ct value on the vertical axis. Repeat the above fluorescence qPCR process for four batches.
[0059] Based on the standard curve drawn above, we noticed a set of primers / probes that resulted in the lowest Ct value (highest qPCR priming efficiency) and named them MPXV F3 / R5 / P3. Their sequences are shown in the following table:
[0060] Table 2: Primer / probe sequences and corresponding positions
[0061]
[0062]
[0063] Example 4: Further analysis
[0064] The results obtained by fluorescent qPCR using primers / probe (MPXV F3 / R5 / P3) were further analyzed.
[0065] 4.1. Specificity, Sensitivity, and Recovery in the Presence of Vero Cell Genomic DNA
[0066] like Figure 2 As shown, after adding 1×10 8 ~1×10 1 The standard curve drawn when the MPXV-1000 plasmid with 1×10 8 ~1×10 1 The standard curves drawn when the copied MPXV-1000 plasmid was used as a PCR amplification template and an additional 500 ng of Vero cell genomic DNA was used for fluorescent qPCR were basically parallel. The PCR priming efficiency of the former was 92.292%, R2 (i.e., the correlation coefficient when fitting the curve) = 0.997, and the PCR priming efficiency of the latter was 92.849%, R2 = 0.998.
[0067] Agarose gel electrophoresis confirmed that the target fragment of 133 bp was obtained when the primer / probe (MPXV F3 / R5 / P3) was used, and there was no extraneous band. Figure 4 shown.
[0068] Lane M: DNA ladder (100 bp to 15 kb);
[0069] Lane 1: Add 1×10 8 The copied MPXV-1000 plasmid is the electrophoresis band of the fluorescent qPCR amplification product;
[0070] Lane 2: Add 1×10 7 The copied MPXV-1000 plasmid is the electrophoresis band of the fluorescent qPCR amplification product;
[0071] Lane 3: Add 1×10 6 The copied MPXV-1000 plasmid is the electrophoresis band of the fluorescent qPCR amplification product;
[0072] Lane 4: Add 1×10 5 The copied MPXV-1000 plasmid is the electrophoresis band of the fluorescent qPCR amplification product;
[0073] Lane 5: Add 1×10 4 The copied MPXV-1000 plasmid is the electrophoresis band of the fluorescent qPCR amplification product;
[0074] Lane 6: Add 1×10 3 The copied MPXV-1000 plasmid is the electrophoresis band of the fluorescent qPCR amplification product;
[0075] Lane 7: Add 1×10 2 The copied MPXV-1000 plasmid is the electrophoresis band of the fluorescent qPCR amplification product;
[0076] Lane 8: Add 1×10 1 The copied MPXV-1000 plasmid is the electrophoresis band of the fluorescent qPCR amplification product;
[0077] Lane 9: negative control (ddH2O added);
[0078] Lane 10: Add 1×10 8 Electrophoresis bands of fluorescent qPCR amplification products when the MPXV-1000 plasmid was copied and 500 ng of Vero cell genomic DNA;
[0079] Lane 11: Add 1×10 7Electrophoresis bands of fluorescent qPCR amplification products when the MPXV-1000 plasmid was copied and 500 ng of Vero cell genomic DNA;
[0080] Lane 12: Add 1×10 6 Electrophoresis bands of fluorescent qPCR amplification products when the MPXV-1000 plasmid was copied and 500 ng of Vero cell genomic DNA;
[0081] Lane 13: Add 1×10 5 Electrophoresis bands of fluorescent qPCR amplification products when the MPXV-1000 plasmid was copied and 500 ng of Vero cell genomic DNA;
[0082] Lane 14: Add 1×10 4 Electrophoresis bands of fluorescent qPCR amplification products when the MPXV-1000 plasmid was copied and 500 ng of Vero cell genomic DNA;
[0083] Lane 15: Add 1×10 3 Electrophoresis bands of fluorescent qPCR amplification products when the MPXV-1000 plasmid was copied and 500 ng of Vero cell genomic DNA;
[0084] Lane 16: Add 1×10 2 Electrophoresis bands of fluorescent qPCR amplification products when the MPXV-1000 plasmid was copied and 500 ng of Vero cell genomic DNA;
[0085] Lanes 17-19: Add 1×10 1 Electrophoresis bands of fluorescent qPCR amplification products when the MPXV-1000 plasmid was copied and 500 ng of Vero cell genomic DNA (triplicate);
[0086] Lane 20: negative control (supplemented with 500 ng of Vero cell genomic DNA).
[0087] No nonspecific amplification bands were observed on the electrophoresis pattern.
[0088] These results demonstrate that the primers and probe are sufficiently specific to amplify the target sequence even in the presence of 500 ng of additional Vero cell genomic DNA (i.e., without interference from the additional 500 ng of Vero cell genomic DNA). Lanes 17-19 show that 10 copies of the MPXV-1000 plasmid can still be detected, demonstrating the high specificity and sensitivity of this method.
[0089] Table 3 below lists the mean (AVE) ± standard deviation (STD) of the Ct values and the intra- and inter-assay coefficients of variation (CV%) of four qPCR runs in the presence of 500 ng of Vero cell genomic DNA.
[0090] Table 3: AVE ± STD and intra- and inter-assay CV% of Ct values of four batches of qPCR in the presence of 500 ng of Vero cell genomic DNA
[0091]
[0092]
[0093] As shown in Table 3 above, whether the MPXV-1000 plasmid was used at 1×10 8 ~1×10 1 Even in the presence of 500 ng of Vero cell genomic DNA, the intra-assay CV% of the Ct values for four qPCR batches did not exceed 2.5, and the inter-assay CV% did not exceed 3.2. This demonstrates that this fluorescent qPCR system is stable and highly reproducible.
[0094] The recovery rate (%) of the target amplification product was determined as follows:
[0095] Recovery rate (%) of target amplification product = measured level of target amplification product / theoretical level × 100%.
[0096] Table 4 below lists the recovery rate (%) of target amplification products and the intra-assay CV% of Ct values of four batches of qPCR in the presence of 500 ng of Vero cell genomic DNA when 50 copies, 25 copies, 10 copies, 5 copies, and 1 copy of the MPXV-1000 plasmid were added as PCR amplification templates.
[0097] Table 4: Recovery (%) of target amplification products and intra-assay CV% of Ct values of four batches of qPCR in the presence of 500 ng Vero cell genomic DNA
[0098]
[0099] When the limit of quantification (LOQ) is defined as a recovery rate of the target amplification product between 50% and 150% and a CV% below 10%, as shown in Table 4 above, in the presence of 500 ng of Vero cell genomic DNA, the LOQ of this fluorescent qPCR system for MPXV-1000 plasmid using primers / probe (MPXV F3 / R5 / P3) is 10 copies / reaction.
[0100] Table 5 below lists the detection rates (%) of target amplification products by qPCR in the presence of 500 ng of Vero cell genomic DNA when 50, 25, 10, 5 and 1 copies of MPXV-1000 plasmid were added as PCR amplification templates.
[0101] Table 5: Detection rate (%) of target amplification products by qPCR in the presence of 500 ng of Vero cell genomic DNA
[0102]
[0103] When the limit of detection (LOD) is defined as a detection rate higher than 95%, as shown in Table 5 above, in the presence of 500 ng of Vero cell genomic DNA, the LOD of this fluorescent qPCR system for MPXV-1000 plasmid using primers / probe (MPXV F3 / R5 / P3) is 10 copies / reaction.
[0104] Specificity, sensitivity, and recovery in the presence of VG301 viral genomic DNA
[0105] like Figure 3 As shown, after adding 1×10 8 ~1×10 1 The standard curve drawn when the MPXV-1000 plasmid with 1×10 8 ~1×10 1 copies of the MPXV-1000 plasmid as a PCR template and an additional 1.0 × 10 7 The standard curves drawn when the copied VG301 viral genomic DNA was subjected to fluorescent qPCR were basically overlapping. The PCR priming efficiency of the former was 92.235%, R2=0.997, and the PCR priming efficiency of the latter was 93.625%, R2=0.997.
[0106] The amplified product (133 bp) obtained using primers / probe (MPXV F3 / R5 / P3) was verified by agarose gel electrophoresis. Figure 5 shown.
[0107] Lane M: DNA ladder (100 bp to 15 kb);
[0108] Lane 1: Add 1×10 8 The copied MPXV-1000 plasmid is the electrophoresis band of the fluorescent qPCR amplification product;
[0109] Lane 2: Add 1×10 7The copied MPXV-1000 plasmid is the electrophoresis band of the fluorescent qPCR amplification product;
[0110] Lane 3: Add 1×10 6 The copied MPXV-1000 plasmid is the electrophoresis band of the fluorescent qPCR amplification product;
[0111] Lane 4: Add 1×10 5 The copied MPXV-1000 plasmid is the electrophoresis band of the fluorescent qPCR amplification product;
[0112] Lane 5: Add 1×10 4 The copied MPXV-1000 plasmid is the electrophoresis band of the fluorescent qPCR amplification product;
[0113] Lane 6: Add 1×10 3 The copied MPXV-1000 plasmid is the electrophoresis band of the fluorescent qPCR amplification product;
[0114] Lane 7: Add 1×10 2 The copied MPXV-1000 plasmid is the electrophoresis band of the fluorescent qPCR amplification product;
[0115] Lane 8: Add 1×10 1 The copied MPXV-1000 plasmid is the electrophoresis band of the fluorescent qPCR amplification product;
[0116] Lane 9: negative control (ddH2O added);
[0117] Lane 10: Add 1×10 8 copies of MPXV-1000 plasmid and 1×10 7 The copied VG301 viral genomic DNA is the electrophoretic band of the fluorescent qPCR amplification product;
[0118] Lane 11: Add 1×10 7 copies of MPXV-1000 plasmid and 1×10 7 The copied VG301 viral genomic DNA is the electrophoretic band of the fluorescent qPCR amplification product;
[0119] Lane 12: Add 1×10 6 copies of MPXV-1000 plasmid and 1×10 7 The copied VG301 viral genomic DNA is the electrophoretic band of the fluorescent qPCR amplification product;
[0120] Lane 13: Add 1×10 5 copies of MPXV-1000 plasmid and 1×10 7The copied VG301 viral genomic DNA is the electrophoretic band of the fluorescent qPCR amplification product;
[0121] Lane 14: Add 1×10 4 copies of MPXV-1000 plasmid and 1×10 7 The copied VG301 viral genomic DNA is the electrophoretic band of the fluorescent qPCR amplification product;
[0122] Lane 15: Add 1×10 3 copies of MPXV-1000 plasmid and 1×10 7 The copied VG301 viral genomic DNA is the electrophoretic band of the fluorescent qPCR amplification product;
[0123] Lane 16: Add 1×10 2 copies of MPXV-1000 plasmid and 1×10 7 The copied VG301 viral genomic DNA is the electrophoretic band of the fluorescent qPCR amplification product;
[0124] Lanes 17-19: Add 1×10 1 copies of MPXV-1000 plasmid and 1×10 7 The electrophoretic bands of the fluorescent qPCR amplification products when the VG301 viral genomic DNA was copied (triplicate);
[0125] Lane 20: negative control (added with 1×10 7 copies of VG301 viral genomic DNA).
[0126] No nonspecific amplification bands were observed on the electrophoresis pattern.
[0127] The above results indicate that the specificity of the primers and probes is good enough even when an additional 1×10 7 The target sequence can still be specifically amplified in the presence of 1×10 7 Lanes 17-19 show that 10 copies of MPXV-1000 plasmid can still be detected, indicating that this method has good specificity and high sensitivity.
[0128] The following table 6 lists the 7 AVE±STD and intra- and inter-assay CV% of Ct values of four batches of qPCR in the presence of 100 copies of VG301 viral genomic DNA.
[0129] Table 6: In 1×10 7AVE±STD and intra-assay and inter-assay CV% of Ct values of four batches of qPCR in the presence of 10 copies of VG301 viral genomic DNA
[0130]
[0131] As shown in Table 6 above, whether the MPXV-1000 plasmid was used at 1×10 8 ~1×10 1 The number of copies starts at 1×10 7 In the presence of VG301 viral genomic DNA, the intra-assay CV% of the Ct values for the four qPCR batches did not exceed 2.9, and the inter-assay CV% did not exceed 3.8. This demonstrates that this fluorescent qPCR system is stable and highly reproducible.
[0132] The recovery rate (%) of the target amplification product was determined as follows:
[0133] Recovery rate (%) of target amplification product = measured level of target amplification product / theoretical level × 100%.
[0134] Table 7 below lists the results of adding 50 copies, 25 copies, 10 copies, 5 copies and 1 copy of MPXV-1000 plasmid as PCR amplification template at 1×10 7 Recovery rate (%) of target amplification products and intra-assay CV% of Ct values of four batches of qPCR in the presence of copied VG301 viral genomic DNA.
[0135] Table 7: In 1×10 7 Recovery rate (%) of target amplification products and intra-assay CV% of Ct values of four batches of qPCR in the presence of VG301 viral genomic DNA
[0136]
[0137]
[0138] When the limit of quantification (LOQ) is defined as the recovery rate of the target amplification product between 50% and 150% and the CV% is less than 10%, as shown in Table 7 above, at 1×10 7 In the presence of 5 copies of VG301 viral genomic DNA, the LOQ of this fluorescent qPCR system for MPXV-1000 plasmid using primers / probe (MPXVF3 / R5 / P3) is 5 copies / reaction.
[0139] Table 8 below lists the results of adding 50 copies, 25 copies, 10 copies, 5 copies and 1 copy of MPXV-1000 plasmid as PCR amplification template at 1×10 7Detection rate (%) of target amplification products by qPCR in the presence of copies of VG301 viral genomic DNA.
[0140] Table 8: In 1×10 7 Detection rate of target amplification products by qPCR in the presence of VG301 viral genomic DNA copies (%)
[0141]
[0142] When the detection limit (LOD) is defined as a detection rate higher than 95%, as shown in Table 8 above, at 1×10 7 In the presence of 5 copies of VG301 viral genomic DNA, the LOD of this fluorescent qPCR system for MPXV-1000 plasmid using primers / probe (MPXVF3 / R5 / P3) was 5 copies / reaction.
Claims
1. A nucleic acid molecule for detecting monkeypox virus, comprising: A primer pair for amplifying a nucleic acid fragment within the OPG118 gene of the monkeypox virus, and a probe for hybridizing to the sense strand or antisense strand of the nucleic acid fragment amplified by the primer pair; wherein the primer pair is a forward primer having a nucleotide sequence shown in SEQ ID NO: 2 and a reverse primer having a nucleotide sequence shown in SEQ ID NO: 3, The probe has a nucleotide sequence shown in SEQ ID NO:
4.
2. The nucleic acid molecule according to claim 1, wherein the amplified nucleic acid fragment comprises the nucleotide sequence shown in SEQ ID NO:
10. 3 . The nucleic acid molecule according to claim 1 , wherein the probe is linked to a reporter fluorescent group at the 5′ end and a quencher fluorescent group at the 3′ end, or is linked to a reporter fluorescent group at the 3′ end and a quencher fluorescent group at the 5′ end.
4. The nucleic acid molecule according to claim 3, wherein the reporter fluorescent group is selected from FAM, FITC, VIC, TET, JOE, ROX, Cy5, Cy3, 5-TAMRA and HEX.
5. The nucleic acid molecule according to claim 3, wherein the quenching fluorescent group is selected from MGB, Dabcyl, Eclipse, BHQ0, BHQ1, BHQ2 and BHQ3.
6. A kit for detecting monkeypox virus, comprising the nucleic acid molecule according to any one of claims 1 to 5.
7. The kit according to claim 6, further comprising one or more of a nucleic acid extraction reagent, a PCR buffer, a DNA polymerase, and dNTPs.
8. A method for detecting monkeypox virus, which is performed using the nucleic acid molecule according to any one of claims 1 to 5, wherein the method is used for non-diagnostic purposes.
9. The method of claim 8, wherein the detection of monkeypox virus is performed by polymerase chain reaction (PCR).
10. The method according to claim 9, wherein the PCR is fluorescent quantitative PCR. The method according to claim 8 , which is used for quality monitoring of a sample.
12. The method according to claim 11, wherein the sample is a sample from Vero cells or an oncolytic virus.
13. Use of the nucleic acid molecule according to any one of claims 1 to 5 in the manufacture of a preparation for detecting monkeypox virus.
14. The use according to claim 13, wherein the detection of the monkeypox virus is performed by polymerase chain reaction (PCR). The use according to claim 14 , wherein the PCR is fluorescent quantitative PCR.
Citation Information
Patent Citations
Method for clinically detecting monkey pox
CN115521997A
Set of oligonucleotide primers and fluorescent-marked probes for species-specific instant identification of orthopoxvirus by real-time multiplex PCR
RU2427648C1