Transgenic mouse model expressing human hla-a201 restricted genes
By introducing specific gene editing and transgenesis into a mouse model, the NSG-SGM3F-A2 mouse model was established, which solved the problem of insufficient reproduction of human diseases in existing models and achieved effective maturation of human T cells and immune system development in humanized mouse models.
Patent Information
- Application Number
- CN202180050762.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2020-07-08
- Filing Date
- 2021-07-07
- Publication Date
- 2025-12-12
- Estimated Expiration
- 2041-07-07
AI Technical Summary
Existing mouse models cannot fully reproduce human diseases when simulating them due to differences between the mouse and human immune systems, especially in T-cell derived models where there are graft-versus-host disease and limited MHC recognition issues.
By introducing inactivated Prkdc, Il2rg, and Flt3 alleles into a mouse model and expressing human IL3, GM-CSF, SCF, and HLA-A2/H2-D/B2M genes, an NSG-SGM3F-A2 mouse model was established to support antigen presentation on human HLA and matching of hematopoietic progenitor cells.
It achieved effective maturation and proliferation of human T cells in humanized mouse models, supported the transplantation of human CD34+HPCs and the development of the human immune system, and improved the reproducibility of the human immune system in mouse models.
Smart Images

Figure CN116322317B_ABST
Abstract
Description
[0001] Related Applications
[0002] This application claims the benefit of U.S. Provisional Application No. 63 / 049,187, filed July 8, 2020, pursuant to 35 U.S. SC §119(e), the entire contents of which are incorporated herein by reference. Background Technology
[0003] Mouse models have been widely used to study human diseases in vivo, circumventing the complexities of treating human patients. However, partly due to significant differences between the mouse and human immune systems, mouse models often fail to adequately reproduce human diseases (Hagai et al., 2018; Kanazawa, 2007; Mestas & Hughes, 2004; Williams, Flavell, & Eisenbarth, 2010). Therefore, humanized mice (defined as mice with a human immune system) may be an attractive alternative (Shultz, Brehm, Garcia-Martinez & Greiner, 2012; Theocharides, Rongvaux, Fritsch, Flavell & Manz, 2016; Victor Garcia, 2016; Zhang & Su, 2012). For this purpose, transplantation of human CD34... + Hematopoietic progenitor cells (HPCs) were used to humanize immunodeficient mice lacking a common γ chain (γc), such as NOD-SCID-Il2γc. - / - (NSG) or BALB / c-Rag2 - / - -γc - / - (BRG)(Matsumura et al., 2003; Traggiai et al., 2004). Based on the source of T cells, the model can be further classified into two types: (1) in which mature T cells are isolated from donors of HPC and adopted (Aspord et al., 2007; Pedroza-Gonzalez et al., 2011; Wu et al., 2014; Wu et al., 2018; Yu et al., 2008); in which case the T cells are selected from the human thymus; and (2) in which endogenous T cells are derived from human CD34 + HPC de novo generation model (Matsumura et al., 2003; Traggiai et al., 2004); in this case, human T cells are selected from the mouse thymus. Summary of the Invention
[0004] This disclosure provides a humanized mouse model expressing the HLA-A201 restriction gene. An important aspect of humanized mouse research is the maturation of human adaptive immunity in the context of human MHC (Billerbeck et al., 2013; Danner et al., 2011; Najima et al., 2016). This mouse model is generated to partially support antigen presentation on human HLA and to match hematopoietic progenitor cell (HPC) donors to mice. This mouse model particularly addresses the limitations of the aforementioned models. The biggest limitation of the first model, in which mature T cells are isolated from HPC donors and adopted, is graft-versus-host disease; where endogenous T cells are derived from human CD34... + The biggest limitation of the second model of HPC de novo generation is the limited number of T cells that can identify the human major histocompatibility complex (MHC).
[0005] Therefore, some aspects of this disclosure provide non-obese diabetic (NOD) mice comprising inactivated mouse Prkdc alleles, inactivated mouse IL2rg alleles, inactivated mouse Flt3 alleles, nucleic acids encoding human interleukin 3 (IL3), nucleic acids encoding human granulocyte / macrophage stimulating factor (GM-CSF), nucleic acids encoding human stem cell factor (SCF), and nucleic acids encoding human B2-microglobulin (B2M) covalently linked to the MHC1 class, α1, and α2 binding domains of the human HLA-A2.1 gene, as well as the α3 cytoplasmic and transmembrane domains (HLA-A2 / H2-D / B2M) of mouse H2-Db. Further aspects of this disclosure provide NSG comprising inactivated mouse Flt3 alleles, nucleic acids encoding human IL3, nucleic acids encoding human GM-CSF, nucleic acids encoding human SCF, and nucleic acids encoding HLA-A2 / H2-D / B2M. TM Mice. These mouse models support antigen presentation on human HLA and allow for matching of hematopoietic progenitor cell (HPC) donors with mice.
[0006] This article also provides methods for generating NOD mice containing inactivated mouse Prkdc alleles, inactivated mouse IL2rg alleles, inactivated mouse Flt3 alleles, nucleic acids encoding human IL3, human GM-CSF, human SCF, and human HLA-A2 / H2-D / B2M, methods for using said mice as a model system, and methods for breeding said mice.
[0007] This article further provides NSG containing transgenic molecules encoding human ILS, human GM-CSF, human SCF, and human HLA-A2 / H2-D / B2M. TM cell. Attached Figure Description
[0008] Figures 1A-1C Human CD34 + HPC-derived human engraftment. Figure 1A is a schematic depicting the breeding scheme of NSG-SGM3F-A2 mice. Figure 1B mCD45 + HLA-A2 expression on cells. Figure 1C hCD45 + cells and percentage of human CD33 + , CD19 + , and CD3 + cells in hNSG-SGM3F-A2 mice 12 weeks after transplantation with human fetal liver, cord blood, and bone marrow HPCs.
[0009] Figures 2A-2D Comparison of human engraftment in humanized SGM3F-A2 mice transplanted with human cord blood or fetal liver HPCs. Figure 2A Human engraftment measured in blood by percentage and absolute number of hCD45+ cells in hSGM3F-A2 mice 12 weeks after transplantation with 1 x 107 5 cord blood (CB) or fetal liver (FL) HPCs. n = 91 mice from 5 CB donors, n = 95 mice from 4 FL donors. Nested t-test. Figure 2B Absolute number of hCD33+, hCD19+, hCD3+ cells in hSGM3F-A2 mice. Figure 2C Absolute number of human CD4 + T cells and CD8 + T cells in blood of hSGM3F-A2 mice. Figure 2D Total human IgM, IgG, and IgA measured in plasma of hSGM3F-A2 mice by ELISA 12 weeks after transplantation. DETAILED DESCRIPTION
[0010] The present disclosure provides mouse models that support antigen presentation on human HLA and match hematopoietic progenitor cell (HPC) donors to mice. In some aspects, the mouse models provided herein have NOD.Cg-Prkdcscid Il2rgtm1Wjl / SzJ (NSG TM) background, and further comprises an inactivated mouse Flt3 allele, a nucleic acid encoding human interleukin 3 (IL3), a nucleic acid encoding human granulocyte macrophage colony-stimulating factor (GM-CSF), a nucleic acid encoding human stem cell factor (SCF), and a nucleic acid encoding human B2 microglobulin (B2M) covalently linked to the MHC class I, alpha 1 and alpha 2 binding domains of the human HLA-A2.1 gene, and the alpha 3, cytoplasmic and transmembrane domains of murine H2-Db (referred to herein as NSG-SGM3F-A2 mice). In some embodiments, the genotype of the NSG-SGM3F-A2 mouse model is NOD.Cg-Prkdc scid Il2rg tm1Wjl Tg(HLA-A / H2-D / B2M) 1Dvs / SzJ Flt3 em1Akp Tg(CMV-IL3,CSF2,KITLG) 1Eav / MloySzJ (see Example 1 for production of NOD.Cg-Prkdc scid Il2rg tm1Wjl Tg(HLA-A / H2-D / B2M) 1Dvs / SzJ Flt3 em1Akp Tg(CMV-IL3,CSF2,KITLG) 1Eav / MloySzJ mouse). In some embodiments, the NOD.Cg-Prkdc scid Il2rg tm1Wjl -Flt3 em1Akp Tg(CMV-IL3,CSF2,KITLG) 1Eav / MloySzJ (SGM3F) mouse was crossed with an HLA-A0201 transgenic mouse (NSG-A2(HHD)) and interbred until all offspring were homozygous to produce NOD.Cg-Prkdc scid Il2rg tm1Wjl Tg(HLA-A / H2-D / B2M) 1Dvs / SzJ Flt3 em1Akp Tg(CMV-IL3,CSF2,KITLG) 1Eav / MloySzJ mouse.
[0011] NSG TMMice are immunodeficient mice that lack mature T cells, B cells, and natural killer (NK) cells, have defects in multiple cytokine signaling pathways, and have numerous defects in innate immunity (see, e.g., (Shultz, Ishikawa, & Greiner, 2007; Shultz et al., 2005; Shultz et al., 1995), each of which is incorporated herein by reference). NSG mice derived from the non-obese diabetic (NOD) mouse strain NOD / ShiLtJ TM Mice (see, e.g., (Makino et al., 1980), incorporated herein by reference) include Prkdc scid mutations (also referred to as "severe combined immunodeficiency" mutations or "scid" mutations) and Il2rg tm1Wjl targeted mutations. Prkdc scid mutations are loss-of-function mutations in the mouse homolog of the human PRKDC gene - such mutations essentially eliminate adaptive immunity (see, e.g., (Blunt et al., 1995; Greiner, Hesselton, & Shultz, 1998), each of which is incorporated herein by reference). Il2rg tm1Wjl mutations are null mutations in the gene encoding the interleukin 2 receptor gamma chain (IL2Ry, homologous to IL2RG in humans), which blocks NK cell differentiation, thus removing an obstacle that prevents efficient engraftment of primary human cells ((Cao et al., 1995; Greiner et al., 1998; Shultz et al., 2005), each of which is incorporated herein by reference). As is known in the art, loss-of-function mutations result in a gene product that has little or no function. In contrast, null mutations result in a gene product that has no function. An inactivated allele can be a loss-of-function allele or a null allele.
[0012] An inactivated allele is an allele that does not produce detectable levels of a functional gene product (e.g., a functional protein). In some embodiments, an inactivated allele is not transcribed. In some embodiments, an inactivated allele does not encode a functional protein. Thus, a mouse comprising an inactivated mouse Flt3 allele does not produce detectable levels of functional FLT3. In some embodiments, a mouse comprising an inactivated mouse Flt3 allele does not produce any functional FLT3.
[0013] Flt3 is a receptor important for development of the dendritic cell and monocyte lineage. Flt3L-Flt3 signaling is important for development of various DC and monocyte lineages (Ding et al., 2014; Ginhoux et al., 2009; Mckenna et al., 2000; Waskow et al., 2008) and its role is further supported by the increase in circulating conventional (c) DC and plasmacytoid (p) DC following administration of Flt3L in mice and humans (Karsunky, Merad, Cozzio, Weissman, & Manz, 2003; Maraskovsky et al., 1996; Pulendran et al., 2000). Knocking out mouse Flt3 can result in: (1) reduction of murine DC and other myeloid cells; and (2) increase in availability of human cells to mouse Flt3L, which can act through the human receptor, thereby improving human CD34 + Long-term development of human bone marrow cells after HPC transplantation.
[0014] The NSG-SGM3F-A2 mouse model provided herein comprises a genomic modification that inactivates a mouse Flt3 allele. A modification, with respect to a nucleic acid, is any manipulation of that nucleic acid relative to the corresponding wild-type nucleic acid (e.g., naturally-occurring nucleic acid). Thus, a genomic modification is any manipulation of a nucleic acid in the genome relative to the corresponding wild-type nucleic acid (e.g., naturally-occurring nucleic acid) in the genome. Non-limiting examples of nucleic acid (e.g., genomic) modifications include deletions, insertions, “indels” (deletions and insertions), and substitutions (e.g., point mutations). In some embodiments, a deletion, insertion, indel, or other modification in a gene results in a frameshift mutation such that the gene no longer encodes a functional product (e.g., protein). Modifications also include chemical modifications, e.g., of at least one nucleobase. Methods of nucleic acid modification, e.g., those that result in inactivation of a gene, are known and include, but are not limited to, RNA interference, chemical modification, and gene editing (e.g., using a recombinase or other programmable nuclease system, e.g., CRISPR / Cas, TALENs, and / or ZFNs). In some embodiments, CRISPR / Cas gene editing is used to inactivate a mouse Flt3 allele, as described elsewhere herein.
[0015] In some embodiments, the genomic modification (e.g., deletion or indel) is in a region of the mouse Flt3 allele selected from the group consisting of a coding region, a non-coding region, and a regulatory region. In some embodiments, the genomic modification (e.g., deletion or indel) is a coding region of the mouse Flt3 allele. For example, the genomic modification (e.g., deletion or indel) can be in exon 3, or it can span exon 3 of the mouse Flt3 allele. In some embodiments, the genomic modification is a genomic deletion. For example, the mouse Flt3 allele can comprise a genomic deletion of the nucleotide sequence in exon 3. In some embodiments, the nucleotide sequence of SEQ ID NO: 1 has been deleted from the inactivated mouse Flt3 allele. In some embodiments, the inactivated mouse Flt3 allele comprises the nucleotide sequence of SEQ ID NO: 1.
[0016] In some embodiments, the NSG-SGM3F-A2 mouse model provided herein does not express detectable levels of mouse FLT3. Detectable levels of mouse FLT3 are any level of FLT3 protein detected using standard protein detection assays, such as flow cytometry and / or ELISA. In some embodiments, the NSG-SGM3F-A2 mouse model expresses no detectable levels or low levels of mouse FLT3. For example, the mouse model can express less than 1,000 pg / ml of mouse FLT3. In some embodiments, the mouse model expresses less than 500 pg / ml of mouse FLT3 or less than 100 pg / ml of mouse FLT3. The mouse FLT3 receptor is also known as cluster of differentiation antigen CD135. Thus, in some embodiments, the NSG-SGM3F-A2 mouse model does not comprise (absence of) CD135 + Pluripotent progenitor cells.
[0017] In some embodiments, Flt3 knockout mice are generated by CRISPR using Cas9 mRNA and guide RNA (gRNA). In some embodiments, the gRNA (e.g., 5'-AAGTGCAGCTCGCCACCCCA-3', SEQ ID NO: 2) targets exon 3 of mouse Flt3 in NSG TM NOD.Cg-Prkdc scid Il2rg tm1Wjl -Flt3 em1Akp ; RRID:IMSR JAX:005557). In some embodiments, blastocysts derived from injected embryos are implanted into surrogate mothers and neonatal pups are obtained. In some embodiments, mice carrying the null deletion are bred with NSG TMBackcrossing. For example, F0 and Fl littermates can be tested for successful gene knockout by PCR and Sanger sequencing. For example, primers (5'-GGTACCAGCAGAGTTGGATAGC-3', SEQ ID NO: 3) and (5'- ATCCCTTACACAGAAGCTGGAG-3', SEQ ID NO: 4) can be used in a PCR reaction to detect the mouse Flt3 wild-type allele from the mutant allele (Table 1). The WT allele produces a DNA fragment of 799 bp in length, while the mutated allele produces a DNA fragment of 363 bp in length.
[0018] Transgenic mouse models
[0019] A transgenic model (Tg mouse) can be generated, for example, to modify a gene sequence by replacing a gene sequence with a transgene, or by adding a gene sequence that is not present within the locus. The NSG-SGM3F-A2 mouse models provided herein include transgenic alleles. They include exogenous nucleic acids that have been introduced into the mouse genome.
[0020] The nucleic acids used provided herein can be DNA, RNA, or chimeras of DNA and RNA. In some embodiments, a nucleic acid (e.g., DNA) comprises a gene that encodes a protein of particular interest. A gene is a unique sequence of nucleotides whose order determines the order of monomers in a polynucleotide or polypeptide. A gene typically encodes a protein. A gene can be endogenous (naturally occurring in the host organism) or exogenous (naturally or by genetic engineering transferred to the host organism). An allele is one of two or more alternative forms of the same gene that arise from mutation and are found at the same locus on a chromosome. In some embodiments, a gene includes a promoter sequence, a coding region (e.g., exon), a non-coding region (e.g., intron), and a regulatory region (also known as a regulatory sequence). As known in the art, a promoter sequence is a DNA sequence at the start of the transcription of a gene. The promoter sequence is typically located directly upstream (at the 5' end) of the transcription start site. An exon is a region of a gene that encodes an amino acid. An intron (and other non-coding DNA) is a region of a gene that does not encode an amino acid.
[0021] A mouse comprising a human gene is considered to comprise a human transgene. A transgene is a gene that is foreign to the host organism. That is, a transgene is a gene that is naturally or by genetic engineering transferred to the host organism. A transgene is not naturally occurring in the host organism (the organism comprising the transgene, e.g., a mouse).
[0022] Methods of generating transgenic mouse models are described elsewhere herein.
[0023] The NSG-SGM3F-A2 mice described herein comprise an inactivated mouse Flt3 allele, a nucleic acid encoding IL3, a nucleic acid encoding GM-CSF, a nucleic acid encoding SCF, and a nucleic acid encoding human B2-microglobulin (B2M) covalently linked to the MHC class I, alpha 1 and alpha 2 binding domains of the human HLA-A2.1 gene and the alpha 3, cytoplasmic and transmembrane domains of murine H2-Db. In some embodiments, the NSG-SGM3F-A2 mice described herein comprise an inactivated mouse Flt3 allele, a nucleic acid encoding human IL3, a nucleic acid encoding human GM-CSF, a nucleic acid encoding human SCF, and a nucleic acid encoding human B2-microglobulin (B2M) covalently linked to the MHC class I, alpha 1 and alpha 2 binding domains of the human HLA-A2.1 gene and the alpha 3, cytoplasmic and transmembrane domains of murine H2-Db. In some embodiments, the NSG-SGM3F-A2 mice comprise a human IL3 transgene, a human GM-CSF transgene, a human SCF transgene, and a human HLA-A2 / H2-D / B2M transgene (a transgene encoding human B2-microglobulin (B2M) covalently linked to the MHC class I, alpha 1 and alpha 2 binding domains of the human HLA-A2.1 gene and the alpha 3, cytoplasmic and transmembrane domains of murine H2-Db). In some embodiments, the transgenes, e.g., the human IL3 transgene, the human GM-CSF transgene, the human SCF transgene, and / or the human HLA-A2 / H2-D / B2M transgene are integrated into the mouse genome. Human IL3, CSF2, and KITLG transgenes are described (Nicolini, Cashman, Hogge, Humphries, & Eaves, 2004), which is incorporated by reference herein. Human HLA-A2 / H2-D / B2M transgenes are described (Pascolo et al., 1997; Takaki et al., 2006), which are incorporated by reference herein.
[0024] In some embodiments, the NSG-SGM3F-A2 mice are generated by mating NSG-HLA-A2 / HHD mice (RRID: IMSR JAX: 014570) with SGM3F mice (NOD.Cg-Prkdc scid Il2rg tm1Wjl -Flt3 em1Akp Tg(CMV-IL3, CSF2, KITLG) 1Eav / MloySzJ) are generated. NSG-SGM3 mice carry three separate transgenes, each designed to carry one of the human interleukin-3 (IL3), human granulocyte / macrophage stimulating factor (GM-CSF), or human stem cell factor (SCF) genes. Expression of each gene is driven by a human cytomegalovirus promoter / enhancer sequence followed by a human growth hormone cassette and a polyadenylation (polyA) sequence. The transgenes are microinjected into fertilized C57BL / 6 x C3H / HeN oocytes. In some embodiments, the resulting founder carrying all three transgenes (3GS) is backcrossed to BALB / c-scid / scid mice for several generations and then backcrossed to NOD.CB17-Prkdc scid Il2rg tm1Wjl ; RRID:IMSR JAX:005557) and then interbred until all offspring are homozygous for the 3GS and the IL2rg targeted mutation. The transgenic mice can be bred to NSG mice for at least one generation to establish NSG-SGM3 mice. For example, NSGF mice can be generated using a CRISPR / cas system. In some embodiments, Cas9 mRNA and sgRNA targeting mouse Flt3 are co-injected into fertilized NSG oocytes. The resulting founder carrying a Flt3 deletion can be bred to NSG mice and then interbred until all offspring are homozygous for the Flt3 targeted mutation. NSG-SGM3F mice can be bred to NSGF mice for several generations (e.g., two generations) to establish NSG-SGM3F-A2 mice. - / - B2m - / - HLA-A2 / HHD transgene expression in mice restores CD8+ T cells and enables HLA-A2.1-restricted cytotoxic T cell responses (Pascolo et al., 1997). NSG-HLA-A2 / HHD mice can then be bred to NSG-SGM3F mice for several generations (e.g., at least four generations) to establish NSG-SGM3F-A2 mice.
[0025] Human immune system model
[0026] In some embodiments, the NSG-SGM3F-A2 mouse model of the present disclosure is used to support human CD34 +Hematopoietic progenitor cells (HPCs) and development of the human innate immune system. The human immune system includes the innate immune system and the adaptive immune system. The innate immune system is responsible for recruiting immune cells to sites of infection, activating the complement cascade, recognizing and clearing foreign substances in the body by white blood cells, activating the adaptive immune system, and serving as a physical and chemical barrier to infectious agents.
[0027] In some embodiments, the NSG-SGM3F-A2 mouse model provided herein is sublethally irradiated (e.g., 100-300 cGy) to kill resident mouse HPCs, and then the irradiated mouse is transplanted with human CD34 + HPCs (e.g., 50,000-200,000 HPCs) to initiate development of the human innate immune system. Thus, in some embodiments, the mouse also comprises human CD34 + HPCs. The human CD34 + HPCs can be from any source, including but not limited to human fetal liver, umbilical cord blood, mobilized peripheral blood, and bone marrow. In some embodiments, the human CD34 + HPCs are from human umbilical cord blood.
[0028] The human CD34 + HPCs differentiate into distinct immune cells (e.g., T cells, B cells, dendritic cells) is a complex process in which successive developmental steps are regulated by a variety of cytokines. This process can be monitored by cell surface antigens such as cluster of differentiation (CD) antigens. For example, CD45 is expressed on the surface of HPCs, macrophages, monocytes, T cells, B cells, natural killer cells, and dendritic cells, and thus can be used as a marker to indicate engraftment. In T cells, CD45 regulates T cell receptor signaling, cell growth, and cell differentiation. In some embodiments, the NSG-SGM3F-A2 mouse model comprises human CD45 + cells. In some embodiments, the NSG-SGM3F-A2 mouse model also shows human CD45 + cells engraft into tissues, but are not limited to the lung, thymus, spleen, lymph nodes, and / or small intestine.
[0029] As CD45+ cells mature, they begin to express additional biomarkers that indicate various different developmental stages and differentiated cell types. Developing T cells, for example, also express CD3, CD4, and CD8. As another example, developing myeloid cells express CD33 + In some embodiments, the mouse model herein not only comprises human CD45 + cells, but also double positive human CD45 + / CD3 + T cells as well as double positive human CD45+ / CD33+ myeloid cells.
[0030] Thus, in some embodiments, the population of human CD45 + cells in the NSG-SGM3F-A2 mouse model comprises an increased percentage of human CD45 + / CD3 + T cells. In some embodiments, relative to an NSG TM control mouse, the population of human CD45 + cells in the mouse model comprises an increased percentage of human CD45 + / CD3 + T cells. In some embodiments, relative to an NSG TM control mouse, the percentage of human CD45 + / CD3 + T cells in the NSG-SGM3F-A2 mouse model is increased by at least 25%. For example, relative to an NSG TM control mouse, the percentage of human CD45 + / CD3 + T cells in the mouse model can be increased by at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100%. In some embodiments, relative to an NSG TM control mouse, the percentage of human CD45 + / CD3 + T cells in the mouse model is increased by at least 50%. In some embodiments, relative to an NSG TM control mouse, the percentage of human CD45 + / CD3 + T cells in the mouse model is increased by at least 100%. In some embodiments, relative to an NSG TM control mouse, the percentage of human CD45 + / CD3 + T cells in the mouse model is increased by 25-100%, 25-75%, 25-50%, 50-100%, 50-75%, or 75-100%.
[0031] In some embodiments, the population of human CD45 + cells in the NSG-SGM3F-A2 mouse model comprises an increased percentage of human CD45 + / CD33 + myeloid cells. In some embodiments, relative to an NSG TM control mouse, the population of human CD45 + cells in the mouse model comprises an increased percentage of human CD45 + / CD33 +myeloid cells. In some embodiments, the percentage of human CD45 TM human CD45 + / CD33 + T cells is increased at least 25% relative to NSG TM control mice, in a mouse model. For example, the percentage of human CD45 + / CD33 + T cells is increased at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% relative to NSG TM control mice, in a mouse model. In some embodiments, the percentage of human CD45 + / CD33 + T cells is increased at least 50% relative to NSG TM control mice, in a mouse model. In some embodiments, the percentage of human CD45 + / CD33 + T cells is increased at least 100% relative to NSG TM control mice, in a mouse model. In some embodiments, the percentage of human CD45 + / CD33 + T cells is increased 25-100%, 25-75%, 25-50%, 50-100%, 50-75%, or 75-100% relative to NSG
[0032] In some embodiments, the population of human CD45 + cells in a NSG-SGM3F-A2 mouse model comprises human CD45 + / CD19 + B cells. In some embodiments, the population of human CD45 TM cells comprises an increased percentage of human CD45 + / CD19 + B cells relative to NSG + control mice. In some embodiments, the percentage of human CD45 TM / CD19 + B cells is increased at least 25% relative to NSG + control mice, in a mouse model. For example, the percentage of human CD45 TM / CD19 + B cells is increased at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% relative to NSG +The percentage of B cells can be increased by at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100%. In some embodiments, the percentage of B cells is increased by at least 50% relative to NSG TM control mice, human CD45 + / CD19 + B cells in the mouse model. In some embodiments, the percentage of B cells is increased by at least 50% relative to NSG TM control mice, human CD45 + / CD19 + B cells in the mouse model. In some embodiments, the percentage of B cells is increased by at least 100% relative to NSG TM control mice, human CD45 + / CD19 + B cells in the mouse model. In some embodiments, the percentage of B cells is increased by 25-100%, 25-75%, 25-50%, 50-100%, 50-75%, or 75-100% relative to NSG
[0033] The NSG-SGM3F-A2 mouse model provided herein is surprisingly also capable of supporting engraftment of dendritic cells (e.g., plasmacytoid dendritic cells and myeloid dendritic cells), natural killer cells, and monocyte-derived macrophages (monocyte macrophages). Plasmacytoid dendritic cells (pDCs) secrete high levels of interferon alpha; myeloid dendritic cells (mDCs) secrete interleukin 12, interleukin 6, tumor necrosis factor, and chemokines; natural killer cells destroy damaged host cells, such as tumor cells and virus-infected cells; and macrophages consume large amounts of bacteria or other cells or microorganisms.
[0034] In some embodiments, the NSG-SGM3F-A2 mouse model comprises an increased percentage of human CD11c TM myeloid dendritic cells relative to NSG + control mice and / or NSGF control mice. In some embodiments, the NSG-SGM3F-A2 mouse comprises an increased percentage of human CD11c TM myeloid dendritic cells relative to NSG + HLA-DR + myeloid dendritic cells. For example, the NSG-SGM3F-A2 mouse comprises an increased percentage of human CD11c TM HLA-DR + myeloid dendritic cells relative to NSG +The percentage of myeloid dendritic cells can be increased by at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100%. In some embodiments, the percentage of myeloid dendritic cells is increased by at least 50% relative to NSG TM The percentage of human CDllc+ cells in NSG-SGM3F-A2 mice relative to control mice and / or NSGF control mice + HLA-DR + The percentage of myeloid dendritic cells is increased by at least 50%. In some embodiments, the percentage of myeloid dendritic cells is increased by at least 50% relative to NSG TM The percentage of human CDllc+ cells in NSG-SGM3F-A2 mice relative to control mice and / or NSGF control mice + HLA-DR + The percentage of myeloid dendritic cells is increased by at least 100%. In some embodiments, the percentage of myeloid dendritic cells is increased by at least 100% relative to NSG TM The percentage of human CDllc+ cells in NSG-SGM3F-A2 mice relative to control mice and / or NSGF control mice + HLA-DR + The percentage of myeloid dendritic cells is increased by 25-100%, 25-75%, 25-50%, 50-100%, 50-75%, or 75-100%.
[0035] In some embodiments, the NSG-SGM3F-A2 mouse model of the present disclosure is used to support transplantation of HLA-A2 matched hematopoietic lineages.
[0036] Methods of generating transgenic animals
[0037] In some aspects, provided herein are methods of generating a transgenic animal expressing a human transgene. In the present context, a transgenic animal refers to an animal having a foreign (exogenous) nucleic acid (e.g., a transgene) inserted (integrated) into its genome. In some embodiments, the transgenic animal is a transgenic rodent, e.g., a mouse or a rat. In some embodiments, the transgenic animal is a mouse. Three general methods for generating transgenic animals include DNA microinjection ((Gordon & Ruddle, 1981), incorporated herein by reference), embryonic stem cell-mediated gene transfer ((Gossler, Doetschman, Korn, Serfling, & Kemler, 1986), incorporated herein by reference), and retrovirus-mediated gene transfer ((Jaenisch, 1976), incorporated herein by reference), any of which can be used as provided herein. Electroporation can also be used to generate transgenic mice (see, e.g., WO 2016 / 054032 and WO 2017 / 124086, each of which is incorporated herein by reference).
[0038] In some embodiments, the nucleic acid comprises a transgene, e.g., a transgene comprising a promoter (e.g., a constitutively active promoter) operably linked to a nucleotide sequence encoding a polypeptide of interest. In some embodiments, the nucleic acid used to generate a transgenic animal (e.g., a mouse) is present on a vector, e.g., a plasmid, a bacterial artificial chromosome (BAC), or a yeast artificial chromosome (YAC), which is delivered to, e.g., the pronucleus / nucleus of a fertilized embryo, where the nucleic acid randomly integrates into the animal genome. In some embodiments, the fertilized embryo is a single cell embryo (e.g., a zygote). In some embodiments, the fertilized embryo is a multi-cell embryo (e.g., a developmental stage after a zygote, such as a blastocyst). In some embodiments, the nucleic acid (e.g., carried on a BAC) is delivered to a fertilized embryo of a mouse to generate a mouse model of the present application. Following injection of the fertilized embryo, the fertilized embryo can be transferred to a pseudopregnant female, which subsequently gives birth to an offspring comprising the nucleic acid encoding the polypeptide of interest. The presence or absence of the nucleic acid can be confirmed, e.g., using various genotyping methods (e.g., sequencing and / or genomic PCR).
[0039] Also provided herein are methods of inactivating an endogenous Flt3 allele. In some embodiments, an endogenous Flt3 allele in a transgenic animal is inactivated. In some embodiments, a gene / genomic editing method is used for gene (allele) inactivation. Engineered nuclease-based gene editing systems that can be used as provided herein include, for example, clustered regularly interspaced short palindromic repeats (CRISPR) systems, zinc finger nucleases (ZFNs), and transcription activator-like effector nucleases (TALENs). See, e.g., (Carroll, 2011; Gaj, Gersbach, & Barbas, 2013; Joung & Sander, 2013), each of which is incorporated herein by reference.
[0040] In some embodiments, a CRISPR system is used to inactivate an endogenous Flt3 allele of the NSG-SGM3F-A2 mouse model provided herein. See, e.g., (Harms et al., 2014; Inui et al., 2014), each of which is incorporated herein by reference. For example, Cas9 mRNA or protein and one or more guide RNAs (gRNAs) can be injected directly into mouse embryos to generate precise genome edits in the Flt3 gene. Mice developed from these embryos can be genotyped or sequenced to determine if they carry the desired mutation, and those carrying the mutation can be bred to confirm germline transmission.
[0041] The CRISPR / Cas system is a naturally occurring defense mechanism in prokaryotes that has been engineered into an RNA-guided-DNA-targeting platform for gene editing. Engineered CRISPR systems comprise two main components: a guide RNA (gRNA) and a CRISPR-associated endonuclease (e.g., a Cas protein). The gRNA is a short synthetic RNA that consists of a scaffold sequence for nuclease binding and a user-defined nucleotide spacer (e.g., about 15-25 nucleotides, or about 20 nucleotides) that defines the genomic target to be modified. Thus, the genomic target of the Cas protein can be changed by simply changing the target sequence present in the gRNA. In some embodiments, the CRISPR-associated endonuclease is selected from Cas9, Cpfl, C2cl, and C2c3. In some embodiments, the Cas nuclease is Cas9.
[0042] The guide RNA comprises at least a spacer sequence that hybridizes (binds) to a target nucleic acid sequence and a CRISPR repeat sequence that binds to and directs an endonuclease to the target nucleic acid sequence. As understood by one of ordinary skill in the art, each gRNA is designed to include a spacer sequence that is complementary to its genomic target sequence (e.g., a region of a Flt3 allele). See, e.g., (Deltcheva et al., 2011; Jinek et al., 2012), each of which is incorporated herein by reference. In some embodiments, the gRNA used in the methods provided herein binds to a region of a mouse Flt3 allele (e.g., exon 3). In some embodiments, the gRNA that binds to a region of a mouse Flt3 allele comprises the nucleotide sequence of 5'-AAGTGCAGCTCGCCACCCCA-3' (SEQ ID NO: 2).
[0043] Methods of use
[0044] The NSG-SGM3F-A2 mouse models provided herein can be used for a number of applications. For example, the mouse models can be used to test how a particular agent (e.g., a therapeutic agent) or medical procedure (e.g., a tissue transplant) affects the human innate immune system (e.g., human innate immune cell responses) and the human adaptive immune system (e.g., antibody responses).
[0045] In some embodiments, the mouse models are used to evaluate the effect of an agent on the development of the human innate immune system. Accordingly, the methods provided herein include administering an agent to a mouse model and evaluating the effect of the agent on the development of the human innate immune system in the mouse. For example, the effect of the agent can be assessed by measuring human innate immune cell (e.g., T cell and / or dendritic cell) responses (e.g., cell death, cell signaling, cell proliferation, etc.) and human adaptive immune responses (e.g., antibody production). Non-limiting examples of agents include therapeutic agents, such as anti-cancer agents and anti-inflammatory agents, and prophylactic agents, such as immunogenic compositions (e.g., vaccines).
[0046] In other embodiments, the mouse models are used to evaluate the immunotherapeutic response to a human tumor. Accordingly, the methods provided herein include administering an agent to a mouse model having a human tumor and evaluating the effect of the agent on the human innate immune system and / or the tumor in the mouse. The effect of the agent can be evaluated by measuring human innate immune cell (e.g., T cell and / or dendritic cell) responses, human adaptive immune responses (e.g., antibody production), and / or tumor cell responses (e.g., cell death, cell signaling, cell proliferation, etc.). In some embodiments, the agent is an anti-cancer agent.
[0047] In still other embodiments, the mouse model is used to evaluate the human innate immune response to infectious microorganisms. Thus, the methods provided herein include exposing the mouse model to an infectious microorganism (e.g., a bacterium and / or a virus) and evaluating the effect of the infectious microorganism on the human innate immune response. The effect of the infectious microorganism can be evaluated by measuring the human innate immune cell (e.g., T cell and / or dendritic cell) response (e.g., cell death, cell signaling, cell proliferation, etc.). These methods can further include administering a drug or antimicrobial agent (e.g., an antibacterial agent or an antiviral agent) to the mouse and evaluating the effect of the drug or antimicrobial agent on the infectious microorganism.
[0048] In still further embodiments, the mouse model is used to evaluate the human immune response to tissue transplantation. Thus, the methods provided herein include transplanting a tissue (e.g., allogeneic tissue) to the mouse model and evaluating the effect of the transplanted tissue on the human innate immune response. The effect of the transplanted tissue can be evaluated by measuring the human innate immune cell (e.g., T cell and / or dendritic cell) response (e.g., cell death, cell signaling, cell proliferation, etc.) and the human adaptive immune response (e.g., antibody production) to the transplanted tissue.
[0049] EMBODIMENT
[0050] EMBODIMENT 1. NOD.Cg-Prkdc scid Il2rg tm1Wjl Tg(HLA-A / H2-D / B2M) 1Dvs / SzJ Flt3 em1Akp Tg(CMV-IL3, CSF2, KITLG) 1Eav / MloySzJ (NSG-SGM3F-A2) mouse model
[0051] An important aspect of humanizing mice is the maturation of human adaptive immunity in the context of human MHC (Billerbeck et al., 2013; Danner et al., 2011; Najima et al., 2016). To support antigen presentation on human HLA and to match HPC donors to mice, we crossed SGM3F (NOD.Cg-Prkdc scid Il2rg tm1Wjl -Flt3 em1Akp Tg(CMV-IL3, CSF2, KITLG) 1Eav / MloySzJ ) mice with HLA-A0201 transgenic mice (NSG-A2(HHD)) and intercrossed to homozygosity in all offspring to generate NOD.Cg-Prkdc scid Il2rg tm1Wjl Tg(HLA-A / H2-D / B2M) 1Dvs / SzJFlt3 em1Akp Tg(CMV-IL3, CSF2, KITLG) 1Eav / MloySzJ (NSG-SGM3F-A2) Figure 1A ). The SGM3F mice combine the features of NSG mice with the transgenic expression of human stem cell factor (SCF), granulocyte macrophage colony-stimulating factor (GM-CSF), and interleukin (IL)-3 (NSG-SGM3, SGM3) (Nicolini et al., 2004; Wunderlich et al., 2010) and the combination of NSG mice with Flt3 mutant mice (NSGF). To confirm the expression of human HLA-A0201, we measured and confirmed surface expression of HLA-A2 in mouse bone marrow cells Figure 1B ). To test their ability to support human immune system engraftment, NSG-SGM3F-A2 mice were sublethally irradiated and transplanted with 1 x 107 5 HLA-A2 + CD34 + HPC. Mice receiving both fetal liver and cord blood HPC showed comparable immune cell composition in the blood, while less CD3 + T cells were found in mice with bone marrow HPC Figure 1C ). Moreover, 6 months after engraftment with FL, CB, or BM HPC, we observed a large number of hCD45 + immune cells in the lungs of the mice, including CD11c + DC and CD3 + T cells (data not shown). Importantly, 6 months after engraftment with HLA-A2 + CB HPC, HLA-A2 expression in the thymus was detected on mouse thymic epithelial cells using BB7.2 antibody specific for HLA-A2 (data not shown) in hNSG-SGM3F-A2 mice reconstituted with HLA-A2 + HPC, which allows for the maturation of T cells in the context of human HLA-A2.
[0052] Example 2. Comparison of human engraftment in humanized SGM3F-A2 mice engrafted with human cord blood or fetal liver HPC
[0053] Due to the limited availability of human fetal tissues, the use of cord blood-derived HPCs to build humanized mice was validated. Different cell types from cohorts of mice transplanted with 4-5 different cord blood or fetal liver donors were compared side-by-side. The data showed that humanized mice transplanted with fetal liver HPCs exhibited only slightly higher hCD45 + Transplantation Figures 2A-2B ) of hCD4 + T cells was observed in mice transplanted with fetal liver HPCs, but no difference was found in the total number of hCD8 + T cells ( Figure 2C ). To compare the functional ability of fetal liver or cord blood-derived human HPCs in priming adaptive humoral responses, the ability of humanized NSG-SGM3F-A2 mice to produce human antibodies was assessed. To this end, total human Ig in plasma at 12 weeks post-transplantation was measured by ELISA. As shown in Figure 2D , both groups of mice secreted comparable amounts of human IgM in plasma, and levels of total human IgG and IgA subclasses were also similar. Thus, the antibody secretion and Ig class switching ability were comparable between HPCs of different origins in humanized NSG-SGM3F-A2 mice. Overall, the level of variability observed in mice produced from the same HPC source in different donors was higher than the variability between HPC sources. This analysis showed that cord blood HPCs provide comparable human engraftment in NSG-SGM3F-A2 mice as fetal liver HPCs.
[0054] Generation of mouse model SGM3F: NSG-SGM3-Flt3ko or SGM3F mice (NOD.Cg-Prkdc scid Il2rg tm1Wjl -Flt3 em1Akp Tg(CMV-IL3, CSF2, KITLG) 1Eav / MloySzJ ) by crossing NSG-SGM3 mice (NOD.Cg-Prkdc scid Il2rg tm1Wjl Tg(CMV-IL3, CSF2, KITLG) 1Eav / MloySzJ ; RRID:IMSR JAX:013062) with NSGF (NOD.Cg-Prkdc scid Il2rg tm1Wjl -Flt3 em1Akp) Mice were crossed and intercrossed until all offspring were homozygous to produce NSG-SGM3 mice. NSG-SGM3 mice carry three separate transgenes, each designed to carry the human interleukin-3 (IL3) gene, the human granulocyte / macrophage stimulating factor (GM-CSF) gene, or the human stem cell factor (SCF) gene. Expression of each gene is driven by a human cytomegalovirus promoter / enhancer sequence, followed by a human growth hormone cassette and a polyadenylation (polyA) sequence. The transgenes were microinjected into fertilized C57BL / 6 x C3H / HeN oocytes. The resulting founders, which carry all three transgenes (3GS), were backcrossed to BALB / c-scid / scid mice for several generations, followed by at least 11 generations of backcrossing to NOD.CB17-Prkdc scid Il2rg tm1Wjl ; RRID:IMSR JAX:005557) and then intercrossed until all offspring were 3GS and IL2rg targeted mutation homozygous. Upon arrival at the Jackson Laboratory, the transgenic mice were bred to NSG mice for one generation to establish NSG-SGM3 mice. NSGF mice were generated using the CRISPR / cas system. CRISPR was generated in NSG mouse zygotes using Cas9 mRNA and sgRNA targeting exon 3 of mouse Flt3 (5'-AAGTGCAGCTCGCCACCCCA-3', SEQ ID NO:2). Blastocysts derived from injected embryos were transferred into surrogate mothers and neonatal pups were obtained. Mice carrying the null deletion were backcrossed to NSG. F0 and Fl littermates were tail tipped and tested for successful gene knockout by PCR and Sanger sequencing. Primers (5'-GGTACCAGCAGAGTTGGATAGC-3', SEQ ID NO:3) and (5'-ATCCCTTACACAGAAGCTGGAG-3', SEQ ID NO:4) were used in PCR reactions to detect mouse Flt3 wild-type alleles from mutant alleles (Table 1). WT alleles produced a DNA fragment of 799 bp in length, while mutated alleles produced a DNA fragment of 363 bp in length.
[0055] Generation of mouse model NSG-SGM3F-A2: NSG-SGM3-Flt3ko-A2 or NSG-SGM3F-A2 mice (NOD.Cg-Prkdc scid Il2rg tm1Wjl Tg(HLA-A / H2-D / B2M) 1Dvs / SzJ Flt3em1Akp Tg(CMV-IL3, CSF2, KITLG) 1Eav / MloySzJ ) by crossing NSG-HLA-A2 / HHD mice (RRID: IMSR JAX: 014570) with NSG-SGM3-Flt3ko or SGM3F mice (NOD.Cg-Prkdc scid Il2rg tm1Wjl -Flt3 em1Akp Tg(CMV-IL3, CSF2, KITLG) 1Eav / MloySzJ ) were generated. NSG-SGM3-Flt3ko mice carry three separate transgenes designed to each carry the human interleukin-3 (IL3), human granulocyte / macrophage stimulating factor (GM-CSF), or human stem cell factor (SCF) genes. Expression of each gene is driven by a human cytomegalovirus promoter / enhancer sequence followed by a human growth hormone cassette and a polyadenylation (polyA) sequence. The transgenes were microinjected into fertilized C57BL / 6 x C3H / HeN oocytes. The resulting founder carrying all three transgenes (3GS) was backcrossed to BALB / c-scid / scid mice for several generations and then backcrossed to NOD.CB17-prkdcscid mice for at least 11 generations (Nicolini et al., 2004). These mice were bred to NSG mice (NOD.Cg-Prkdc scid Il2rg tm1Wjl ; RRID: IMSR JAX: 005557) and then cross-bred until all offspring were homozygous for the 3GS and the IL2rg targeted mutations. Upon arrival at the Jackson Laboratory, the transgenic mice were bred to NSG mice for one generation to establish NSG-SGM3 mice. NSGF mice were generated using the CRISPR / cas system. Cas9 mRNA and sgRNA targeting mouse Flt3 were co-injected into fertilized NSG oocytes. The resulting founder carrying a deletion of Flt3 was bred to NSG mice and then cross-bred until all offspring were homozygous for the Flt3 targeted mutation. NSG-SGM3 mice were bred to NSGF mice for 2 generations to establish NSG-SGM3-Flt3ko mice. NSG-HLA-A2 / HHD mice carry an HLA-A2 / H2-D / B2M transgene that encodes human B2-microglobulin (B2M) covalently linked to the MHC class I, alpha 1 and alpha 2 binding domains of the human HLA-A2.1 gene and the alpha 3, cytoplasmic and transmembrane domains of murine H2-Db (Pascolo et al., 1997; Shultz et al., 2010). NSG-HLA-A2 / HHD mice were bred to NSG-SGM3F mice for 4 generations to establish NSG-SGM3F-A2 mice.
[0056] Additional materials and methods
[0057] Humanized mice
[0058] Humanized mice were generated on different mouse strains in the NSG background obtained from Jackson Laboratory (Bar Harbor, ME). All protocols were reviewed and approved by the Institutional Animal Care and Use Committee of Jackson Laboratory (14005) and University of Connecticut Health Center (101163-0220 & 101831-0321; Farmington, CT). At 4 weeks of age, mice were sublethally irradiated (10 cGy per gram of body weight) with gamma radiation. 100,000 CD34 + HPCs from fetal livers or term cord blood (Advanced Bioscience Resources or Lonza) were administered by intravenous (IV) injection via tail vein in 200 μΐ, PBS. Alternatively, as indicated, mice received adult CD34 + HPCs from bone marrow (Lonza). Mice were bled 4-12 weeks after HPC transplantation to evaluate engraftment and sacrificed according to individual experimental design.
[0059] Flow cytometry analysis
[0060] Mice were sacrificed and blood was collected with heparin. Bone (femur and tibia), spleen, and lung were collected to prepare single cell suspensions. Spleen was digested with 50 pg / ml of Liberase (Roche Diagnostics, Indianapolis, IN) and 24 U / mL of DNase I (Sigma) for 10 min at 37 °C. Lung was digested with 50 pg / ml of Liberase and 24 U / mL of DNase I (Sigma) for 30 min at 37 °C and then mechanically dissociated with GentleMACS (Miltenyi Biotec). Cells were first treated with a murine Fc block (BD) and then stained with antibody cocktail for 30 min on ice. After two washes with PBS, samples were acquired on LSRII or FACSARIA II (BD) and analyzed with FlowJo software (Tree Star, Ashland, OR). For expression of human HLA-0201, cells were stained with antibodies against mouse CD45-BV421 (30-F11, BD) and human HLA-A2-PE (BB7.2, BD). For human engraftment in blood, cells were stained with antibodies against mouse CD45-BV650 (30-F11, BD) and human CD45-BV510 (HI30, BD), CD33-PE (P67.6, Biolegend), CD14-PE-Cy7 (MqP9, BD), CD19-APC (HIB19, Biolegend), and CD3-APC-H7 (SK7, BD).
[0061] Immunofluorescence staining
[0062] Tissues were embedded in OCT (Sakura Finetek U.S.A.) and snap-frozen in liquid nitrogen. Cryosections were cut at 6 pm, air-dried on Superfrost plus slides and fixed with cold acetone for 5 min. Tissue sections were first treated with 0.03% hyaluronidase (Sigma) for 15 min, then with Background Buster and Fc receptor blocker (Innovex Bioscience). Sections were then stained with monoclonal antibodies against human CD3 (UCHT1, Biolegend), CD11c (S-HCL-3, BD), HLA-A2 (BB7.2, BD), HLA-DR (L243, Biolegend) or pan-cytokeratin (AE1 / AE3, Miltenyi Biotech) for 1 h at room temperature, then with isotype-specific secondary antibodies for 30 min at room temperature. The corresponding isotype antibodies were used as controls. Finally, sections were counterstained with 1 pg / ml of 4',6-diamidino-2-phenylindole (DAPI), mounted with Fluoromount (Thermo Fisher Scientific) and visualized using a Leica SP 8 confocal microscope with Leica LAS AF 2.0 software or a Zeiss Axio fluorescence microscope with ZEN software.
[0063] Statistical analysis
[0064] Statistical analysis was performed in Prism (GraphPad). Mann-Whitney test or two-sided t-test was used to analyze comparisons between any 2 groups. Comparisons between any 3 or more groups were analyzed by analysis of variance (ANOVA).
[0065] Table 1. List of primers used for mouse genotyping.
[0066]
[0067] Sequences
[0068] SEQ ID NO: 1, Flt3 em1Akp
[0069]
[0070] GACGCCCAGTTCACCAAAATGTTCACGCTGAATATAAGAAAGAAACCTCAAGTGCT
[0071] AGCAAATGCCTCAGCCAGCCAGGCGTCCTGTTCCTCTGATGGCTACCCGCTACCCTC
[0072] TTGGACCTGGAAGAAGTGTTCGGACAAATCTCCCAATTGCACGGAGGAAATCCCAG
[0073] AAGGAGTTTGGAATAAAAAGGCTAACAGAAAAGTGTTTGGCCAGTGGGTGTCGAGC
[0074] AGTACTCTAAATATGAGTGAGGCCGGGAAAGGGCTTCTGGTCAAATGCTGTGCGTA
[0075] CAATTCTATGGGCACGTCTTGCGAAACCATCTTTTTAAACTCACCAGGCCCCTTCCC
[0076] TTTCATCCAAGACAACATCTCCTTCTATGCGACCATTGGGCTCTGTCTCCCCTTCATT
[0077] GTTGTTCTCATTGTGTTGATCTGCCACAAATACAAAAAGCAATTTAGGTACGAGAGT
[0078] CAGCTGCAGATGATCCAGGTGACTGGCCCCCTGGATAACGAGTACTTCTACGTTGAC
[0079] TTCAGGGACTATGAATATGACCTTAAGTGGGAGTTCCCGAGAGAGAACTTAGAGTT
[0080] TGGGAAGGTCCTGGGGTCTGGCGCTTTCGGGAGGGTGATGAACGCCACGGCCTATG
[0081] GCATTAGTAAAACGGGAGTCTCAATTCAGGTGGCGGTGAAGATGCTAAAAGAGAAA
[0082] GCTGACAGCTGTGAAAAAGAAGCTCTCATGTCGGAGCTCAAAATGATGACCCACCT
[0083] GGGACACCATGACAACATCGTGAATCTGCTGGGGGCATGCACACTGTCAGGGCCAG
[0084] TGTACTTGATTTTTGAATATTGTTGCTATGGTGACCTCCTCAACTACCTAAGAAGTA
[0085] AAAGAGAGAAGTTTCACAGGACATGGACAGAGATTTTTAAGGAACATAATTTCAGT
[0086] TTTTACCCTACTTTCCAGGCACATTCAAATTCCAGCTTCAGAATGAATTAAATTCCC
[0087] ATTGAACCCTGAGAGCTGATCCAAGGGCGGGTGTAACTGAACTTCTCGTGAACCAG
[0088] GCATGATGAGATTGAATATGAAAACCAGAAGAGGCTGGCAGAAGAAGAGGAGGAA
[0089] GATTTGAACGTGCTGACGTTTGAAGACCTCCTTTGCTTTGCGTACCAAGTGGCCAAA
[0090] GGCATGGAATTCCTGGAGTTCAAGTCGTGTGTCCACAGAGACCTGGCAGCCAGGAA
[0091] TGTGTTGGTCACCCACGGGAAGGTGGTGAAGATCTGTGACTTTGGACTGGCCCGAG
[0092] ACATCCTGAGCGACTCCAGCTACGTCGTCAGGGGCAACGCACGGCTGCCGGTGAAG
[0093] TGGATGGCACCTGAGAGCTTATTTGAAGGGATCTACACAATCAAGAGTGACGTCTG
[0094] GTCCTACGGCATCCTTCTCTGGGAGATATTTTCACTGGGTGTGAACCCTTACCCTGG
[0095] CATTCCTGTCGACGCTAACTTCTATAAACTGATTCAGAGTGGATTTAAAATGGAGCA
[0096] GCCATTCTATGCCACAGAAGGGATATGTATCAGAACATGGGTGGCAACGTCCCAGA
[0097] ACATCCATCCATCTACCAAAACAGGCGGCCCCTCAGCAGAGAGGCAGGCTCAGAGC
[0098] CGCCATCGCCACAGGCCCAGGTGAAGATTCACGGAGAAAGAAGTTAGCGAGGAGG
[0099] CCTTGGACCCCGCCACCCTAGCAGGCTGTAGACCACAGAGCCAAGATTAGCCTCGC
[0100] CTCTGAGGAAGCGCCCTACAGGCCGTTGCTTCGCTGGACTTTTCTCTAGATGCTGTC
[0101] TGCCATTACTCCAAAGTGACTTCTATAAAATCAAACCTCTCCTCGCACAGGTGGGAG
[0102] AGCCAATAATGAGACTTGTTGGTGAGCCCGCCTACCCTGGGGGGCCTTTCCAGGCCC
[0103] CCCAGGCTTGAGGGGAAAGCCATGTATCTGAAATATAGTATATTCTTGTAAATACGTGAAACAAACCAAACCCGTTTTTTGCTAAGGGAAAGCTAAATATGATTTTTAAAAATCTATGTTTTAAAATACTATGTAACTTTTTCATCTATTTAGTGATATATTTTATGGATGGAAATAAACTTTCTACTGTAGAAA
[0104] SEQ ID NO: 2, gRNA for mouse Flt3, 5'-AAGTGCAGCTCGCCACCCCA-3'
[0105] SEQ ID NO: 3-4, PCR primers for mouse Flt3, including 5'-GGTACCAGCAGAGTTGGATAGC-3' (SEQ ID NO: 3) and 5'-ATCCCTTACACAGAAGCTGGAG-3' (SEQ ID NO: 4)
[0106] References
[0107] Aspord, C, Pedroza-Gonzalez, A., Gallegos, M., Tindle, S., Burton, E. C, Su, D., Palucka, A. K. (2007). Breast cancer instructs dendritic cells to prime interleukin 13-secreting CD4+ T cells that facilitate tumor development. J Exp Med, 204(5), 1037-1047. doi:10.1084 / jem.20061120
[0108] Billerbeck, E., Horwitz, J. A., Labitt, R. N., Donovan, B. M., Vega, K., Budell, W. C, Ploss, A. (2013). Characterization of human antiviral adaptive immune responses during hepatotropic virus infection in HLA-transgenic human immune system mice. J Immunol, 191(4), 1753-1764. doi:10.4049 / jimmunol.1201518
[0109] Blunt, T., Finnie, N.J., Taccioli, G.E., Smith, G.C., Demengeot, J., Gottlieb, T.M., Jackson, S.P. (1995). Defective DNA-dependent protein kinase activity is linked to V(D)J recombination and DNA repair defects associated with the murine scid mutation. Cell, 80(5), 813-823. doi:10.1016 / 0092-8674(95)90360-7
[0110] Cao, X., Shores, E.W., Hu-Li, J., Anver, M.R., Kelsall, B.L., Russell, S.M., et al. (1995). Defective lymphoid development in mice lacking expression of the common cytokine receptor gamma chain. Immunity, 2(3), 223-238. doi:10.1016 / 1074-7613(95)90047-0
[0111] Carroll, D. (2011). Genome engineering with zinc-finger nucleases. Genetics, 188(4), 773-782. doi:10.1534 / genetics.111.131433
[0112] Danner, R., Chaudhari, S.N., Rosenberger, J., Surls, J., Richie, T.L., Brumeanu, T.D., & Casares, S. (2011). Expression of HLA class II molecules in humanized NOD.Rag1KO.IL2RgcKO mice is critical for development and function of human T and B cells. PLoS One, 6(5), e19826. doi:10.1371 / journal.pone.0019826
[0113] Deltcheva, E., Chylinski, K., Sharma, C. M., Gonzales, K., Chao, Y., Pirzada, Z. A., Charpentier, E. (2011). CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III. Nature, 471(7340), 602-607. doi:10.1038 / nature09886
[0114] Gaj, T., Gersbach, C. A., & Barbas, C. F., 3rd. (2013). ZFN, TALEN, and CRISPR / Cas-based methods for genome engineering. Trends Biotechnol, 31(7), 397-405. doi:10.1016 / j.tibtech.2013.04.004
[0115] Gordon, J. W., & Ruddle, F. H. (1981). Integration and stable germline transmission of genes injected into mouse pronuclei. Science, 214(4526), 1244-1246. doi:10.1126 / science.6272397
[0116] Gossler, A., Doetschman, T., Korn, R., Serfling, E., & Kemler, R. (1986). Transgenesis by means of blastocyst-derived embryonic stem cell lines. Proc Natl Acad Sci U S A, 83(23), 9065-9069. doi:10.1073 / pnas.83.23.9065
[0117] Greiner, D. L., Hesselton, R. A., & Shultz, L. D. (1998). SCID mouse models of human stem cell engraftment. Stem Cells, 16(3), 166-177. doi:10.1002 / stem.160166
[0118] Hagai, T., Chen, X., Miragaia, R. J., Rostom, R., Gomes, T., Kunowska, N., Teichmann, S. A. (2018). Gene expression variability across cells and species shapes innate immunity. Nature, 563(7730), 197-202. doi:10.1038 / s41586-018-0657-2
[0119] Harms, D. W., Quadros, R. M., Seruggia, D., Ohtsuka, M., Takahashi, G., Montoliu, L., & Gurumurthy, C. B. (2014). Mouse Genome Editing Using the CRISPR / Cas System. Curr Protoc Hum Genet, 83, 15 17 11-27. doi:10.1002 / 0471142905.hg1507s83
[0120] Inui, M., Miyado, M., Igarashi, M., Tamano, M., Kubo, A., Yamashita, S., Takada, S. (2014). Rapid generation of mouse models with defined point mutations by the CRISPR / Cas9 system. Sci Rep, 4, 5396. doi:10.1038 / srep05396
[0121] Jaenisch, R. (1976). Germ line integration and Mendelian transmission of the exogenous Moloney leukemia virus. Proc Natl Acad Sci U S A, 73(4), 1260-1264. doi:10.1073 / pnas.73.4.1260
[0122] Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., & Charpentier, E. (2012). A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science, 337(6096), 816-821. doi:10.1126 / science.1225829
[0123] Joung, J. K., & Sander, J. D. (2013). TALENs: a widely applicable technology for targeted genome editing. Nat Rev Mol Cell Biol, 14(1), 49-55. doi:10.1038 / nrm3486
[0124] Kanazawa, N. (2007). Dendritic cell immunoreceptors: C-type lectin receptors for pattern-recognition and signaling on antigen-presenting cells. J Dermatol Sci, 45(2), 77-86.
[0125] Makino, S., Kunimoto, K., Muraoka, Y., Mizushima, Y., Katagiri, K., & Tochino, Y. (1980). Breeding of a non-obese, diabetic strain of mice. Jikken Dobutsu, 29(1), 1-13. doi:10.1538 / expanim1978.29.1_1
[0126] Matsumura, T., Kametani, Y., Ando, K., Hirano, Y., Katano, I., Ito, R., Habu, S. (2003). Functional CD5+ B cells develop predominantly in the spleen of NOD / SCID / gammac(null) (NOG) mice transplanted either with human umbilical cord blood, bone marrow, or mobilized peripheral blood CD34+ cells. Exp Hematol, 31(9), 789-797.
[0127] Mestas, J., & Hughes, C. C. (2004). Of mice and not men: differences between mouse and human immunology. J Immunol, 172(5), 2731-2738.
[0128] Najima, Y., Tomizawa-Murasawa, M., Saito, Y., Watanabe, T., Ono, R., Ochi, T., Ishikawa, F. (2016). Induction of WT1 -specific human CD8+ T cells from human HSCs in HLA class I Tg NOD / SCID / IL2rgKO mice. Blood, 127(6), 722-734. doi:10.1182 / blood-2014-10-604777
[0129] Nicolini, F. E., Cashman, J. D., Hogge, D. E., Humphries, R. K., & Eaves, C. J. (2004). NOD / SCID mice engineered to express human IL-3, GM-CSF and Steel factor constitutively mobilize engrafted human progenitors and compromise human stem cell regeneration. Leukemia, 18(2), 341-347. doi:10.1038 / sj.leu.2403222
[0130] Pascolo, S., Bervas, N., Ure, J. M., Smith, A. G., Lemonnier, F. A., & Perarnau, B. (1997). HLA-A2.1-restricted education and cytolytic activity of CD8(+) T lymphocytes from beta2 microglobulin (beta2m) HLA-A2.1 monochain transgenic H-2Db beta2m double knockout mice. J Exp Med, 185(12), 2043-2051. doi:10.1084 / jem.185.12.2043
[0131] Pedroza-Gonzalez, A., Xu, K., Wu, T. C., Aspord, C., Tindle, S., Marches, F., Palucka, A. K. (2011). Thymic stromal lymphopoietin fosters human breast tumor growth by promoting type 2 inflammation. J Exp Med, 208(3), 479-490. doi:10.1084 / jem.20102131
[0132] Shultz, L. D., Brehm, M. A., Garcia-Martinez, J. V., & Greiner, D. L. (2012). Humanized mice for immune system investigation: progress, promise and challenges. Nat Rev Immunol, 12(11), 786-798. doi:10.1038 / nri3311
[0133] Shultz, L. D., Ishikawa, F., & Greiner, D. L. (2007). Humanized mice in translational biomedical research. Nat Rev Immunol, 7(2), 118-130. doi:10.1038 / nri2017
[0134] Shultz, L. D., Lyons, B. L., Burzenski, L. M., Gott, B., Chen, X., Chaleff, S., Handgretinger, R. (2005). Human lymphoid and myeloid cell development in NOD / LtSz-scid IL2R gamma null mice engrafted with mobilized human hemopoietic stem cells. J Immunol, 174(10), 6477-6489. doi:10.4049 / jimmunol.174.10.6477
[0135] Shultz, L. D., Saito, Y., Najima, Y., Tanaka, S., Ochi, T., Tomizawa, M., Ishikawa, F. (2010). Generation of functional human T-cell subsets with HLA-restricted immune responses in HLA class I expressing NOD / SCID / IL2r gamma(null) humanized mice. Proc Natl Acad Sci U S A, 107(29), 13022-13027. doi:10.1073 / pnas.1000475107
[0136] Shultz, L. D., Schweitzer, P. A., Christianson, S. W., Gott, B., Schweitzer, I. B., Tennent, B., et al. (1995). Multiple defects in innate and adaptive immunologic function in NOD / LtSz-scid mice. J Immunol, 154(1), 180-191.
[0137] Takaki, T., Marron, M. P., Mathews, C. E., Guttmann, S. T., Bottino, R., Trucco, M., Serreze, D. V. (2006). HLA-A*0201 -restricted T cells from humanized NOD mice recognize autoantigens of potential clinical relevance to type 1 diabetes. J Immunol, 176(5), 3257-3265. doi: 10.4049 / jimmunol.176.5.3257
[0138] Theocharides, A. P., Rongvaux, A., Fritsch, K., Flavell, R. A., & Manz, M. G. (2016). Humanized hemato-lymphoid system mice. Haematologica, 101(1), 5-19. doi: 10.3324 / haematol.2014.115212
[0139] Traggiai, E., Chicha, L., Mazzucchelli, L., Bronz, L., Piffaretti, J. C., Lanzavecchia, A., & Manz, M. G. (2004). Development of a human adaptive immune system in cord blood cell-transplanted mice. Science, 304(5667), 104-107. doi: 10.1126 / science.1093933
[0140] Victor Garcia, J. (2016). Humanized mice for HIV and AIDS research. Curr Opin Virol, 19, 56-64. doi:10.1016 / j.coviro.2016.06.010
[0141] Williams, A., Flavell, R. A., & Eisenbarth, S. C. (2010). The role of NOD-like Receptors in shaping adaptive immunity. Curr Opin Immunol, 22(1), 34-40. doi:10.1016 / j.coi.2010.01.004
[0142] Wu, T. C., Xu, K., Banchereau, R., Marches, F., Yu, C. I., Martinek, J., Palucka, K. (2014). Reprogramming tumor-infiltrating dendritic cells for CD103+CD8+ mucosal T-cell differentiation and breast cancer rejection. Cancer Immunol Res, 2(5), 487-500. doi:10.1158 / 2326-6066.CIR-13-0217
[0143] Wu, T. C., Xu, K., Martinek, J., Young, R. R., Banchereau, R., George, J., Palucka, A. K. (2018). IL1 Receptor Antagonist Controls Transcriptional Signature of Inflammation in Patients with Metastatic Breast Cancer. Cancer Res, 78(18), 5243-5258. doi:10.1158 / 0008-5472.CAN-18-0413
[0144] Wunderlich, M., Chou, F.S., Link, K.A., Mizukawa, B., Perry, R.L., Carroll, M., & Mulloy, J.C. (2010). AML xenograft efficiency is significantly improved in NOD / SCID-IL2RG mice constitutively expressing human SCF, GM-CSF and IL-3. Leukemia, 24(10), 1785-1788. doi:10.1038 / leu.2010.158
[0145] Yu, C.I., Gallegos, M., Marches, F., Zurawski, G., Ramilo, O., Garcia-Sastre, A., Palucka, A.K. (2008). Broad influenza-specific CD8+ T-cell responses in humanized mice vaccinated with influenza virus vaccines. Blood, 112(9), 3671-3678. doi:10.1182 / blood-2008-05-157016
[0146] Zhang, L., & Su, L. (2012). HIV-1 immunopathogenesis in humanized mouse models. Cell Mol Immunol, 9(3), 237-244. doi:10.1038 / cmi.2012.7
[0147] All references, patents and patent applications disclosed herein are incorporated by reference with respect to their respective cited subject matter, which in some cases can include the entire contents of the document.
[0148] The indefinite articles "a" and "an," as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean "at least one."
[0149] It will be further understood that, unless explicitly stated otherwise, in any method claimed herein that includes more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts are recited.
[0150] In the claims, as well as in the specification above, all transitional phrases such as "comprising," "including," "carrying," "having," "containing," "involving," "holding," "composed of," and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases "consisting of" and "consisting essentially of" are closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03.
[0151] The terms "about" and "substantially" preceding a numerical value mean ±10% of the numerical value.
[0152] Where a range of values is provided, each intervening value, to the tenth of the unit of the lower limit unless the context clearly indicates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range is contemplated in this embodiment.
Claims
1. A method of producing a non-obese diabetic (NOD) mouse comprising: an inactivated mouse Prkdc allele; an inactivated mouse IL2rg allele; an inactivated mouse Flt3 allele; a nucleic acid encoding human interleukin 3 (IL3); a nucleic acid encoding human granulocyte / macrophage stimulating factor (GM-CSF); a nucleic acid encoding human stem cell factor (SCF); and a nucleic acid encoding human B2-microglobulin (B2M) covalently linked to the MHC class I, alpha 1 and alpha 2 binding domains of the human HLA-A2.1 gene and the alpha 3, cytoplasmic and transmembrane domains of murine H2-Db (HLA-A2 / H2-D / B2M), the method comprising introducing the transgene encoding HLA-A2 / H2-D / B2M into a NOD scid gamma mouse comprising an inactivated mouse Flt3 allele, a nucleic acid encoding human interleukin 3 (IL3), a nucleic acid encoding human granulocyte / macrophage stimulating factor (GM-CSF) and a nucleic acid encoding human stem cell factor (SCF).
2. A method of producing a non-obese diabetic (NOD) mouse comprising: an inactivated mouse Prkdc allele; an inactivated mouse IL2rg allele; an inactivated mouse Flt3 allele; a nucleic acid encoding human interleukin 3 (IL3); a nucleic acid encoding human granulocyte / macrophage stimulating factor (GM-CSF); a nucleic acid encoding human stem cell factor (SCF); and a nucleic acid encoding human B2-microglobulin (B2M) covalently linked to the MHC class I, alpha 1 and alpha 2 binding domains of the human HLA-A2.1 gene and the alpha 3, cytoplasmic and transmembrane domains of murine H2-Db (HLA-A2 / H2-D / B2M), the method comprising crossing an NSG-SGM3F mouse comprising a nucleic acid encoding human interleukin 3 (IL3), a nucleic acid encoding human granulocyte / macrophage stimulating factor (GM-CSF), a nucleic acid encoding human stem cell factor (SCF) and an inactivated mouse Flt3 allele with an NSG-HLA-A2 / HHD mouse comprising a transgene encoding human B2-microglobulin (B2M) covalently linked to the MHC class I, alpha 1 and alpha 2 binding domains of the human HLA-A2.1 gene and the alpha 3, cytoplasmic and transmembrane domains of murine H2-Db.
3. A method of producing a non-obese diabetic (NOD) mouse comprising: an inactivated mouse Prkdc allele; an inactivated mouse IL2rg allele; an inactivated mouse Flt3 allele; a nucleic acid encoding human interleukin 3 (IL3); a nucleic acid encoding human granulocyte / macrophage stimulating factor (GM-CSF); a nucleic acid encoding human stem cell factor (SCF); and a nucleic acid encoding human B2-microglobulin (B2M) covalently linked to the MHC class I, alpha 1 and alpha 2 binding domains of the human HLA-A2.1 gene and the alpha 3, cytoplasmic and transmembrane domains of murine H2-Db (HLA-A2 / H2-D / B2M), the method comprising crossing an NSG-SGM3F mouse comprising a nucleic acid encoding human interleukin 3 (IL3), a nucleic acid encoding human granulocyte / macrophage stimulating factor (GM-CSF), a nucleic acid encoding human stem cell factor (SCF) and an inactivated mouse Flt3 allele with an NSG-HLA-A2 / HHD mouse comprising a transgene encoding human B2-microglobulin (B2M) covalently linked to the MHC class I, alpha 1 and alpha 2 binding domains of the human HLA-A2.1 gene and the alpha 3, cytoplasmic and transmembrane domains of murine H2-Db. a nucleic acid encoding human B2-microglobulin (B2M) covalently linked to the MHC class I, alpha 1 and alpha 2 binding domains of the human HLA-A2.1 gene and the alpha 3, cytoplasmic and transmembrane domains of murine H2-Db (HLA-A2 / H2-D / B2M), The method comprises: (a) developing a founder mouse having a NOD scid gamma genetic background, an inactivated mouse Flt3 allele, a nucleic acid encoding human IL3, a nucleic acid encoding human GM-CSF and a nucleic acid encoding human SCF; (b) breeding the founder mouse with a NOD scid gamma mouse comprising a transgene encoding human B2 microglobulin (B2M) covalently linked to the MHC class I, alpha 1 and alpha 2 binding domains of the human HLA-A2.1 gene and the alpha 3, cytoplasmic and transmembrane domains of murine H2-Db to produce Fl offspring mice; and (c) interbreeding the Fl offspring mice to produce F2 offspring mice homozygous for the inactivated Flt3 allele, a nucleic acid encoding human interleukin 3 (IL3), a nucleic acid encoding human granulocyte / macrophage stimulating factor (GM-CSF), a nucleic acid encoding human stem cell factor (SCF) and a transgene encoding human B2-microglobulin (B2M) covalently linked to the MHC class I, alpha 1 and alpha 2 binding domains of the human HLA-A2.1 gene and the alpha 3, cytoplasmic and transmembrane domains of murine H2-Db.
4. The method of any one of claims 1-3, wherein the non-obese diabetic (NOD) mouse is a NOD.Cg-Prkdc scid Il2rg tm1Wjl / SzJ (NOD scid gamma) mouse.
5. The method of any one of claims 1-3, wherein the non-obese diabetic (NOD) mouse has been irradiated, transplanted with human hematopoietic progenitor cells (HPCs), and the human HPCs are transplanted as human CD45+ cells.
6. The method of claim 4, wherein the non-obese diabetic (NOD) mouse has been irradiated, transplanted with human hematopoietic progenitor cells (HPCs), and the human HPCs are transplanted as human CD45+ cells.
7. The method of claim 5, wherein the human HPCs are from fetal liver, umbilical cord blood or bone marrow and the transplanted human CD45 + cells in the non-obese diabetic (NOD) mouse comprise a mixed population of CD19 + B cells, CD33 + myeloid cells and CD3 + T cells.
8. The method of claim 5, wherein the human HPCs are from fetal liver, umbilical cord blood or bone marrow and the lung tissue of the non-obese diabetic (NOD) mouse comprises CD3 + T cells and HLA-DR + CD11c + Dendritic cells.
9. The method of claim 5, wherein the human HPCs are HLA-A2 + and the non-obese diabetic (NOD) mice comprise HLA-A2 + mouse thymic epithelial cells.
10. A method comprising breeding Prkdc scid homozygous, Il2rg tm1Wjl homozygous, Flt3 em1Akp homozygous, Il-3 homozygous, GM-CSF homozygous, SCF homozygous, and transgene homozygous for HLA-A2 / H2-D / B2M female mice with Prkdc scid homozygous, X-linked Il2rg tm1Wjl heterozygous, Flt3 em1Akp homozygous, Il-3 homozygous, GM-CSF homozygous, SCF homozygous, and transgene homozygous for HLA-A2 / H2-D / B2M male mice to produce offspring mice.
11. A cell obtained from a mouse produced by the method of any one of the preceding claims.
12. A method of breeding a mouse produced by the method of any one of the preceding claims 1-10.
13. The method of claim 12, comprising breeding a mouse produced by the method of any one of the preceding claims 1-10 with a second mouse to produce an offspring mouse.
14. The method of claim 13, wherein the second mouse is a mouse produced by the method of any one of the preceding claims 1-10.
15. A method comprising sub-lethally irradiating a non-obese diabetic (NOD) mouse produced by the method of any one of claims 1-10 to produce an irradiated mouse.
16. The method of claim 15, further comprising administering human hematopoietic progenitor cells (HPCs) to the non-obese diabetic (NOD) mouse.
17. The method of claim 15 or 16, further comprising administering a drug of interest to the non-obese diabetic (NOD) mouse, wherein the method is for non-therapeutic purposes.
18. The method of claim 17, further comprising assessing the effect of the agent on human immune cells in the non-obese diabetic (NOD) mouse.
19. The method of claim 18, wherein the human immune cells are selected from T cells, dendritic cells, natural killer cells, and macrophages.
Citation Information
Patent Citations
Sodium enalapril complex and the use thereof to make sodium enalapril
US5637730A
High efficiency, high throughput generation of genetically modified mammals by electroporation
WO2016054032A1
Genetically modified non-human mammals by multi-cycle electroporation of CAS9 protein
WO2017124086A1
Cells with improved immunomodulatory properties and methods of use and production thereof
CN112481211A
Transgenic mouse model supporting human innate immune function
CN115997017A