Lipid compounds and lipid nanoparticle compositions
By combining lipid compounds with other lipid components to form lipid nanoparticles, the low permeability and degradation problems of nucleic acid therapeutics are solved, effective nucleic acid delivery and expression are achieved, and it is suitable for the treatment of various diseases.
Patent Information
- Application Number
- CN202280006971.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2021-10-08
- Filing Date
- 2022-01-11
- Publication Date
- 2025-10-17
- Estimated Expiration
- 2042-01-11
AI Technical Summary
Existing nucleic acid therapeutics face the problems of low cell permeability and high sensitivity to degradation of nucleic acid molecules such as RNA, necessitating the development of new lipid compounds to achieve effective in vivo delivery and expression.
Lipid compounds are provided for combination with neutral lipids, charged lipids, steroids, and polymers to form lipid nanoparticles for the delivery of nucleic acid molecules such as locked nucleic acids, peptide nucleic acids, and morpholino nucleic acids, promoting encapsulation and delivery through the interaction of cationic lipids with negatively charged molecules.
It improves the cell permeability and stability of nucleic acid molecules, achieves effective in vivo delivery and expression, and is suitable for the treatment of various diseases.
Smart Images

Figure BDA0004181048750000021 
Figure BDA0004181048750000291 
Figure BDA0004181048750000311
Abstract
Description
[0001] 1. SEQUENCE LISTING
[0002] The instant specification is filed with a computer readable format (CRF) copy of the sequence listing. The CRF is entitled 14639-019-146_SeqListing_ST25.txt, was created on December 20, 2021, is 627 bytes in size, and is hereby incorporated by reference in its entirety. 2. TECHNICAL FIELD
[0004] The present disclosure relates generally to lipid compounds that can be used in combination with other lipid components, such as neutral lipids, cholesterol, and polymer-conjugated lipids, to form lipid nanoparticles for the delivery of therapeutic agents, such as nucleic acid molecules, including nucleic acid mimics, such as locked nucleic acids (LNAs), peptide nucleic acids (PNAs), and morpholinos, in vitro and in vivo for therapeutic or prophylactic purposes, including vaccination. 3. BACKGROUND
[0006] Therapeutic nucleic acids have the potential to revolutionize vaccination, gene therapy, protein replacement therapy, and other genetic disease treatment methods. Since the first clinical studies of therapeutic nucleic acids began in the 2000s, significant progress has been made in the design of nucleic acid molecules and methods for their delivery. However, nucleic acid therapeutics still face several challenges, including low cellular penetration and high susceptibility to degradation of certain nucleic acid molecules, including RNA. Thus, there remains a need to develop new nucleic acid molecules, as well as related methods and compositions that facilitate the in vitro or in vivo delivery of nucleic acid molecules for therapeutic and / or prophylactic purposes. Lipid compounds can be used in combination with other lipid components, such as neutral lipids, cholesterol, and polymer-conjugated lipids, to form lipid nanoparticles for the delivery of therapeutic agents. There is a need to develop new lipid compounds (e.g., cationic lipid compounds) that provide efficient delivery of therapeutic agents, sufficient activity of the therapeutic agents (e.g., expression of mRNA after delivery), optimal pharmacokinetics, and / or other suitable physiological, biological, and / or therapeutic properties. 4. SUMMARY
[0008] In one embodiment, provided herein are lipid compounds, including pharmaceutically acceptable salts, prodrugs, or stereoisomers thereof, which can be used alone or in combination with other lipid components, such as neutral lipids, charged lipids, steroids (including, for example, all solid sterols) and / or analogs and / or polymers thereof, to form lipid nanoparticles for delivery of therapeutic agents, such as nucleic acid molecules, including nucleic acid mimics, such as locked nucleic acids (LNAs), peptide nucleic acids (PNAs), and morpholino nucleic acids. In some cases, the lipid nanoparticles are used to deliver nucleic acids, such as antisense and / or messenger RNAs. Also provided are methods of using such lipid nanoparticles to treat various diseases or conditions, such as diseases or conditions caused by infectious agents and / or protein deficiencies.
[0009] In one embodiment, provided herein is a compound of Formula (I):
[0010]
[0011] or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof, wherein G 1 , G 2 , G 3 , L 1 , L 2 , R 3 , R 4 , n and m are as defined herein or elsewhere.
[0012] In one embodiment, provided herein is a nanoparticle composition comprising a compound provided herein and a therapeutic or prophylactic agent. In one embodiment, the therapeutic or prophylactic agent comprises at least one mRNA encoding an antigen or fragment or epitope thereof.
[0013] Additional features of the disclosure will be apparent to those of ordinary skill in the art in view of the following detailed description of specific embodiments. 5. DETAILED DESCRIPTION
[0015] 5.1 General Techniques
[0016] The techniques and procedures described or referenced herein include techniques and procedures that are generally well understood and / or routinely practiced by those skilled in the art, such as those generally described in Sambrook et al., Molecular Cloning: A Laboratory Manual (3rd ed., 2001); Current Protocols in Molecular Biology (Ausubel et al. eds., 2003).
[0017] 5.2 Terminology
[0018] Unless otherwise described, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. For purposes of interpreting this specification, the following terms will have the below-described meanings, and the meanings detected below will be applied even if not expressly included in the following description of the terms. All patents, applications, published applications and other publications are incorporated by reference in their entirety. In the event that any description of a term conflicts with any document incorporated herein by reference, the description set forth below shall control.
[0019] The term "lipid," as used herein and unless otherwise specified, refers to a group of organic compounds that includes, but is not limited to, fatty acid esters, and is generally characterized by poor solubility in water but solubility in many nonpolar organic solvents. While lipids generally have weak water solubility, certain classes of lipids (e.g., lipids modified with polar groups, such as DMG-PEG2000) have limited water solubility and are soluble in water under certain conditions. Known lipid types include biomolecules such as fatty acids, waxes, sterols, fat-soluble vitamins, monoglycerides, diglycerides, triglycerides, and phospholipids. Lipids can be classified into at least three categories: (1) "simple lipids" including fats and oils, and waxes; (2) "compound lipids" including phospholipids and glycolipids (e.g., DMPE-PEG2000); and (3) "derived lipids" such as sterol-like compounds. In addition, as used herein, lipids also include lipid-like compounds. The term "lipid-like compound" or simply "lipid-like," refers to a lipid-like compound (e.g., an amphiphilic compound having lipid-like physical properties).
[0020] The term "lipid nanoparticle" or "LNP" refers to a particle having at least one dimension in the nanometer (nm) scale (e.g., 1 to 1,000 nm) that contains one or more types of lipid molecules. The LNPs provided herein can further contain at least one non-lipid payload molecule (e.g., one or more nucleic acid molecules). In some embodiments, the LNP comprises a non-lipid payload molecule that is partially or completely encapsulated within a lipid shell. In particular, in some embodiments, where the payload is a negatively charged molecule (e.g., an mRNA encoding a viral protein), and the lipid component of the LNP comprises at least one cationic lipid. Without being bound by theory, it is contemplated that the cationic lipid can interact with the negatively charged payload molecule and facilitate payload incorporation and / or encapsulation into the LNP during LNP formation. Other lipids that can form part of the LNP as provided herein include, but are not limited to, neutral lipids and charged lipids, such as sterols, polymer-conjugated lipids, and various zwitterionic lipids. In certain embodiments, the LNP according to the present disclosure comprises one or more lipids of Formula (I) (and subformulae thereof) as described herein.
[0021] The term "cationic lipid" refers to a lipid that is positively charged at any pH value or hydrogen ion activity of its environment, or that is capable of becoming positively charged in response to the pH value or hydrogen ion activity of its environment, e.g., the environment of its intended use. Thus, the term "cationic" encompasses "permanent cationic" and "cationizable." In certain embodiments, the positive charge in a cationic lipid arises from the presence of a quaternary nitrogen atom. In certain embodiments, the cationic lipid comprises a zwitterionic lipid that is positively charged in the environment of its intended use, e.g., at physiological pH. In certain embodiments, the cationic lipid is one or more lipids of Formula (I) (and subformulae thereof) as described herein.
[0022] The term "polymer-conjugated lipid" refers to a molecule that comprises both a lipid moiety and a polymer moiety. An example of a polymer-conjugated lipid is a PEGylated lipid (PEG-lipid), wherein the polymer moiety comprises polyethylene glycol.
[0023] The term "neutral lipid" encompasses any lipid molecule that exists in uncharged form or in a neutral zwitterionic form at a selected pH value or within a selected pH range. In some embodiments, the selected useful pH value or range corresponds to the pH conditions in the environment of the intended lipid use, such as physiological pH. As non-limiting examples, neutral lipids that can be used in conjunction with the present disclosure include, but are not limited to, phosphatidylcholines such as 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC); phosphatidylethanolamines such as 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 2-((2,3-bis(octyloxy)propyl))dimethylammonio)ethyl hydrogen phosphate (DOCP); sphingomyelin (SM); ceramides; steroids such as sterols and derivatives thereof. The neutral lipids provided herein can be synthetic or derived from natural sources or compounds (isolated or modified therefrom).
[0024] The term“charged lipid” encompasses any lipid molecule that exists in a positively or negatively charged form at a selected pH value or within a selected pH range. In some embodiments, the selected pH value or range corresponds to the pH conditions in the environment for which a predetermined lipid use is intended, such as a physiological pH value. By way of non-limiting example, charged lipids that can be used in conjunction with the present disclosure include, but are not limited to, phosphatidylserine, phosphatidic acid, phosphatidylglycerol, phosphatidylinositol, a sterol hemisuccinate, dialkyi trimethylammonium-propane (e.g., DOTAP, DOTMA), dialkyldimethylaminopropane, ethylphosphocholine, dimethylaminoethane carbamoyl sterol (e.g., DC-Chol), 1,2-dioleoyl-sn-glycero-3-phospho-L-serine sodium salt (DOPS-Na), 1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycero) sodium salt (DOPG-Na), and 1,2-dioleoyl-sn-glycero-3-phospho sodium salt (DOPA-Na). The charged lipids provided herein can be synthetic or derived from a natural source or compound (isolated or modified therefrom).
[0025] The term“alkyl,” as used herein and unless otherwise indicated, refers to a saturated straight chain or branched chain hydrocarbon chain radical. In one embodiment, the alkyl group has, for example, one to twenty-four carbon atoms (C1-C 24 alkyl), four to twenty carbon atoms (C4-C 20 alkyl), six to sixteen carbon atoms (C6-C 16 alkyl), six to nine carbon atoms (C6-C9 alkyl), one to fifteen carbon atoms (C1-C 15 alkyl), one to twelve carbon atoms (C1-C 12 alkyl), one to eight carbon atoms (C1-C8 alkyl), or one to six carbon atoms (C1-C6 alkyl) and which is attached to the rest of the molecule by a single bond. Examples of alkyl include, but are not limited to, methyl, ethyl, n-propyl, 1-methylethyl (iso-propyl), n-butyl, n-pentyl, 1,1-dimethylethyl (tert-butyl), 3-methylhexyl, 2-methylhexyl, and the like. Unless otherwise indicated, alkyl groups are optionally substituted.
[0026] The term“alkenyl,” as used herein and unless otherwise indicated, refers to a straight chain or branched chain hydrocarbon chain radical that contains one or more carbon-carbon double bonds and which is attached to the rest of the molecule by a single bond. Those skilled in the art will recognize that the term“alkenyl” also encompasses radicals having“cis” and“trans” configurations, or having“E” and“Z” configurations. In one embodiment, the alkenyl group has, for example, two to twenty-four carbon atoms (C2-C 24 alkenyl), four to twenty carbon atoms (C4-C 20 alkenyl), six to sixteen carbon atoms (C6-C 16alkenyl), two to twelve carbon atoms (C2-C12alkenyl), two to eight carbon atoms (C2-C8alkenyl), or two to six carbon atoms (C2-C6alkenyl) and which is attached to the rest of the molecule by a single bond. Examples of alkenyl include, but are not limited to, ethenyl, prop-1 -enyl, but-1 -enyl, pent-1 -enyl, pent-1,4-dienyl, and the like. Unless stated otherwise, alkenyl groups are optionally substituted. 15 alkenyl), two to twelve carbon atoms (C2-C12alkenyl), two to eight carbon atoms (C2-C8alkenyl), or two to six carbon atoms (C2-C6alkenyl) and which is attached to the rest of the molecule by a single bond. Examples of alkenyl include, but are not limited to, ethenyl, prop-1 -enyl, but-1 -enyl, pent-1 -enyl, pent-1,4-dienyl, and the like. Unless stated otherwise, alkenyl groups are optionally substituted. 12 alkenyl), two to twelve carbon atoms (C2-C12alkenyl), two to eight carbon atoms (C2-C8alkenyl), or two to six carbon atoms (C2-C6alkenyl) and which is attached to the rest of the molecule by a single bond. Examples of alkenyl include, but are not limited to, ethenyl, prop-1 -enyl, but-1 -enyl, pent-1 -enyl, pent-1,4-dienyl, and the like. Unless stated otherwise, alkenyl groups are optionally substituted.
[0027] The term "alkynyl," as used herein and unless otherwise indicated, refers to a straight or branched chain hydrocarbon chain radical group consisting only of carbon and hydrogen atoms, which contains one or more carbon-carbon triple bonds. In one embodiment, the alkynyl group has, for example, two to twenty-four carbon atoms (C2-C 24 alkynyl), four to twenty carbon atoms (C4-C 20 alkynyl), six to sixteen carbon atoms (C6-C 16 alkynyl), six to nine carbon atoms (C6-C9alkynyl), two to fifteen carbon atoms (C2-C 15 alkynyl), two to twelve carbon atoms (C2-C 12 alkynyl), two to eight carbon atoms (C2-C8alkynyl), or two to six carbon atoms (C2-C6alkynyl) and which is attached to the rest of the molecule by a single bond. Examples of alkynyl include, but are not limited to, ethynyl, propynyl, butynyl, pentynyl, and the like. Unless stated otherwise, alkynyl groups are optionally substituted.
[0028] The term "alkylene" or "alkylene chain," as used herein and unless otherwise indicated, refers to a straight or branched chain polyvalent (e.g., divalent or trivalent) hydrocarbon chain linking the rest of the molecule to one or more groups, which consists solely of carbon and hydrogen, and is saturated. In one embodiment, the alkylene has, for example, one to twenty-four carbon atoms (C1-C 24 alkylene), one to fifteen carbon atoms (C1-C 15 alkylene), one to twelve carbon atoms (C1-C 12 alkylene), one to eight carbon atoms (C1-C8alkylene), one to six carbon atoms (C1-C6alkylene), two to four carbon atoms (C2-C4alkylene), one to two carbon atoms (C1-C2alkylene). Examples of alkylene include, but are not limited to, methylene, ethylene, propylene, n-butylene, and the like. The alkylene chain is attached to the rest of the molecule via a single bond, and to the group(s) via a single bond. The points of attachment of the alkylene chain to the rest of the molecule and to the group(s) can be through one carbon, or any two (or more) carbons within the chain. Unless stated otherwise, alkylene chains are optionally substituted.
[0029] As used herein and unless otherwise indicated, the term "alkenylene" refers to a straight or branched multivalent (e.g., divalent or trivalent) hydrocarbon chain that connects the remainder of the molecule to one or more groups, consisting solely of carbon and hydrogen and containing one or more carbon-carbon double bonds. In one embodiment, an alkenylene group has, for example, two to twenty-four carbon atoms (C2-C 24 alkenyl), two to fifteen carbon atoms (C2-C 15 alkenyl), two to twelve carbon atoms (C2-C 12 Alkenylene is a 1- to 2-carbon group, having two to eight carbon atoms (C-C alkenylene), two to six carbon atoms (C-C alkenylene), or two to four carbon atoms (C-C alkenylene). Examples of alkenylene include, but are not limited to, vinylene, propenylene, n-butenylene, and the like. Alkenylene is attached to the rest of the molecule via a single or double bond and to a radical via a single or double bond. The point of attachment of an alkenylene to the rest of the molecule and to one or more radicals may be through one carbon or any two (or more) carbons within the chain. Unless otherwise indicated, an alkenylene is optionally substituted.
[0030] As used herein and unless otherwise indicated, the term "cycloalkyl" refers to a non-aromatic saturated monocyclic or polycyclic hydrocarbon radical consisting solely of carbon and hydrogen atoms. Cycloalkyl groups may include fused or bridged ring systems. In one embodiment, a cycloalkyl group has, for example, 3 to 15 ring carbon atoms (C3-C4). 15 cycloalkyl), 3 to 10 ring carbon atoms (C3-C 10 The cycloalkyl radical is a cycloalkyl radical having 3 to 8 ring carbon atoms (C3-C8 cycloalkyl). The cycloalkyl radical is connected to the rest of the molecule by a single bond. Examples of monocyclic cycloalkyl radicals include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. Examples of polycyclic cycloalkyl radicals include, but are not limited to, adamantyl, norbornyl, decahydronaphthyl, 7,7-dimethyl-bicyclo[2.2.1]heptyl, and the like. Unless otherwise indicated, cycloalkyl radicals are optionally substituted.
[0031] As used herein, and unless otherwise specified, the term "cycloalkylene" is a multivalent (e.g., divalent or trivalent) cycloalkyl group. Unless otherwise specified, a cycloalkylene group is optionally substituted.
[0032] As used herein and unless otherwise indicated, the term "cycloalkenyl" refers to a non-aromatic monocyclic or polycyclic hydrocarbon radical consisting solely of carbon and hydrogen atoms and including one or more carbon-carbon double bonds. Cycloalkenyl groups may include fused or bridged ring systems. In one embodiment, a cycloalkenyl group has, for example, 3 to 15 ring carbon atoms (C3-C 15 cycloalkenyl), 3 to 10 ring carbon atoms (C3-C 10The cycloalkenyl group is a cycloalkyl group (C-C) or 3 to 8 ring carbon atoms (C-C). The cycloalkenyl group is connected to the rest of the molecule by a single bond. Examples of monocyclic cycloalkenyl groups include, but are not limited to, cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclohexenyl, cycloheptenyl, cyclooctenyl, and the like. Unless otherwise indicated, the cycloalkenyl group is optionally substituted.
[0033] As used herein, and unless otherwise specified, the term "cycloalkenylene" is a multivalent (e.g., divalent or trivalent) cycloalkenyl group. Unless otherwise specified, a cycloalkenylene group is optionally substituted.
[0034] As used herein and unless otherwise indicated, the term "heterocyclyl" refers to a non-aromatic monocyclic or polycyclic moiety containing one or more (e.g., one, one or two, one to three, or one to four) heteroatoms independently selected from nitrogen, oxygen, phosphorus, and sulfur. The heterocyclyl group may be attached to the main structure at any heteroatom or carbon atom. The heterocyclyl group may be a monocyclic, bicyclic, tricyclic, tetracyclic, or other polycyclic ring system, wherein the polycyclic ring system may be a fused, bridged, or spirocyclic ring system. The heterocyclyl polycyclic ring system may contain one or more heteroatoms in one or more rings. The heterocyclyl group may be saturated or partially unsaturated. Saturated heterocycloalkyl groups may be referred to as "heterocycloalkyl." Partially unsaturated heterocycloalkyl groups may be referred to as "heterocycloalkenyl" when the heterocyclyl group contains at least one double bond, or as "heterocycloalkynyl" when the heterocyclyl group contains at least one triple bond. In one embodiment, the heterocyclyl group has, for example, 3 to 18 ring atoms (3 to 18-membered heterocyclyl), 4 to 18 ring atoms (4 to 18-membered heterocyclyl), 5 to 18 ring atoms (3 to 18-membered heterocyclyl), 4 to 8 ring atoms (4 to 8-membered heterocyclyl), or 5 to 8 ring atoms (5 to 8-membered heterocyclyl). When appearing herein, a numerical range such as "3 to 18" refers to each integer in the given range; for example, "3 to 18 ring atoms" means that the heterocyclyl group can consist of 3 ring atoms, 4 ring atoms, 5 ring atoms, 6 ring atoms, 7 ring atoms, 8 ring atoms, 9 ring atoms, 10 ring atoms, etc. (up to and including 18 ring atoms). Examples of heterocyclic groups include, but are not limited to, imidazolyl, imidazolidinyl, oxazolyl, oxazolidinyl, thiazolyl, thiazolidinyl, pyrazolidinyl, pyrazolyl, isoxazolidinyl, isoxazolyl, isothiazolidinyl, isothiazolyl, morpholinyl, pyrrolyl, pyrrolidinyl, furanyl, tetrahydrofuranyl, thienyl, pyridyl, piperidinyl, quinolyl, and isoquinolyl. Unless otherwise specified, heterocyclic groups are optionally substituted.
[0035] As used herein, and unless otherwise specified, the term "heterocyclylene" is a polyvalent (e.g., divalent or trivalent) heterocyclyl group. Unless otherwise specified, a heterocyclylene group is optionally substituted.
[0036] As used herein and unless otherwise indicated, the term "aryl" refers to a monocyclic aromatic group and / or a polycyclic monovalent aromatic group containing at least one aromatic hydrocarbon ring. In certain embodiments, an aryl group has 6 to 18 ring carbon atoms (C6-C 18 aryl), 6 to 14 ring carbon atoms (C6-C 14 aryl), or 6 to 10 ring carbon atoms (C6-C 10 aryl). Examples of aryl groups include, but are not limited to, phenyl, naphthyl, fluorenyl, azulenyl, anthryl, phenanthryl, pyrenyl, biphenyl, and terphenyl. The term "aryl" also refers to bicyclic, tricyclic, or other polycyclic hydrocarbon rings in which at least one ring is aromatic and the other rings can be saturated, partially unsaturated, or aromatic, such as indanyl, indenyl, dihydroindenyl, or tetrahydronaphthyl / tetralinyl. Unless otherwise specified, aryl groups are optionally substituted.
[0037] As used herein and unless otherwise indicated, the term "arylene" is a polyvalent (e.g., divalent or trivalent) aryl group. Unless otherwise specified, arylene groups are optionally substituted.
[0038] As used herein and unless otherwise indicated, the term "heteroaryl" refers to a monocyclic aromatic group and / or a polycyclic aromatic group containing at least one aromatic ring, wherein at least one aromatic ring contains one or more (e.g., one, one or two, one to three, or one to four) heteroatoms independently selected from O, S, and N. A heteroaryl group can be attached to the main structure at any heteroatom or carbon atom. In certain embodiments, a heteroaryl group has 5 to 20, 5 to 15, or 5 to 10 ring atoms. The term "heteroaryl" also refers to bicyclic, tricyclic, or other polycyclic rings in which at least one ring is aromatic and the other rings can be saturated, partially unsaturated, or aromatic, wherein at least one aromatic ring contains one or more heteroatoms independently selected from O, S, and N. Examples of monocyclic heteroaryl groups include, but are not limited to, pyrrolyl, pyrazolyl, pyrazolinyl, imidazolyl, oxazolyl, isoxazolyl, thiazolyl, thiadiazolyl, isothiazolyl, furanyl, thiophenyl, oxadiazolyl, pyridyl, pyrazinyl, pyrimidinyl, pyridazinyl, and triazinyl. Examples of bicyclic heteroaryl groups include, but are not limited to, indolyl, benzothiazolyl, benzoxazolyl, benzothienyl, quinolyl, tetrahydroisoquinolyl, isoquinolyl, benzimidazolyl, benzopyranyl, indolizinyl, benzofuranyl, isobenzofuranyl, chromonyl, coumarinyl, cinnolinyl, quinoxalinyl, indazolyl, purinyl, pyrrolopyridyl, furopyridyl, thienopyridyl, dihydroisoindolyl, and tetrahydroquinolinyl. Examples of tricyclic heteroaryl groups include, but are not limited to, carbazolyl, benzindolyl, phenanthrolinyl, acridinyl, phenanthridinyl, and xanthenyl. Unless otherwise specified, heteroaryl groups are optionally substituted.
[0039] As used herein and unless otherwise indicated, the term "heteroaryl" means a monovalent group derived from a heteroaromatic ring. Unless otherwise indicated, a heteroaryl group is optionally substituted.
[0040] When a group described herein is referred to as "substituted," it can be substituted with one or more of any suitable substituents. Illustrative examples of substituents include, but are not limited to, those found in the exemplary compounds and embodiments provided herein, as well as: a halogen atom, such as F, CI, Br, or I; a cyano group; an oxo (=0) group; a hydroxyl group (-OH); an alkyl group; an alkenyl group; an alkynyl group; a cycloalkyl group; an aryl group; -(C=0)OR'; -0(C=0)R'; -C(=0)R'; -OR'; -S-SR'; -C(=0)SR'; -SC(=0)R'; -NR'R'; -NR'C(=0)R'; -C(=0)NR'R'; -NR'C(=0)NR'R'; -OC(=0)NR'R'; -NR'C(=0)OR'; -NR'S(O) x NR'R'; -NR'S(O) x NR'R'; -NR'S(O) x R' and -S(O) x NR'R', where: R' is, at each occurrence, independently H, C1-C 15 alkyl or cycloalkyl, and x is 0, 1, or 2. In some embodiments, the substituent is C1-C 12 alkyl. In other embodiments, the substituent is a cycloalkyl group. In other embodiments, the substituent is a halo group, such as a fluoro group. In other embodiments, the substituent is an oxo group. In other embodiments, the substituent is a hydroxyl group. In other embodiments, the substituent is an alkoxy group (-OR'). In other embodiments, the substituent is a carboxyl group. In other embodiments, the substituent is an amino group (-NR'R').
[0041] As used herein and unless otherwise indicated, the term "optionally selected" or "optionally" (e.g., optionally substituted) means that the event or circumstance subsequently described can or can not occur, and the description includes both cases where the event or circumstance occurs and where it does not. For example, "optionally substituted alkyl" means that the alkyl group can or can not be substituted, and the description includes both substituted alkyl groups and alkyl groups without substitution.
[0042] As used herein and unless otherwise indicated, the term "prodrug" of a biologically active compound refers to a compound that can be converted to a biologically active compound under physiological conditions or by solvolysis. In one embodiment, the term "prodrug" refers to a pharmaceutically acceptable metabolic precursor of a biologically active compound. When a prodrug is administered to a subject in need thereof, the prodrug can be inactive, but is converted to the biologically active compound within the living body. Prodrugs are typically rapidly transformed in vivo to yield the parent biologically active compound, by displacement of the pro-moiety, e.g. by hydrolysis in blood. Prodrug compounds often offer advantages of solubility, tissue compatibility or delayed release in a mammalian organism (see, Bundgard, H., Design of Prodrugs (1985), pp. 7-9, 21-24 (Elsevier, Amsterdam). A discussion of prodrugs is provided in Higuchi, T., et al., A.C.S. Symposium Series, Vol. 14, and in Bioreversible Carriers in Drug Design, ed. Edward B. Roche, American Pharmaceutical Association and Pergamon Press, 1987.
[0043] In one embodiment, the term "prodrug" is also intended to encompass any covalently bonded carriers, which release the active compound in vivo when such prodrugs are administered to a mammalian subject. Prodrugs of a compound can be prepared by modifying functional groups present on the compound in such a way that their modifications can be cleaved in vivo to yield the parent compound. Prodrugs include compounds wherein a hydroxy, amino, or mercapto group is bonded to any group that, when such prodrug is administered to a mammalian subject, cleaves to form a free hydroxyl, free amino, or free mercapto group, respectively.
[0044] Examples of prodrugs include, but are not limited to, acetate, formate, and benzoate derivatives of alcohol functional groups or amide derivatives of amine functional groups in the compounds provided herein.
[0045] As used herein and unless otherwise indicated, the term "pharmaceutically acceptable salt" includes both acid and base addition salts.
[0046] Examples of pharmaceutically acceptable acid addition salts include, but are not limited to, salts of hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid and the like; and organic acids, such as but not limited to acetic acid, 2,2-dichloroacetic acid, adipic acid, alginic acid, ascorbic acid, aspartic acid, benzenesulfonic acid, benzoic acid, 4-acetamidobenzoic acid, camphoric acid, camphor-10-sulfonic acid, capric acid, caproic acid, caprylic acid, carbonic acid, cinnamic acid, citric acid, cyclamic acid, dodecylsulfic acid, ethane-1,2-disulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, formic acid, fumaric acid, galactaric acid, gentisic acid, glucoheptonic acid, gluconic acid, glucuronic acid, glutamic acid, glutaric acid, 2-oxoglutaric acid, glycerophosphoric acid, glycolic acid, hippuric acid, isobutyric acid, lactic acid, lactobionic acid, lauric acid, maleic acid, malic acid, malonic acid, mandelic acid, methanesulfonic acid, mucic acid, naphthalene-1,5-disulfonic acid, naphthalene-2-sulfonic acid, 1-hydroxy-2-naphthoic acid, nicotinic acid, oleic acid, orotic acid, oxalic acid, palmitic acid, pamoic acid, propionic acid, pyroglutamic acid, pyruvic acid, salicylic acid, 4-aminosalicylic acid, sebacic acid, stearic acid, succinic acid, tartaric acid, thiocyanic acid, p-toluenesulfonic acid, trifluoroacetic acid, undecylenic acid and the like.
[0047] Examples of pharmaceutically acceptable base addition salts include, but are not limited to, salts prepared by the addition of inorganic or organic bases to the free acid compounds. Salts derived from inorganic bases include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts and the like. In one embodiment, the inorganic salts are ammonium, sodium, potassium, calcium, and magnesium salts. Salts derived from organic bases include, but are not limited to, salts of primary, secondary, and tertiary amines; substituted amines including naturally occurring substituted amines; cyclic amines and basic ion-exchange resins such as ammonia, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, diethanolamine, ethanolamine, deanol, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, benethamine, benzathine, ethylenediamine, glucosamine, methylglucosamine, theobromine, triethanolamine, tromethamine, purines, piperizine, piperidine, N-ethylpiperidine, polyamine resins and the like. In one embodiment, the organic bases are isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline, and caffeine.
[0048] The compounds provided herein can contain one or more asymmetric centers and thus can exist in enantiomeric, diastereomeric, and other stereoisomeric forms. The absolute stereochemistry is not necessarily specified unless otherwise indicated. All such possible isomers, as well as their racemic and optically pure forms, are intended to be included within the scope of the present disclosure. The optically active ( + ) and ( - ) isomers, and racemic mixtures (+) and ( - ) can be prepared using chiral synthons or chiral reagents, or resolved using conventional techniques, e.g., chromatography and fractional crystallization. Conventional techniques for the preparation of / separation of isomers are applicable to the compounds of the present disclosure. When the compounds described herein contain olefinic double bonds, unless otherwise specified, the compounds are meant to include both E and Z geometric isomers. Likewise, when the compounds described herein contain other geometrically isomeric centers, such as the aspartyl moiety, for example, both cis- and trans-forms are intended unless expressly otherwise described.
[0049] As used herein and unless otherwise indicated, the term "isomer" refers to different compounds having the same molecular formula. "Stereoisomers" are isomers that differ only in the way the atoms are arranged in space. "Atropisomers" are stereoisomers resulting from hindered rotation about a single bond. "Enantiomers" are a pair of non-superimposable mirror images of a stereoisomer. A mixture of enantiomers in any ratio can be referred to as a "racemic" mixture. "Diastereomers" are stereoisomers that have at least two asymmetric carbons that are not mirror images of each other.
[0050] " Stereoisomers" can also include E and Z isomers or mixtures thereof, as well as cis- and trans- isomers or mixtures thereof. In certain embodiments, the compounds described herein are isolated as E or Z isomers. In other embodiments, the compounds described herein are mixtures of E and Z isomers.
[0051] " Tautomers" refer to isomeric forms of a compound that are in equilibrium with each other. The concentration of isomeric forms will depend on the environment in which the compound is found, and can vary depending on, for example, whether the compound is a solid or in an organic or aqueous solution.
[0052] It is also noted that the compounds described herein can contain unnatural proportions of atomic isotopes at one or more atoms. For example, the compounds can be radiolabeled with radioactive isotopes, such as tritium ( 3 H), iodine-125 ( 125 I), sulfur-35 ( 35 S), or carbon-14 ( 14 C), or can be isotopically enriched, such as deuterium ( 2 H), carbon-13 ( 13C) or nitrogen-15 15 N) As used herein, an “isotopologue” is an isotopically enriched compound. The term “isotopically enriched” means that the isotopic composition of an atom differs from the natural isotopic composition of that atom. “Isotopically enriched” can also mean that a compound contains at least one atom that has an isotopic composition that differs from the natural isotopic composition of that atom. The term “isotopic composition” refers to the amount of each isotope present for a given atom. Radiolabeled and isotopically enriched compounds are useful as therapeutic agents, e.g., cancer therapeutic agents; research reagents, e.g., binding assay reagents; and diagnostic agents, e.g., in vivo imaging agents. All isotopic variations of the compounds described herein, whether radioactive or not, are intended to be encompassed within the scope of the embodiments provided herein. In some embodiments, isotopologues of the compounds described herein are provided, e.g., isotopologues that are deuterium, carbon-13, and / or nitrogen-15 enriched. As used herein, “deuterated” means that at least one hydrogen (H) in a compound has been replaced with deuterium (indicated as D or 2 H). That is, the compound is enriched in deuterium at at least one position.
[0053] It should be noted that if there is a discrepancy between a depicted structure and the name of the structure, the depicted structure is intended to control.
[0054] As used herein and unless otherwise indicated, the term “pharmaceutically acceptable carrier, diluent or excipient” includes, but is not limited to, any adjuvant, carrier, excipient, glidant, sweetening, diluting, preserving, colorant, flavor enhancing, surfactant, wetting, dispersing, suspending, stabilizing, isotonic, solvent, or emulsor agent approved by the United States Food and Drug Administration as being acceptable for use in humans or domestic animals.
[0055] The term “composition” is intended to encompass a product comprising the specified ingredients (e.g., the mRNA molecules provided herein) in the specified amounts.
[0056] As used interchangeably herein, the terms "polynucleotide" or "nucleic acid" refer to a polymer of nucleotides of any length and include, for example, DNA and RNA. A nucleotide can be a deoxyribonucleotide, ribonucleotide, modified nucleotide or base, and / or an analogue thereof, or any substrate which can be incorporated into a polymer by a DNA or RNA polymerase or by a synthetic reaction. A polynucleotide can comprise modified nucleotides, such as methylated nucleotides and analogs. A nucleic acid can be in single- or double-stranded form. As used herein and unless otherwise indicated, "nucleic acid" also includes nucleic acid mimetics, such as locked nucleic acids (LNAs), peptide nucleic acids (PNAs), and morpholino nucleic acids. As used herein, "oligonucleotide" refers to a short synthetic polynucleotide, which is generally, but not necessarily, less than about 200 nucleotides in length. The term "oligonucleotide" is not mutually exclusive with "polynucleotide." The above description of a polynucleotide applies equally and fully to an oligonucleotide. Unless otherwise indicated, the left-hand end of any single-stranded polynucleotide sequence is the 5' terminus; the left-hand direction of a double-stranded polynucleotide sequence is referred to as the 5' direction. The direction of 5' to 3' addition of nucleotides to an nascent RNA transcript is referred to as the transcription direction; sequence regions on the DNA strand having the same sequence as the RNA transcript and which are located 5' to the 5' terminus of the RNA transcript are referred to as "upstream sequences"; sequence regions on the DNA strand having the same sequence as the RNA transcript and which are located 3' to the 3' terminus of the RNA transcript are referred to as "downstream sequences."
[0057] An "isolated nucleic acid" refers to a nucleic acid, e.g., RNA, DNA, or mixed nucleic acid, that is substantially separated from other genomic DNA sequences and proteins or complexes (such as ribosomes and polymerases) that naturally accompany the native sequence. An "isolated" nucleic acid molecule is one that is separated from other nucleic acid molecules present in the natural source of the nucleic acid molecule. In addition, an "isolated" nucleic acid molecule, such as an mRNA molecule, can be substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors, or other chemicals when chemically synthesized. In particular embodiments, one or more nucleic acid molecules encoding an antigen described herein are isolated or purified. The term includes nucleic acid sequences that have been removed from their naturally occurring milieu, and includes recombinant or cloned DNA or RNA isolates as well as chemically synthesized analogs or biologically synthesized analogs from heterologous systems. A substantially pure molecule can include an isolated form of the molecule.
[0058] The term "coding nucleic acid" or its grammatical equivalents, when used in reference to a nucleic acid molecule, includes: (a) nucleic acid molecules that, when transcribed in their natural state or manipulated by methods well known to those skilled in the art, yield mRNA that is then translated into a peptide and / or polypeptide; and (b) mRNA molecules themselves. The anti-sense strand is the complement of such a nucleic acid molecule, and the coding sequence can be inferred therefrom. The term "coding region" refers to the portion of a coding nucleic acid sequence that is translated into a peptide or polypeptide. The term "untranslated region" or "UTR" refers to the portion of a coding nucleic acid that is not translated into a peptide or polypeptide. Depending on the orientation of the UTR relative to the coding region of a nucleic acid molecule, the UTR is referred to as a 5'-UTR if it is located 5' to the coding region, and a 3'-UTR if it is located 3' to the coding region.
[0059] As used herein, the term "mRNA" refers to a messenger RNA molecule comprising one or more open reading frames (ORFs) that can be translated by a cell or organism having the mRNA to produce one or more peptide or protein products. The region containing one or more ORFs is referred to as the coding region of the mRNA molecule. In certain embodiments, the mRNA molecule further comprises one or more untranslated regions (UTRs).
[0060] In certain embodiments, the mRNA is a monocistronic mRNA comprising only one ORF. In certain embodiments, the monocistronic mRNA encodes a peptide or protein comprising at least one epitope of a selected antigen (e.g., a pathogenic antigen or a tumor-associated antigen). In other embodiments, the mRNA is a multicistronic mRNA comprising two or more ORFs. In certain embodiments, the multicistronic mRNA encodes two or more peptides or proteins that can be the same or different from each other. In certain embodiments, each peptide or protein encoded by the multicistronic mRNA comprises at least one epitope of a selected antigen. In certain embodiments, the different peptides or proteins encoded by the multicistronic mRNA each comprise at least one epitope of a different antigen. In any of the embodiments described herein, the at least one epitope can be at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 epitopes of an antigen.
[0061] The term "nucleobase" encompasses purines and pyrimidines, including the natural compounds adenine, thymine, guanine, cytosine, uracil, inosine, as well as natural or synthetic analogs or derivatives thereof.
[0062] As used herein, the term "functional nucleotide analog" refers to a modified version of a canonical nucleotide A, G, C, U, or T that (a) retains the base pairing properties of the corresponding canonical nucleotide, and (b) contains at least one chemical modification to (i) the nucleobase, (ii) the sugar group, (iii) the phosphate group, or (iv) any combination of (i) to (iii) of the corresponding natural nucleotide. As used herein, base pairing encompasses not only the classic Watson-Crick adenine-thymine, adenine-uracil, or guanine-cytosine base pairs, but also base pairs formed between a canonical nucleotide and a functional nucleotide analog or between a pair of functional nucleotide analogs, where the arrangement of hydrogen bond donors and hydrogen bond acceptors allows for hydrogen bonding between the modified nucleobase and the canonical nucleobase or between two complementary modified nucleobase structures. For example, a functional analog of guanosine (G) retains the ability to base pair with cytosine (C) or a functional analog of cytosine. One example of such non-canonical base pairing is base pairing between a modified nucleotide inosine and adenine, cytosine, or uracil. As described herein, a functional nucleotide analog can be naturally occurring or non-naturally occurring. Thus, a nucleic acid molecule containing a functional nucleotide analog can have at least one modified nucleobase, sugar group, and / or internucleoside linkage. Exemplary chemical modifications to the nucleobase, sugar group, or internucleoside linkage of a nucleic acid molecule are provided herein.
[0063] As used herein, the terms "translation enhancer element," "TEE," and "translation enhancer" refer to a region in a nucleic acid molecule used to facilitate translation of a coding sequence of the nucleic acid into a protein or peptide product, such as via cap-dependent or cap-independent translation. A TEE is typically located in a UTR region of a nucleic acid molecule, such as an mRNA, and enhances the level of translation of a coding sequence located upstream or downstream. For example, a TEE in the 5'-UTR of a nucleic acid molecule can be located between the promoter and the start codon of the nucleic acid molecule. Various TEE sequences are known in the art (Wellensiek et al., Genome-wide profiling of human cap-independent translation-enhancing elements, Nature Methods, August 2013; 10(8):747-750; Chappell et al., PNAS, June 29, 2004, 101(26) 9590-9594). Some TEEs are known to be conserved across multiple species (Pánek et al., Nucleic Acids Research, Volume 41, Issue 16, 1 September 2013, Pages 7625-7634).
[0064] As used herein, the term "stem-loop sequence" refers to a single-stranded polynucleotide sequence having at least two regions that are complementary or substantially complementary to each other when read in opposite directions, and thus capable of base pairing to each other to form at least one double helix and an unpaired loop. The resulting structure is referred to as a stem-loop structure, hairpin, or hairpin loop, which is a secondary structure found in many RNA molecules.
[0065] As used herein, the term "peptide" refers to a polymer containing two to fifty (2-50) amino acid residues linked by one or more covalent peptide bonds. The term applies to naturally occurring amino acid polymers as well as to amino acid polymers in which one or more of the amino acid residues are non-naturally occurring amino acids (e.g., amino acid analogs or non-natural amino acids).
[0066] The terms "polypeptide" and "protein" are used interchangeably herein to refer to a polymer having more than fifty (50) amino acid residues linked by covalent peptide bonds. That is, a description directed to a polypeptide is equally applicable to a description directed to a protein, and vice versa. The term applies to naturally occurring amino acid polymers as well as to amino acid polymers in which one or more of the amino acid residues are non-naturally occurring amino acids (e.g., amino acid analogs). As used herein, the term encompasses amino acid chains of any length, including full-length proteins (e.g., antigens).
[0067] The term "antigen" refers to a substance capable of being recognized by the immune system (including the adaptive immune system) of a subject, and capable of triggering an immune response (including an antigen-specific immune response) after the subject is exposed to the antigen. In certain embodiments, an antigen is a protein associated with a diseased cell, such as a cell infected with a pathogenic agent or a neoplastic cell (e.g., a tumor-associated antigen (TAA)).
[0068] In the context of a peptide or polypeptide, the term "fragment" as used herein refers to a peptide or polypeptide comprising less than the full-length amino acid sequence. Such fragments can, for example, result from truncation at the amino terminus, truncation at the carboxy terminus, and / or internal deletion of residues in the amino acid sequence. Fragments can, for example, result from alternative RNA splicing or from protease activity in vivo. In certain embodiments, a fragment refers to a polypeptide comprising an amino acid sequence of at least 5 contiguous amino acid residues, at least 10 contiguous amino acid residues, at least 15 contiguous amino acid residues, at least 20 contiguous amino acid residues, at least 25 contiguous amino acid residues, at least 30 contiguous amino acid residues, at least 40 contiguous amino acid residues, at least 50 contiguous amino acid residues, at least 60 contiguous amino acid residues, at least 70 contiguous amino acid residues, at least 80 contiguous amino acid residues, at least 90 contiguous amino acid residues, at least 100 contiguous amino acid residues, at least 125 contiguous amino acid residues, at least 150 contiguous amino acid residues, at least 175 contiguous amino acid residues, at least 200 contiguous amino acid residues, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, at least 750, at least 800, at least 850, at least 900, or at least 950 contiguous amino acid residues of the polypeptide. In particular embodiments, a fragment of a polypeptide retains at least one, at least two, at least three, or more functions of the polypeptide.
[0069] An "epitope" is a site on the surface of an antigen molecule to which a single antibody molecule binds, such as a local region of the surface of an antigen that is capable of binding to one or more antigen binding regions of an antibody, and which has antigenic or immunogenic activity in an animal, such as in a mammal (e.g., in a human), capable of eliciting an immune response. An epitope that has immunogenic activity is a portion of a polypeptide that elicits an antibody response in an animal. An epitope that has antigenic activity is a portion of a polypeptide that is bound by an antibody as determined by any method well known in the art, including, for example, by immunoassay. An antigenic epitope does not necessarily have immunogenicity. Epitopes are generally composed of chemical groups on the surface of a molecule, such as amino acids or sugar side chains, and have specific three-dimensional structural characteristics, as well as specific charge characteristics. Antibody epitopes can be linear epitopes or conformational epitopes. Linear epitopes are formed by contiguous amino acid sequences in a protein. Conformational epitopes are formed by amino acids that are non-contiguous in the primary sequence of a protein but come together when the protein folds into its three-dimensional structure. Induced epitopes are formed when the three-dimensional structure of a protein is altered, such as after activation or binding by another protein or ligand. In certain embodiments, an epitope is a three-dimensional surface characteristic of a polypeptide. In other embodiments, an epitope is a linear characteristic of a polypeptide. Generally, an antigen has several or many different epitopes, and can react with many different antibodies.
[0070] As used herein, the term "genetic vaccine" refers to a therapeutic or prophylactic composition comprising at least one nucleic acid molecule that encodes an antigen associated with a disease of interest (e.g., an infectious disease or a neoplastic disease). Administration of the vaccine to a subject ("vaccination") allows for production of the encoded peptide or protein, thereby eliciting an immune response in the subject against the disease of interest. In certain embodiments, the immune response includes an adaptive immune response, such as the production of antibodies against the encoded antigen, and / or the activation and proliferation of immune cells capable of specifically eliminating diseased cells expressing the antigen. In certain embodiments, the immune response further includes an innate immune response. In accordance with the present disclosure, the vaccine can be administered to the subject prior to or after the onset of clinical symptoms of the disease of interest. In some embodiments, vaccination of a healthy or asymptomatic subject renders the vaccinated subject immune or less susceptible to the development of the disease of interest. In some embodiments, vaccination of a subject displaying symptoms of the disease ameliorates the disease condition or treats the disease in the vaccinated subject.
[0071] The terms "innate immune response" and "innate immunity" are art-recognized and refer to a non-specific defense mechanism initiated by the body's immune system upon recognition of pathogen-associated molecular patterns, which involves different forms of cellular activities, including cytokine production and cell death via various pathways. As used herein, an innate immune response includes, but is not limited to, an increase in the production of inflammatory cytokines (e.g., Type I interferon or IL-10 production); activation of the NFKB pathway; increased proliferation, maturation, differentiation, and / or survival of immune cells, and in some cases, induction of apoptosis. Activation of innate immunity can be detected using methods known in the art, such as measuring (N F)-K B activation.
[0072] The terms "adaptive immune response" and "adaptive immunity" are art-recognized and refer to an antigen-specific defense mechanism initiated by the body's immune system upon recognition of a specific antigen, including humoral responses and cell-mediated responses. As used herein, an adaptive immune response includes a cellular response triggered and / or enhanced by a vaccine composition, such as a genetic composition described herein. In some embodiments, the vaccine composition comprises an antigen that is the target of the antigen-specific adaptive immune response. In other embodiments, the vaccine composition, upon administration, allows for the production of an antigen in the immunized subject, which antigen is the target of the antigen-specific adaptive immune response. Activation of an adaptive immune response can be detected using methods known in the art, such as measuring the production of antigen-specific antibodies or the level of antigen-specific cell-mediated cytotoxicity.
[0073] The term "antibody" is intended to include the polypeptide product of a B cell that is within the range of immunoglobulin polypeptides, which is capable of binding to a specific molecular antigen and is composed of two identical pairs of polypeptide chains, where each pair has one heavy chain (about 50-70 kDa) and one light chain (about 25 kDa), each amino-terminal portion of each chain includes a variable region containing about 100 to about 130 or more amino acids, and each carboxy-terminal portion of each chain includes a constant region. See, e.g., Antibody Engineering (Borrebaeck, ed., 2nd ed., 1995); and Kuby, Immunology (3rd ed., 1997). In particular embodiments, the specific molecular antigen can be bound by an antibody provided herein, including a polypeptide, a fragment thereof, or an epitope. Antibodies also include, but are not limited to, synthetic antibodies, recombinantly produced antibodies, camelized antibodies, intrabodies, anti-idiotypic (anti-Id) antibodies, and functional fragments of any of the above, by which is meant a portion of an antibody heavy or light chain polypeptide that retains some or all of the binding activity of the antibody from which the fragment was derived. Non-limiting examples of functional fragments include single chain Fv (scFv) (e.g., including monospecific, bispecific, etc.), Fab fragments, F(ab') fragments, F(ab)2 fragments, F(ab')2 fragments, disulfide-linked Fv (dsFv), Fd fragments, Fv fragments, diabodies, triabodies, tetrabodies, and minibodies. In particular, the antibodies provided herein include immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, e.g., antigen binding domains or molecules containing an antigen binding site (e.g., one or more CDRs of an antibody). Such antibody fragments can be found in, e.g., Harlow and Lane, Antibodies: A Laboratory Manual (1989); Mol. Biology and Biotechnology: A Comprehensive Desk Reference (Myers, ed., 1995); Huston et al., 1993, Cell Biophysics 22:189-224; Pluckthun and Skerra, 1989, Meth. Enzymol. 178:497-515; and Day, Advanced Immunochemistry (2nd ed., 1990). The antibodies provided herein can be of any class (e.g., IgG, IgE, IgM, IgD, and IgA) or any subclass (e.g., IgGl, IgG2, IgG3, IgG4, IgAl, and IgA2) of immunoglobulin molecule.
[0074] The term "administer" or "administration" refers to the act of injecting or otherwise physically delivering a substance (e.g., a lipid nanoparticle composition described herein) that is present outside of the body into the body of a patient, such as transmucosally, intradermally, intravenously, intramuscularly, and / or any other physical delivery method described herein or known in the art. When treating a disease, disorder, condition, or symptom thereof, administration of the substance is typically performed after the onset of the disease, disorder, condition, or symptom thereof. When preventing a disease, disorder, condition, or symptom thereof, administration of the substance is typically performed before the onset of the disease, disorder, condition, or symptom thereof.
[0075] "Long-term" administration, as opposed to acute modes, refers to administration of one or more agents in a continuous mode (e.g., for a period of time, such as days, weeks, months, or years), whereby the initial therapeutic effect (activity) is maintained over a longer period of time. "Intermittent" administration refers to treatment that is not continuously ongoing, but is periodic in nature.
[0076] As used herein, the term "targeted delivery" or the verb form "target" refers to a process that facilitates the arrival of a delivered agent (such as a therapeutically effective payload molecule in a lipid nanoparticle composition described herein) to a particular organ, tissue, cell, and / or intracellular compartment (referred to as a target location) as compared to delivery to any other organ, tissue, cell, or intracellular compartment (referred to as a non-target location). Targeted delivery can be detected using methods known in the art, for example, by comparing the concentration of a delivered agent in a target cell population to the concentration of the delivered agent at a non-target cell population following systemic administration. In certain embodiments, targeted delivery results in a concentration at the target location that is at least 2-fold higher than the concentration at the non-target location.
[0077] An "effective amount" is generally an amount sufficient to reduce the severity and / or frequency of symptoms; eliminate symptoms and / or their underlying cause; prevent occurrence of symptoms and / or their underlying cause; and / or ameliorate or remedy damage caused by or related to a disease, disorder, or condition, including, for example, damage caused by or related to infection and neoplastic formation. In some embodiments, an effective amount is a therapeutically effective amount or a prophylactically effective amount.
[0078] As used herein, the term "therapeutically effective amount" refers to the amount of an agent (e.g., a vaccine composition) sufficient to reduce and / or ameliorate the severity and / or duration of a given disease, disorder, or condition, and / or its associated symptoms (e.g., an infectious disease, such as an infectious disease caused by a viral infection, or a neoplastic disease, such as a cancer). A "therapeutically effective amount" of a substance / molecule / agent of the present disclosure (e.g., a lipid nanoparticle composition described herein) can vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the substance / molecule / agent to elicit a desired response in the individual. A therapeutically effective amount encompasses an amount of a substance / molecule / agent that treats the beneficial effects of the substance / molecule / agent outweigh any toxic or deleterious effects. In certain embodiments, the term "therapeutically effective amount" refers to the amount of a lipid nanoparticle composition, or a therapeutic or prophylactic agent contained therein (e.g., a therapeutic mRNA), as described herein, effective to "treat" a disease, disorder, or condition in a subject or mammal.
[0079] A "prophylactically effective amount" is the amount of a pharmaceutical composition that will have the intended prophylactic effect, e.g., preventing a disease, disorder, condition, or associated symptom (e.g., an infectious disease, such as an infectious disease caused by a viral infection, or a neoplastic disease, such as a cancer), delaying the onset (or recurrence) thereof, or reducing the likelihood of the onset (or recurrence) thereof, when administered to a subject. Typically, but not necessarily, a prophylactically effective amount is less than a therapeutically effective amount, since the prophylactic dose is administered before or at an early stage of disease, disorder, or condition in a subject. Full therapeutic or prophylactic effects can not be achieved with a single dose, and may
[0080] The terms "prevent," "preventing," and "prevention" refer to reducing the likelihood of the onset (or recurrence) of a disease, disorder, condition, or associated symptom (e.g., an infectious disease, such as an infectious disease caused by a viral infection, or a neoplastic disease, such as a cancer).
[0081] The terms "manage," "managing," and "management" refer to the beneficial effects obtained by a subject from a therapy (e.g., a prophylactic or therapeutic agent), which do not result in a cure of the disease. In certain embodiments, one or more therapies (e.g., a prophylactic or therapeutic agent, such as a lipid nanoparticle composition described herein) are administered to a subject to "manage" an infectious or neoplastic disease, one or more symptoms thereof, thereby preventing the progression or worsening of the disease.
[0082] The term "prophylactic agent" refers to any agent that can completely or partially inhibit the development, recurrence, onset, or spread of a disease and / or its associated symptoms in a subject.
[0083] The term“therapeutic agent” refers to any agent that can be used in the treatment, prevention or alleviation of a disease, disorder or condition, including any agent that is used in the treatment, prevention or alleviation of a disease, disorder or condition and / or one or more symptoms thereof.
[0084] The term“therapies / therapy” refers to any regimen, method and / or agent that can be used in the prevention, management, treatment and / or amelioration of a disease, disorder or condition. In certain embodiments, the term“therapies / therapy” refers to biological, supportive and / or other therapies known to those of skill in the art, such as medical personnel, to be useful in the prevention, management, treatment and / or amelioration of a disease, disorder or condition.
[0085] As used herein, a“prophylactically effective serum titer” is a serum titer of an antibody that completely or partially inhibits the development, recurrence, onset or spread of a disease, disorder or condition, and / or its associated symptoms, in a subject (e.g., a human).
[0086] In certain embodiments, a“therapeutically effective serum titer” is a serum titer of an antibody that reduces the severity, duration and / or symptoms associated with a disease, disorder or condition, in a subject (e.g., a human).
[0087] The term“serum titer” refers to the average serum titer in a population of at least 10, at least 20, at least 40 up to about 100, 1000 or more subjects, or from multiple samples (e.g., at multiple time points) in a single subject.
[0088] The term“side effects” encompasses unwanted and / or adverse effects of a therapy (e.g., a prophylactic or therapeutic agent). An unwanted effect is not necessarily adverse. An adverse effect of a therapy (e.g., a prophylactic or therapeutic agent) can be harmful, unpleasant, or risky. Examples of side effects include diarrhea, cough, gastroenteritis, wheezing, nausea, vomiting, anorexia, abdominal cramping, fever, pain, weight loss, dehydration, hair loss, difficulty breathing, insomnia, dizziness, mucositis, neurological and muscular effects, fatigue, dry mouth, loss of appetite, skin rash or swelling at the site of administration, flu-like symptoms such as fever, chills, and fatigue, digestive tract problems, and allergic reactions. Other unwanted effects experienced by patients are numerous and known in the art. Many effects are described in the Physician’s Desk Reference (68th edition, 2014).
[0089] The terms "subject" and "patient" are used interchangeably. As used herein, in certain embodiments, a subject is a mammal, such as a non-primate (e.g., a cow, pig, horse, cat, dog, rat, etc.) or a primate (e.g., a monkey or a human). In particular embodiments, a subject is a human. In one embodiment, a subject is a mammal (e.g., a human) having an infectious or neoplastic disease. In another embodiment, a subject is a mammal (e.g., a human) at risk of developing an infectious or neoplastic disease.
[0090] The term "detectable probe" refers to a composition that provides a detectable signal. The term includes, but is not limited to, any fluorophore, chromophore, radiolabel, enzyme, antibody or antibody fragment, etc. that provides a detectable signal via activity.
[0091] The term "detectable agent" refers to a substance that can be used to determine the existence / presence of a desired molecule, such as an antigen encoded by an mRNA molecule described herein, in a sample or subject. A detectable agent can be a substance that can be visually observed or a substance that can be otherwise determined and / or measured (e.g., by quantification).
[0092] "Substantially all" means at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or about 100%.
[0093] The term "about" or "approximately," as used herein and unless otherwise indicated, means an acceptable error for the particular value as determined by one of ordinary skill in the art to which the value pertains, depending in part on the manner in which the value is measured or determined. In certain embodiments, the term "about" or "approximately" means within 1, 2, 3, or 4 standard deviations. In certain embodiments, the terms "about" and "approximately" mean within 20%, within 15%, within 10%, within 9%, within 8%, within 7%, within 6%, within 5%, within 4%, within 3%, within 2%, within 1%, within 0.5%, within 0.05%, or lower of a given value or range.
[0094] The singular terms "a," "an," and "the" include plural referents unless the context clearly indicates otherwise.
[0095] All publications, patent applications, deposit accession numbers, and other references cited in this specification are herein incorporated by reference in their entirety as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference. The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present application is not entitled to antedate such publication by virtue of prior application. In addition, the dates of publication provided can be different from the dates that may appear on the publications that were published by the U.S. Patent and Trademark Office.
[0096] A number of embodiments of the application have been described. Nevertheless, it will be understood that various modifications can be made without departing from the spirit and scope of the application. Accordingly, the description in the Experimental Section and Examples is intended to be illustrative, but not limiting, of the scope of the application described in the claims.
[0097] 5.3 Lipid Compounds
[0098] Unless otherwise indicated, the description provided herein applies to all of the formulae (e.g., Formula (I), including subformulae thereof) provided herein, to the extent that they apply.
[0099] In one embodiment, provided herein is a compound of Formula (I):
[0100]
[0101] or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof, wherein:
[0102] G 1 and G 2 each independently is a bond, C2-C 12 alkylene, or C2-C 12 alkenylene, wherein one or more -CH2- in G 1 and G 2 is optionally replaced with -O-;
[0103] each L 1 independently is -OC(=O)R 1 , -C(=O)OR 1 , -OC(=O)OR 1 , -C(=O)R 1 , -OR 1 , -S(O) x R 1 , -S-SR 1 , -C(=O)SR 1 , -SC(=O)R 1 , -NR a C(=O)R 1 , -C(=O)NRb R c 、-NR a C(=O)NR b R c 、-OC(=O)NR b R c 、-NR a C(=O)OR 1 、-SC(=S)R 1 、-C(=S)SR 1 、-C(=S)R 1 、-CH(OH)R 1 、-P(=O)(OR b )(OR c ),-NR a P(=O)(OR b )(OR c )、-(C6-C 10 arylene)-R 1 , -(6- to 10-membered heteroarylene)-R 1 、-(4- to 8-membered heterocyclylene)-R 1 or R 1 ;
[0104] Each L 2 are independently -OC(=O)R 2 、-C(=O)OR 2 、-OC(=O)OR 2 、-C(=O)R 2 、-OR 2 、-S(O) x R 2 、-S-SR 2 、-C(=O)SR 2 、-SC(=O)R 2 、-NR d C(=O)R 2 、-C(=O)NR e R f 、-NR d C(=O)NR e R f 、-OC(=O)NR e R f 、-NR d C(=O)OR 2 、-SC(=S)R 2 、-C(=S)SR 2 、-C(=S)R 2 、-CH(OH)R 2 、-P(=O)(OR e )(ORf ), -NR d P(=O)(OR e )(OR f ), -(C6-C 10 arylene)-R 2 , -(6- to 10-membered heteroarylene)-R 2 , -(4- to 8-membered heterocyclyl ene)-R 2 or R 2 ;
[0105] R 1 and R 2 are each independently C6-C 24 alkyl or C6-C 24 alkenyl;
[0106] R a , R b , R d and R e are each independently H, C1-C 24 alkyl or C2-C 24 alkenyl;
[0107] R c and R f are each independently C1-C 24 alkyl or C2-C 24 alkenyl;
[0108] G 3 is C2-C 12 alkylene or C2-C 12 alkenylene, wherein some or all of the alkylene or alkenylene is optionally replaced by C3-C8 cycloalkylene, C3-C8 cycloalkenylene, C3-C8 cycloalkynylene, 4- to 8-membered heterocyclyl ene, C6-C 10 arylene or 5- to 10-membered heteroarylene;
[0109] R 3 is hydrogen, C1-C 12 alkyl, C2-C 12 alkenyl, C2-C 12 alkynyl, C3-C8 cycloalkyl, C3-C8 cycloalkenyl, C3-C8 cycloalkynyl, 4- to 8-membered heterocyclyl, C6-C 10 aryl or 5- to 10-membered heteroaryl; or R 3 , G 1 or G 1 together with the nitrogen to which it is attached form a cyclic moiety; or R 3 , G 3 or G 3 together with the nitrogen to which it is attached form a cyclic moiety;
[0110] R 4 is C1-C 12 alkyl or C3-C8 cycloalkyl;
[0111] x is 0, 1, or 2;
[0112] n is 1 or 2;
[0113] m is 1 or 2; and
[0114] wherein each alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, heterocyclyl, aryl, heteroaryl, alkylene, alkenylene, cycloalkylene, cycloalkenylene, cycloalkynylene, heterocyclylene, arylene, heteroarylene, and cyclic moiety is independently optionally substituted.
[0115] In one embodiment, provided herein is a compound of Formula (I):
[0116]
[0117] or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof, wherein:
[0118] G 1 and G 2 are each independently a bond, C2-C 12 alkylene, or C2-C 12 alkenylene;
[0119] each L 1 is independently -OC(=O)R 1 , -C(=O)OR 1 , -OC(=O)OR 1 , -C(=O)R 1 , -OR 1 , -S(O) x R 1 , -S-SR 1 , -C(=O)SR 1 , -SC(=O)R 1 , -NR a C(=O)R 1 , -C(=O)NR b R c , -NR a C(=O)NR b R c , -OC(=O)NR b R c , -NR a C(=O)OR 1 , -SC(=S)R 1 , -C(=S)SR 1-C(=S)R 1 -CH(OH)R 1 -P(=O)(OR b )(OR c ), -(C6-C 10 arylene)-R 1 -(6- to 10-membered heteroarylene)-R 1 or R 1 ;
[0120] each L 2 is independently -OC(=O)R 2 -C(=O)OR 2 -OC(=O)OR 2 -C(=O)R 2 -OR 2 -S(O) x R 2 -S-SR 2 -C(=O)SR 2 -SC(=O)R 2 -NR d C(=O)R 2 -C(=O)NR e R f -NR d C(=O)NR e R f -OC(=O)NR e R f -NR d C(=O)OR 2 -SC(=S)R 2 -C(=S)SR 2 -C(=S)R 2 -CH(OH)R 2 -P(=O)(OR e )(OR f ), -(C6-C 10 arylene)-R 2 -(6- to 10-membered heteroarylene)-R 2 or R 2 ;
[0121] R 1 and R 2 are each independently C6-C 24 alkyl or C6-C 24 alkenyl;
[0122] R a , R b , R d and Re Each independently represents H, C1-C 12 Alkyl or C2-C 12 alkenyl;
[0123] R c and R f Each independently is C1-C 24 Alkyl or C2-C 24 alkenyl;
[0124] G 3 It is C2-C 12 Alkylene or C2-C 12 Alkenylene, wherein part or all of the alkylene or alkenylene groups are optionally substituted by C3-C8 cycloalkylene, C3-C8 cycloalkenylene, C3-C8 cycloalkynylene, 4 to 8 membered heterocyclylene, C6-C8 10 arylene or 5- to 10-membered heteroarylene replacement;
[0125] R 3 is hydrogen, C1-C 12 Alkyl, C2-C 12 Alkenyl, C2-C 12 Alkynyl, C3-C8 cycloalkyl, C3-C8 cycloalkenyl, C3-C8 cycloalkynyl, 4- to 8-membered heterocyclic group, C6-C 10 aryl or 5- to 10-membered heteroaryl; or R 3 , G 1 or G 1 Together with the nitrogen to which it is attached, a portion of R forms a cyclic moiety; or 3 , G 3 or G 3 A portion of together with the nitrogen to which it is attached forms a cyclic portion;
[0126] R 4 It is C1-C 12 Alkyl or C3-C8 cycloalkyl;
[0127] x is 0, 1, or 2;
[0128] n is 1 or 2;
[0129] m is 1 or 2; and
[0130] wherein each alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, heterocyclyl, aryl, heteroaryl, alkylene, alkenylene, cycloalkylene, cycloalkenylene, cycloalkynylene, heterocyclylene, arylene, heteroarylene, and cyclic moiety is independently optionally substituted.
[0131] In one embodiment, n is 1. In one embodiment, n is 2. In one embodiment, m is 1. In one embodiment, m is 2. In one embodiment, n is 1 and m is 1. In one embodiment, n is 1 and m is 2. In one embodiment, n is 2 and m is 1. In one embodiment, n is 2 and m is 2.
[0132] In one embodiment, the compound is a compound of Formula (II-A):
[0133]
[0134] or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof.
[0135] In one embodiment, the compound is a compound of Formula (II-B):
[0136]
[0137] or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof.
[0138] In one embodiment, the compound is a compound of Formula (II-C):
[0139]
[0140] or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof.
[0141] In one embodiment, the compound is a compound of Formula (II-D):
[0142]
[0143] or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof.
[0144] In one embodiment, G 3 is C2-C 12 alkylene. In one embodiment, G 3 is C2-C8alkylene. In one embodiment, G 3 is C2-C6alkylene. In one embodiment, G 3 is C2-C4alkylene. In one embodiment, G 3 is C2alkylene. In one embodiment, G 3 is C3alkylene. In one embodiment, G 3 is C4alkylene. In one embodiment, G 3 is C5alkylene. In one embodiment, G 3is C6alkylene. In one embodiment, G 3 is -CH2CH2-.
[0145] In one embodiment, G 3 is C2-C 12 alkylene. In one embodiment, G 3 is C2-C8alkenylene. In one embodiment, G 3 is C2-C6alkenylene. In one embodiment, G 3 is C2-C4alkenylene. In one embodiment, G 3 is C2alkenylene. In one embodiment, G 3 is C3alkenylene. In one embodiment, G 3 is C4alkenylene. In one embodiment, G 3 is C5alkenylene. In one embodiment, G 3 is C6alkenylene. In one embodiment, G 3 is (Z)-CH2-CH=CH-CH2-. In one embodiment, G 3 is (E)-CH2-CH=CH-CH2-.
[0146] In one embodiment, G 3 is C2-C 12 alkylene or C2-C 12 alkenylene, wherein some or all of the alkylene or alkenylene is replaced by C3-C8cycloalkylene, C3-C8cycloalkenylene, C3-C8cycloalkynylene, 4- to 8-membered heterocyclylene, C6-C 10 arylene, or 5- to 10-membered heteroarylene. In one embodiment, G 3 is C2-C 12 alkylene or C2-C 12 alkenylene, wherein some or all of the alkylene or alkenylene is replaced by C3-C8cycloalkylene. In one embodiment, G 3 is C2-C 12 alkylene or C2-C 12 alkenylene, wherein all of the alkylene or alkenylene is replaced by C3-C8cycloalkylene, i.e. G 3 is C3-C8cycloalkylene. In one embodiment, G 3 is cyclopropylene. In one embodiment, G 3 is cyclobutylene. In one embodiment, G 3 is cyclopentylene. In one embodiment, G 3 is cyclohexylene. In one embodiment, G 3 is cycloheptylene. In one embodiment, G 3is cyclooctylene.
[0147] In one embodiment, G 3 is
[0148] In one embodiment, G 3 is unsubstituted.
[0149] In one embodiment, the compound is a compound of Formula (III-A):
[0150]
[0151] wherein s is an integer from 2 to 12,
[0152] or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof.
[0153] In one embodiment, the compound is a compound of Formula (III-B):
[0154]
[0155] wherein s is an integer from 2 to 12,
[0156] or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof.
[0157] In one embodiment, the compound is a compound of Formula (III-C):
[0158]
[0159] wherein s is an integer from 2 to 12,
[0160] or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof.
[0161] In one embodiment, the compound is a compound of Formula (III-D):
[0162]
[0163] wherein s is an integer from 2 to 12,
[0164] or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof.
[0165] In one embodiment, s is an integer from 2 to 12. In one embodiment, s is an integer from 2 to 8. In one embodiment, s is an integer from 2 to 6. In one embodiment, s is an integer from 2 to 4. In one embodiment, s is 2. In one embodiment, s is 3. In one embodiment, s is 4. In one embodiment, s is 5. In one embodiment, s is 6.
[0166] In one embodiment, G 1 is a bond. In one embodiment, G 1 is C2-C 12 alkylene. In one embodiment, G 1 is C4-C8alkylene. In one embodiment, G 1 is C5-C7alkylene. In one embodiment, G 1 is C2alkylene. In one embodiment, G 1 is C3alkylene. In one embodiment, G 1 is C4alkylene. In one embodiment, G 1 is C5alkylene. In one embodiment, G 1 is C6alkylene. In one embodiment, G 1 is C7alkylene. In one embodiment, G 1 is C2-C 12 alkenylene. In one embodiment, G 1 is C4-C8alkenylene. In one embodiment, G 1 is C5-C7alkenylene. In one embodiment, G 1 is C5alkenylene. In one embodiment, G 1 is C7alkenylene. In one embodiment, G 1 is straight chained. In one embodiment, G 1 is branched. In one embodiment, G 1 is divalent. In one embodiment, G 1 is trivalent.
[0167] In one embodiment, G 2 is a bond. In one embodiment, G 2 is C2-C 12 alkylene. In one embodiment, G 2 is C4-C8alkylene. In one embodiment, G 2 is C5-C7alkylene. In one embodiment, G 2 is C2alkylene. In one embodiment, G 2 is C3alkylene. In one embodiment, G 2 is C4alkylene. In one embodiment, G 2 is C5alkylene. In one embodiment, G 2 is C6alkylene. In one embodiment, G 2 is C7alkylene. In one embodiment, G 2 is C2-C12 In one embodiment, G 2 In one embodiment, G 2 In one embodiment, G 2 In one embodiment, G 2 In one embodiment, G 2 In one embodiment, G 2 In one embodiment, G 2 In one embodiment, G 2 It's trivalent.
[0168] In one embodiment, G 1 and G 2 Each independently is C2-C 12 In one embodiment, G 1 and G 2 Each is independently C5 alkylene. In one embodiment, G 1 and G 2 are each independently a C7 alkylene group.
[0169] In one embodiment, G 1 One or more -CH2- in G are replaced by -O-. 1 In one embodiment, one or more non-terminal -CH2- in G is replaced by -O-. 1 In one embodiment, one non-terminal -CH2- in G is replaced by -O-. 1 It is (C2-C5 alkylene)-O-(C2-C6 alkylene).
[0170] In one embodiment, G 1 yes In one embodiment, G 1 yes In one embodiment, G 1 yes In one embodiment, G 1 yes In one embodiment, G 1 yes In one embodiment, G 1 yes In one embodiment, G 1 yes In one embodiment, G 1 yes In one embodiment, G 1 yes
[0171] In one embodiment, G 2 is substituted with -O- at one or more of the non-terminal -CH2- groups. In one embodiment, G 2 is substituted with -O- at one or more of the non-terminal -CH2- groups. In one embodiment, G 2 is substituted with -O- at one non-terminal -CH2- group. In one embodiment, G 2 is (C2-C5alkylene)-O-(C2-C6alkylene).
[0172] In one embodiment, G 2 is In one embodiment, G 2 is In one embodiment, G 2 is In one embodiment, G 2 is In one embodiment, G 2 is In one embodiment, G 2 is In one embodiment, G 2 is In one embodiment, G 2 is In one embodiment, G 2 is
[0173] In one embodiment, the compound is a compound of Formula (IV):
[0174]
[0175] wherein s is an integer from 2 to 12,
[0176] y is an integer from 2 to 12; and
[0177] z is an integer from 2 to 12;
[0178] or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof.
[0179] In one embodiment, the compound is a compound of Formula (IV-A), (IV-B), (IV-C), (IV-D), (IV-E), (IV-F), (IV-G), or (IV-H):
[0180]
[0181] or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof.
[0182] In one embodiment, the compound is a compound of Formula (V):
[0183]
[0184] wherein y is an integer from 2 to 12; and
[0185] z is an integer from 2 to 12;
[0186] or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof.
[0187] In one embodiment, the compound is a compound of Formula (V-A), (V-B), (V-C), (V-D), (V-E), (V-F), (V-G), or (V-H):
[0188]
[0189] or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof.
[0190] In one embodiment, y and z are each independently an integer from 2 to 10. In one embodiment, y and z are each independently an integer from 2 to 6. In one embodiment, y and z are each independently an integer from 4 to 10.
[0191] In one embodiment, y and z are different. In one embodiment, y and z are the same. In one embodiment, y and z are the same and are selected from 4, 5, 6, 7, 8, and 9. In one embodiment, y is 5 and z is 5.
[0192] In one embodiment, s is an integer from 2 to 12. In one embodiment, s is an integer from 2 to 8. In one embodiment, s is an integer from 2 to 6. In one embodiment, s is an integer from 2 to 4. In one embodiment, s is 2. In one embodiment, s is 3. In one embodiment, s is 4. In one embodiment, s is 5. In one embodiment, s is 6.
[0193] In one embodiment, y is 5, z is 5, and s is 2.
[0194] In one embodiment, L 1 is R 1 .
[0195] In one embodiment, L 1 is -OC(=O)R 1 , -C(=O)OR 1 , -OC(=O)OR1 、-C(=O)R 1 、-OR 1 、-S(O) x R 1 、-S-SR 1 、-C(=O)SR 1 、-SC(=O)R 1 、-NR a C(=O)R 1 、-C(=O)NR b R c 、-NR a C(=O)NR b R c 、-OC(=O)NR b R c 、-NR a C(=O)OR 1 、-SC(=S)R 1 、-C(=S)SR 1 、-C(=S)R 1 、-CH(OH)R 1 、-P(=O)(OR b )(OR c ),-NR a P(=O)(OR b )(OR c ) or -(4- to 8-membered heterocyclylene)-R 1 In one embodiment, L 1 Yes-OC(=O)R 1 、-C(=O)OR 1 、-C(=O)SR 1 、-SC(=O)R 1 、-NR a C(=O)R 1 or -C(=O)NR b R c In one embodiment, L 1 Yes-OC(=O)R 1 、-C(=O)OR 1 、-NR a C(=O)R 1 or -C(=O)NR b R c In one embodiment, L 1 Yes-OC(=O)R 1 In one embodiment, L 1 is -C(=O)OR 1 In one embodiment, L 1 Yes-NRa C(=O)R 1 In one embodiment, L 1 is -C(=O)NR b R c In one embodiment, L 1 is -OR 1 In one embodiment, L 1 is -NR a P(=O)(OR b )(OR c ). In one embodiment, L 1 is -(4- to 8-membered heterocyclyl)-R 1 In one embodiment, L 1 is
[0196] In one embodiment, L 2 is R 2 .
[0197] In one embodiment, L 2 is -OC(=O)R 2 , -C(=O)OR 2 , -OC(=O)OR 2 , -C(=O)R 2 , -OR 2 , -S(O) x R 2 , -S-SR 2 , -C(=O)SR 2 , -SC(=O)R 2 , -NR d C(=O)R 2 , -C(=O)NR e R f , -NR d C(=O)NR e R f , -OC(=O)NR e R f , -NR d C(=O)OR 2 , -SC(=S)R 2 , -C(=S)SR 2 , -C(=S)R 2 , -CH(OH)R 2 , -P(=O)(OR e )(OR f ), or -NR d P(=O)(OR e )(OR f-(4- to 8-membered heterocyclyl)-R 2 In one embodiment, L 2 is -OC(=O)R 2 , -C(=O)OR 2 , -C(=O)SR 2 , -SC(=O)R 2 , -NR d C(=O)R 2 , or -C(=O)NR e R f In one embodiment, L 2 is -OC(=O)R 2 , -C(=O)OR 2 , -NR d C(=O)R 2 , or -C(=O)NR e R f In one embodiment, L 2 is -OC(=O)R 2 In one embodiment, L 2 is -C(=O)OR 2 In one embodiment, L 2 is -NR d C(=O)R 2 In one embodiment, L 2 is -C(=O)NR e R f In one embodiment, L 2 is -OR 2 In one embodiment, L 2 is -NR d P(=O)(OR e )(OR f ). In one embodiment, L 2 is -(4- to 8-membered heterocyclyl)-R 2 In one embodiment, L 2 is
[0198] In one embodiment, L 1 is -C(=O)OR 1 or -C(=O)NR b R c ; and L 2 is -C(=O)OR 2 or -C(=O)NR e R f In one embodiment, L 1 is -C(=O)OR 1 .and L 2 is -C(=O)OR 2 In one embodiment, L 1 is -C(=O)OR 1 and L 2 is -C(=O)NR e R f In one embodiment, L 1 is -C(=O)NR b R c and L 2 is -C(=O)OR 2 In one embodiment, L 1 is -C(=O)NR b R c and L 2 is -C(=O)NR e R f .
[0199] In one embodiment, L 1 is -OC(=O)R 1 or -NR a C(=O)R 1 ; and L 2 is -OC(=O)R 2 or -NR d C(=O)R 2 In one embodiment, L 1 is -OC(=O)R 1 and L 2 is -OC(=O)R 2 In one embodiment, L 1 is -OC(=O)R 1 and L 2 is -NR d C(=O)R 2 In one embodiment, L 1 is -NR a C(=O)R 1 and L 2 is -OC(=O)R 2 In one embodiment, L 1 is -NR a C(=O)R 1 and L 2 is -NR d C(=O)R 2 .
[0200] In one embodiment, L 1 is -OR 1 and L2 -C(=O)OR 2 In one embodiment, L 1 is -OR 1 In one embodiment, L 2 -C(=O)NR e R f In one embodiment, L 1 -C(=O)OR 1 In one embodiment, L 2 is -OR 2 In one embodiment, L 1 -C(=O)NR b R c In one embodiment, L 2 is -OR 2 .
[0201] In one embodiment, the compound is a compound of Formula (VI):
[0202]
[0203] wherein z is an integer from 2 to 12;
[0204] or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof.
[0205] In one embodiment, z is an integer from 2 to 10. In one embodiment, z is an integer from 2 to 6. In one embodiment, z is an integer from 4 to 10. In one embodiment, z is selected from the group consisting of 4, 5, 6, 7, 8, and 9. In one embodiment, z is 5.
[0206] In one embodiment, R 3 is C1-C 12 alkyl. In one embodiment, R 3 is C1-C8alkyl. In one embodiment, R 3 is C1-C6alkyl. In one embodiment, R 3 is C1-C4alkyl. In one embodiment, the alkyl group is a straight chain alkyl group. In one embodiment, the alkyl group is a branched chain alkyl group. In one embodiment, R 3 is methyl. In one embodiment, R 3 is ethyl. In one embodiment, R 3 is n-propyl. In one embodiment, R 3 is iso-propyl. In one embodiment, R 3 is n-butyl. In one embodiment, R 3 is n-pentyl. In one embodiment, R 3 is n-hexyl. In one embodiment, R3 is n-octyl. In one embodiment, R 3 is n-nonyl.
[0207] In one embodiment, R 3 is C2-C 12 alkenyl. In one embodiment, R 3 is C2-C8alkenyl. In one embodiment, R 3 is C2-C4alkenyl. In one embodiment, the alkenyl is straight chain alkenyl. In one embodiment, the alkenyl is branched chain alkenyl. In one embodiment, R 3 is ethenyl. In one embodiment, R 3 is allyl.
[0208] In one embodiment, R 3 is C2-C 12 alkynyl. In one embodiment, R 3 is C2-C8alkynyl. In one embodiment, R 3 is C2-C4alkynyl. In one embodiment, the alkynyl is straight chain alkynyl. In one embodiment, the alkynyl is branched chain alkynyl.
[0209] In one embodiment, R 3 is C3-C8cycloalkyl. In one embodiment, R 3 is cyclopropyl. In one embodiment, R 3 is cyclobutyl. In one embodiment, R 3 is cyclopentyl. In one embodiment, R 3 is cyclohexyl. In one embodiment, R 3 is cycloheptyl. In one embodiment, R 3 is cyclooctyl.
[0210] In one embodiment, R 3 is C3-C8cycloalkenyl. In one embodiment, R 3 is cyclopropenyl. In one embodiment, R 3 is cyclobutenyl. In one embodiment, R 3 is cyclopentenyl. In one embodiment, R 3 is cyclohexenyl. In one embodiment, R 3 is cycloheptenyl. In one embodiment, R 3 is cyclooctenyl.
[0211] In one embodiment, R 3 is 4- to 8-membered heterocyclyl. In one embodiment, R 3 is 4- to 8-membered heterocycloalkyl. In one embodiment, R3 In one embodiment, R 3 In one embodiment, R 3 In one embodiment, R 3 It is tetrahydrothiopyranyl.
[0212] In one embodiment, R 3 It is C6-C 10 In one embodiment, R 3 It is phenyl.
[0213] In one embodiment, R 3 is a 5- to 10-membered heteroaryl. In one embodiment, R 3 is a 5-membered heteroaryl. In one embodiment, R 3 It is a 6-membered heteroaryl group.
[0214] In one embodiment, R 3 , G 1 or G 1 A portion of the alkyl group together with the nitrogen to which it is attached forms a cyclic portion.
[0215] In one embodiment, the compound is of formula (VII):
[0216]
[0217] Where s is an integer from 2 to 12,
[0218] u is 1, 2, or 3;
[0219] v is 1, 2, or 3;
[0220] y' is an integer from 0 to 10; and
[0221] z is an integer from 2 to 12;
[0222] or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
[0223] In one embodiment, R 3 , G 3 or G 3 A portion of the alkyl group together with the nitrogen to which it is attached forms a cyclic portion.
[0224] In one embodiment, the compound is of Formula (VIII-A), (VIII-B), (VIII-C), (VIII-D), (VIII-E), (VIII-F), or (VIII-G):
[0225]
[0226] wherein s' is an integer from 0 to 10,
[0227] u is 1, 2, or 3;
[0228] v is 1, 2, or 3;
[0229] y is an integer from 2 to 12;
[0230] z is an integer from 2 to 12;
[0231] y0 is an integer from 1 to 11;
[0232] z0 is an integer from 1 to 11;
[0233] y1 is an integer from 0 to 9; and
[0234] z1 is an integer from 0 to 9;
[0235] or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof.
[0236] In one embodiment, u is 1. In one embodiment, u is 2. In one embodiment, u is 3. In one embodiment, v is 1. In one embodiment, v is 2. In one embodiment, v is 3. In one embodiment, u is 1, and v is 1. In one embodiment, u is 2, and v is 2. In one embodiment, u is 3, and v is 3.
[0237] In one embodiment, the compound is a compound of Formula (IX-A), (IX-B), (IX-C), (IX-D), (IX-E), (IX-F), (IX-G), (IX-H), (IX-I), (IX-J), (IX-K), (IX-L), (IX-M), (IX-N), (IX-O), (IX-P), (IX-Q), (IX-R), (IX-S), (IX-T), (IX-U), (IX-V), (IX-W), (IX-X), (IX-Y), (IX-Z), or (IX-AA):
[0238]
[0239]
[0240] wherein s is an integer from 2 to 12,
[0241] y is an integer from 2 to 12;
[0242] z is an integer from 2 to 12;
[0243] y0 is an integer from 1 to 11;
[0244] z0 is an integer from 1 to 11 ;
[0245] y1 is an integer from 0 to 9;
[0246] z1 is an integer from 0 to 9;
[0247] y2 is an integer from 2 to 5;
[0248] y3 is an integer from 2 to 6;
[0249] y4 is an integer from 0 to 3;
[0250] y5 is an integer from 1 to 5;
[0251] z2 is an integer from 2 to 5;
[0252] z3 is an integer from 2 to 6;
[0253] z4 is an integer from 0 to 3; and
[0254] z5 is an integer from 1 to 5;
[0255] or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof.
[0256] In one embodiment, y0 is an integer from 1 to 7. In one embodiment, y0 is 1. In one embodiment, y0 is 2. In one embodiment, y0 is 3. In one embodiment, y0 is 4. In one embodiment, y0 is 5. In one embodiment, y0 is 6. In one embodiment, y0 is 7. In one embodiment, z0 is an integer from 1 to 7. In one embodiment, z0 is 1. In one embodiment, z0 is 2. In one embodiment, z0 is 3. In one embodiment, z0 is 4. In one embodiment, z0 is 5. In one embodiment, z0 is 6. In one embodiment, z0 is 7.
[0257] In one embodiment, y1 is an integer from 2 to 6. In one embodiment, y1 is 2. In one embodiment, y1 is 3. In one embodiment, y1 is 4. In one embodiment, y1 is 5. In one embodiment, y1 is 6. In one embodiment, z1 is an integer from 2 to 6. In one embodiment, z1 is 2. In one embodiment, z1 is 3. In one embodiment, z1 is 4. In one embodiment, z1 is 5. In one embodiment, z1 is 6.
[0258] In one embodiment, y2 is 2. In one embodiment, y2 is 3. In one embodiment, y2 is 4. In one embodiment, y2 is 5. In one embodiment, z2 is 2. In one embodiment, z2 is 3. In one embodiment, z2 is 4. In one embodiment, z2 is 5.
[0259] In one embodiment, y3 is 2. In one embodiment, y3 is 3. In one embodiment, y3 is 4. In one embodiment, y3 is 5. In one embodiment, y3 is 6. In one embodiment, z3 is 2. In one embodiment, z3 is 3. In one embodiment, z3 is 4. In one embodiment, z3 is 5. In one embodiment, z3 is 6.
[0260] In one embodiment, y4 is 0. In one embodiment, y4 is 1. In one embodiment, y4 is 2. In one embodiment, y4 is 3. In one embodiment, z4 is 0. In one embodiment, z4 is 1. In one embodiment, z4 is 2. In one embodiment, z4 is 3.
[0261] In one embodiment, y5 is 1. In one embodiment, y5 is 2. In one embodiment, y5 is 3. In one embodiment, y5 is 4. In one embodiment, y5 is 5. In one embodiment, z5 is 1. In one embodiment, z5 is 2. In one embodiment, z5 is 3. In one embodiment, z5 is 4. In one embodiment, z5 is 5.
[0262] In one embodiment, y2 is 2 and y3 is 2. In one embodiment, y2 is 2 and y4 is 1. In one embodiment, z2 is 2 and z3 is 2. In one embodiment, z2 is 2 and z4 is 1.
[0263] In one embodiment, s, y, z, L 1 and L 2 are as defined elsewhere. In one embodiment, L 1 is -OR 1 , -OC(=O)R 1 , -C(=O)OR 1 , or -C(=O)NR b R c ; and L 2 is -OR 2 , -OC(=O)R 2 , -C(=O)OR 2 , or -C(=O)NR e R fIn one embodiment, when there are two L 1 each L 1 is independently -OC(=O)R 1 In one embodiment, when there are two L 2 each L 2 is independently -OC(=O)R 2 In one embodiment, when there is only one L 1 L 1 is -C(=O)OR 1 In one embodiment, when there is only one L 1 L 1 is -C(=O)NR b R c In one embodiment, when there is only one L 2 L 2 is -C(=O)OR 2 In one embodiment, when there is only one L 2 L 2 is -C(=O)NR e R f .
[0264] In one particular embodiment of any one of Formulas (IX-A) to (IX-AA), when there is only one L 1 L 1 is -C(=O)OR 1 In another embodiment, L 1 is -C(=O)NR b R c In one embodiment, R 1 or R c is -R 7 -CH(R 8 )(R 9 ), wherein R 7 is a C0-C1 alkylene and R 8 and R 9 are independently C4-C8 alkyl.
[0265] In one particular embodiment of any one of Formulas (IX-A) to (IX-AA), when there is only one L 2 L 2 is -C(=O)OR 2 In another embodiment, L 2 is -C(=O)NR e R f In one embodiment, R 2 or R f is -R7 -CH(R 8 )(R 9 ), wherein R 7 is C0-C1alkylene, and R 8 and R 9 are independently C4-C8alkyl.
[0266] In one embodiment of any of Formulas (IX-A) to (IX-AA), when the moiety is present, each L 1 is independently -OC(=O)R 1 . In one embodiment, each R 1 is independently linear C7-C 11 alkyl.
[0267] In one embodiment of any of Formulas (IX-A) to (IX-AA), when the moiety is present, each L 2 is independently -OC(=O)R 2 . In one embodiment, each R 2 is independently linear C7-C 11 alkyl.
[0268] In one embodiment of any of Formulas (IX-A) to (IX-AA), when the moiety is present, each L 1 is independently -OR 1 . In another embodiment, each L 1 is independently -C(=O)OR 1 . In one embodiment, each R 1 is independently linear C7-C 11 alkyl.
[0269] In one embodiment of any of Formulas (IX-A) to (IX-AA), when the moiety is present, each L 2 is independently -OR 2 . In another embodiment, each L 2 is independently -C(=O)OR 2 . In one embodiment, each R 2 is independently linear C7-C 11 alkyl.
[0270] In one embodiment, R 3 is unsubstituted.
[0271] In one embodiment, R 3substituted with one or more substituents selected from the group consisting of C1-C6alkyl, halo, C1-C6haloalkyl, nitro, oxo, -OR g , -NR g C(=O)R h , -C(=O))NR g R h , -C(=O)R h , -OC(=O)R h , -C(=O)OR h , and -O-R i -OH, wherein:
[0272] R g is, at each occurrence, independently H or C1-C6alkyl;
[0273] R h is, at each occurrence, independently C1-C6alkyl; and
[0274] R i is, at each occurrence, independently C1-C6alkylene.
[0275] In one embodiment, R 3 is substituted with one or more C1-C6alkyl (e.g., methyl). In one embodiment, R 3 is substituted with one or more halo (e.g., -F). In one embodiment, R 3 is substituted with one or more C1-C6haloalkyl (e.g., -CF3). In one embodiment, R 3 is substituted with one or more hydroxyl. In one embodiment, R 3 is substituted with one hydroxyl.
[0276] In one embodiment, R 3 is substituted with one or more C3-C8cycloalkyl, C6-C 10 aryl, or 5- to 10-membered heteroaryl, each of which is optionally substituted. In one embodiment, R 3 is C1-C6alkyl (e.g., methyl) substituted with one or more C3-C8cycloalkyl, C6-C 10 aryl, or 5- to 10-membered heteroaryl, each of which is optionally substituted. In one embodiment, the C3-C8cycloalkyl, C6-C 10 aryl, or 5- to 10-membered heteroaryl is not substituted. In one embodiment, the C3-C8cycloalkyl, C6-C 10 aryl, or 5- to 10-membered heteroaryl is substituted with one or more C1-C6alkyl, halo, C1-C6haloalkyl, nitro, hydroxyl, or cyano.
[0277] In one embodiment, R 4 is C1-C 12 alkyl. In one embodiment, R 4 is C1-C8alkyl. In one embodiment, R 4 is C1-C6alkyl. In one embodiment, R 4 is C1-C4alkyl. In one embodiment, R 4 is methyl. In one embodiment, R 4 is ethyl. In one embodiment, R 4 is n-propyl. In one embodiment, R 4 is i-propyl. In one embodiment, R 4 is n-butyl. In one embodiment, R 4 is n-pentyl. In one embodiment, R 4 is n-hexyl. In one embodiment, R 4 is n-octyl. In one embodiment, R 4 is n-nonyl.
[0278] In one embodiment, R 4 is C3-C8cycloalkyl. In one embodiment, R 4 is cyclopropyl. In one embodiment, R 4 is cyclobutyl. In one embodiment, R 4 is cyclopentyl. In one embodiment, R 4 is cyclohexyl. In one embodiment, R 4 is cycloheptyl. In one embodiment, R 4 is cyclooctyl.
[0279] In one embodiment, R 4 is unsubstituted.
[0280] In one embodiment, R 4 is substituted with one or more substituents selected from the group consisting of oxo, -OR g , -NR g C(=O)R h , -C(=O)NR g R h , -C(=O)R h , -OC(=O)R h , -C(=O)OR h , -O-R i -OH and -N(R 10 )R 11 , wherein:
[0281] R gindependently at each occurrence H or C1-C6alkyl;
[0282] R h independently at each occurrence C1-C6alkyl;
[0283] R i independently at each occurrence C1-C6alkylene;
[0284] R 10 is hydrogen or C1-C6alkyl;
[0285] R 11 is C1-C6alkyl, C3-C8cycloalkyl, or C3-C8cycloalkenyl;
[0286] or R 10 and R 11 together with the nitrogen to which they are attached form a cyclic moiety; and
[0287] R 11 or cyclic moiety is optionally substituted with one or more of hydroxyl, oxo, -NH2, -NH(C1-C6alkyl), or -N(C1-C6alkyl)2.
[0288] In one embodiment, R 4 is substituted with one or more hydroxyl groups. In one embodiment, R 4 is substituted with one hydroxyl group.
[0289] In one embodiment, R 4 is substituted C1-C 12 alkyl. In one embodiment, R 4 is -(CH2) p Q, -(CH2) p CHQR, -CHQR, or -CQ(R)2, wherein Q is C3-C8cycloalkyl, C3-C8cycloalkenyl, C3-C8cycloalkynyl, 4- to 8-membered heterocyclyl, C6-C 10 aromatic, 5- to 10-membered heteroaromatic, -OR, -O(CH2) p N(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -N(R)2, -C(O)N(R)2, -N(R)C(O)R, -N(R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -N(R)R 22 , -O(CH2) p OR, -N(R)C(=NR 23 )N(R)2, -N(R)C(=CHR 23)N(R)2, -OC(O)N(R)2, -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O)2R, -N(OR)C(O)OR, -N(OR)C(O)N(R)2, -N(OR)C(S)N(R)2, -N(OR)C(=NR 23 )N(R)2, -N(OR)C(=CHR 23 )N(R)2, -C(=NR 23 )N(R)2, -C(=NR 23 )R, -C(O)N(R)OR, or -C(R)N(R)2C(O)OR, and each p is independently 1, 2, 3, 4, or 5;
[0290] R 22 is C3-C8cycloalkyl, C3-C8cycloalkenyl, C3-C8cycloalkynyl, 4- to 8-membered heterocyclyl, C6-C 10 aryl, or 5- to 10-membered heteroaryl;
[0291] R 23 is H, -CN, -NO2, C1-C6alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C2-C6alkenyl, C3-C8cycloalkyl, C3-C8cycloalkenyl, C3-C8cycloalkynyl, 4- to 8-membered heterocyclyl, C6-C 10 aryl, or 5- to 10-membered heteroaryl;
[0292] each R is independently H, C1-C3alkyl, or C2-C3alkenyl; or two R in the N(R)2moiety, together with the nitrogen to which they are attached, form a cyclic moiety; and
[0293] each X is independently F, CI, Br, or I.
[0294] In one embodiment, R 4 is -CH2CH2OH. In one embodiment, R 4 is -CH2CH2CH2OH. In one embodiment, R 4 is -CH2CH2CH2CH2OH. In one embodiment, R 4 is -CH2CH2OCH2CH2OH.
[0295] In one embodiment, R 4 is substituted with one or more -N(R 10 )R 11 . In one embodiment, R 4 is substituted with one -N(R 10 )R 11 . In one embodiment, R
[0296] In one embodiment, R 10 is hydrogen.
[0297] In one embodiment, R 11 is C3-C8 cycloalkenyl. In one embodiment, R 11 is cyclobutenyl. In one embodiment, R 11 is substituted with one or more of oxo, -NH2, -NH(Ci-C6 alkyl), or -N(Ci-C6 alkyl)2.
[0298] In one embodiment, R 10 and R 11 together with the nitrogen to which they are attached form a cyclic moiety. In one embodiment, the cyclic moiety is 5- to 10-membered heteroaryl. In one embodiment, the cyclic moiety is pyrimidin-1-yl. In one embodiment, the cyclic moiety is purin-9-yl. In one embodiment, the cyclic moiety is substituted with one or more of oxo, -NH2, -NH(Ci-C6 alkyl), or -N(Ci-C6 alkyl)2.
[0299] In one embodiment, R 4 is substituted with In one embodiment, R 4 is substituted with In one embodiment, R 4 is substituted with In one embodiment, R
[0300] In one embodiment, R 1 is straight chain C6-C 24 alkyl. In one embodiment, R 1 is straight chain C7-C 15 alkyl. In one embodiment, R 1 is straight chain C7 alkyl. In one embodiment, R 1 is straight chain C8 alkyl. In one embodiment, R 1 is straight chain C9 alkyl. In one embodiment, R 1 is straight chain C 10 alkyl. In one embodiment, R 1 is straight chain C 11 alkyl. In one embodiment, R 1 is straight chain C 12 alkyl. In one embodiment, R 1 is straight chain C 13 alkyl. In one embodiment, R 1 is straight chain C 14 alkyl. In one embodiment, R1 is straight chain C6-C 15 alkyl.
[0301] In one embodiment, R 1 is straight chain C6-C 24 alkyl. In one embodiment, R 1 is straight chain C7-C 17 alkyl. In one embodiment, R 1 is straight chain C7 alkyl. In one embodiment, R 1 is straight chain C8 alkyl. In one embodiment, R 1 is straight chain C9 alkyl. In one embodiment, R 1 is straight chain C 10 alkyl. In one embodiment, R 1 is straight chain C 11 alkyl. In one embodiment, R 1 is straight chain C 12 alkyl. In one embodiment, R 1 is straight chain C 13 alkyl. In one embodiment, R 1 is straight chain C 14 alkyl. In one embodiment, R 1 is straight chain C 15 alkyl. In one embodiment, R 1 is straight chain C 16 alkyl. In one embodiment, R 1 is straight chain C 17 alkyl.
[0302] In one embodiment, R 1 is branched C6-C 24 alkyl. In one embodiment, R 1 is -R 7 -CH(R 8 )(R 9 ), wherein R 7 is C0-C5 alkylene, and R 8 and R 9 are independently C2-C 10 alkyl. In one embodiment, R 1 is -R 7 -CH(R 8 )(R 9 ), wherein R 7 is C0-C1 alkylene, and R 8 and R 9 are independently C4-C8 alkyl.
[0303] In one embodiment, R1 is branched C6-C 24 alkenyl. In one embodiment, R 1 is -R 7 -CH(R 8 )(R 9 ), wherein R 7 is C0-C5alkylene, and R 8 and R 9 are independently C2-C 10 alkenyl. In one embodiment, R 1 is -R 7 -CH(R 8 )(R 9 ), wherein R 7 is C0-C1alkylene, and R 8 and R 9 are independently C6-C 10 alkenyl.
[0304] In one embodiment, R 2 is straight chain C6-C 24 alkyl. In one embodiment, R 2 is straight chain C7-C 15 alkyl. In one embodiment, R 2 is straight chain C7alkyl. In one embodiment, R 2 is straight chain C8alkyl. In one embodiment, R 2 is straight chain C9alkyl. In one embodiment, R 2 is straight chain C 10 alkyl. In one embodiment, R 2 is straight chain C 11 alkyl. In one embodiment, R 2 is straight chain C 12 alkyl. In one embodiment, R 2 is straight chain C 13 alkyl. In one embodiment, R 2 is straight chain C 14 alkyl. In one embodiment, R 2 is straight chain C 15 alkyl.
[0305] In one embodiment, R 2 is straight chain C6-C 24 alkenyl. In one embodiment, R 2 is straight chain C7-C 17 alkenyl. In one embodiment, R 2 is straight chain C7alkenyl. In one embodiment, R 2is straight-chain C8alkenyl. In one embodiment, R 2 is straight-chain C9alkenyl. In one embodiment, R 2 is straight-chain C 10 alkenyl. In one embodiment, R 2 is straight-chain C 11 alkenyl. In one embodiment, R 2 is straight-chain C 12 alkenyl. In one embodiment, R 2 is straight-chain C 13 alkenyl. In one embodiment, R 2 is straight-chain C 14 alkenyl. In one embodiment, R 2 is straight-chain C 15 alkenyl. In one embodiment, R 2 is straight-chain C 16 alkenyl. In one embodiment, R 2 is straight-chain C 17 alkenyl.
[0306] In one embodiment, R 2 is branched C6-C 24 alkyl. In one embodiment, R 2 is -R 7 -CH(R 8 )(R 9 ), wherein R 7 is C0-C5alkylene, and R 8 and R 9 are independently C2-C 10 alkyl. In one embodiment, R 2 is -R 7 -CH(R 8 )(R 9 ), wherein R 7 is C0-C1alkylene, and R 8 and R 9 are independently C4-C8alkyl.
[0307] In one embodiment, R 2 is branched C6-C 24 alkenyl. In one embodiment, R 2 is -R 7 -CH(R 8 )(R 9 ), wherein R 7 is C0-C5alkylene, and R 8 and R 9 are independently C2-C 10 alkenyl. In one embodiment, R2 is -R 7 -CH(R 8 )(R 9 ), wherein R 7 is C0-C1alkylene and R 8 and R 9 are independently C6-C 10 alkenyl.
[0308] In one embodiment, R c is linear C6-C 24 alkyl. In one embodiment, R c is linear C7-C 15 alkyl. In one embodiment, R c is linear C7alkyl. In one embodiment, R c is linear C8alkyl. In one embodiment, R c is linear C9alkyl. In one embodiment, R c is linear C 10 alkyl. In one embodiment, R c is linear C 11 alkyl. In one embodiment, R c is linear C 12 alkyl. In one embodiment, R c is linear C 13 alkyl. In one embodiment, R c is linear C 14 alkyl. In one embodiment, R c is linear C 15 alkyl.
[0309] In one embodiment, R c is linear C6-C 24 alkenyl. In one embodiment, R c is linear C7-C 17 alkenyl. In one embodiment, R c is linear C7alkenyl. In one embodiment, R c is linear C8alkenyl. In one embodiment, R c is linear C9alkenyl. In one embodiment, R c is linear C 10 alkenyl. In one embodiment, R c is linear C 11 alkenyl. In one embodiment, R c is linear C 12 alkenyl. In one embodiment, R c is linear C 13alkyl. In one embodiment, R c is straight chain C 14 alkyl. In one embodiment, R c is straight chain C 15 alkyl. In one embodiment, R c is straight chain C 16 alkyl. In one embodiment, R c is straight chain C 17 alkyl.
[0310] In one embodiment, R c is branched C6-C 24 alkyl. In one embodiment, R c is -R 7 -CH(R 8 )(R 9 ), wherein R 7 is C0-C5 alkylene, and R 8 and R 9 are independently C2-C 10 alkyl. In one embodiment, R c is -R 7 -CH(R 8 )(R 9 ), wherein R 7 is C0-C1 alkylene, and R 8 and R 9 are independently C4-C8 alkyl.
[0311] In one embodiment, R c is branched C6-C 24 alkenyl. In one embodiment, R c is -R 7 -CH(R 8 )(R 9 ), wherein R 7 is C0-C5 alkylene, and R 8 and R 9 are independently C2-C 10 alkenyl. In one embodiment, R c is -R 7 -CH(R 8 )(R 9 ), wherein R 7 is C0-C1 alkylene, and R 8 and R 9 are independently C6-C 10 alkenyl.
[0312] In one embodiment, R f is straight chain C6-C 24 alkenyl.alkyl. In one embodiment, R is straight chain C7-C9alkyl. In one embodiment, R is straight chain C7alkyl. In one embodiment, R is straight chain C8alkyl. In one embodiment, R is straight chain C9alkyl. In one embodiment, R is straight chain C10alkyl. In one embodiment, R is straight chain C11alkyl. In one embodiment, R is straight chain C12alkyl. In one embodiment, R is straight chain C13alkyl. In one embodiment, R is straight chain C14alkyl. In one embodiment, R is straight chain C15alkyl. In one embodiment, R is straight chain C16alkyl. In one embodiment, R is straight chain C17alkyl. In one embodiment, R is straight chain C18alkyl. In one embodiment, R is straight chain C19alkyl. In one embodiment, R is straight chain C20alkyl. f 15 f f f f 10 f 11 f 12 f 13 f 14 f 15
[0313] f 24 f 17 f f f f 10 f 11 f 12 f 13 f 14 f 15 f 16 f
[0314] 17 In one embodiment, R is straight chain C6-C10alkenyl. In one embodiment, R is straight chain C7-C10alkenyl. In one embodiment, R is straight chain C7-C10alkenyl. In one embodiment, R is straight chain C7alkenyl. In one embodiment, R is straight chain C8alkenyl. In one embodiment, R is straight chain C9alkenyl. In one embodiment, R is straight chain C10alkenyl. In one embodiment, R is straight chain C11alkenyl. In one embodiment, R is straight chain C12alkenyl. In one embodiment, R is straight chain C13alkenyl. In one embodiment, R is straight chain C14alkenyl. In one embodiment, R is straight chain C15alkenyl. In one embodiment, R is straight chain C16alkenyl. In one embodiment, R is straight chain C17alkenyl. In one embodiment, R is straight chain C18alkenyl. In one embodiment, R is straight chain C19alkenyl. In one embodiment, R is straight chain C20alkenyl.f is branched C6-C 24 alkyl. In one embodiment, R f is -R 7 -CH(R 8 )(R 9 ), wherein R 7 is C0-C5 alkylene, and R 8 and R 9 are independently C2-C 10 alkyl. In one embodiment, R f is -R 7 -CH(R 8 )(R 9 ), wherein R 7 is C0-C1 alkylene, and R 8 and R 9 are independently C4-C8 alkyl.
[0315] In one embodiment, R f is branched C6-C 24 alkenyl. In one embodiment, R f is -R 7 -CH(R 8 )(R 9 ), wherein R 7 is C0-C5 alkylene, and R 8 and R 9 are independently C2-C 10 alkenyl. In one embodiment, R f is -R 7 -CH(R 8 )(R 9 ), wherein R 7 is C0-C1 alkylene, and R 8 and R 9 are independently C6-C 10 alkenyl.
[0316] In one embodiment, R 1 , R 2 , R c , and R f are each independently linear C6-C 18 alkyl, linear C6-C 18 alkenyl, or -R 7 -CH(R 8 )(R 9 ), wherein R 7 is C0-C5 alkylene, and R 8 and R 9 are independently C2-C 10 alkyl or C2-C10 Alkenyl.
[0317] In one embodiment, R 1 、R 2 、R c and R f Each independently is a straight chain C7-C 15 Alkyl, straight chain C7-C 15 Alkenyl or -R 7 -CH(R 8 )(R 9 ), where R 7 is a C0-C1 alkylene group, and R 8 and R 9 are independently C4-C8 alkyl or C6-C 10 Alkenyl.
[0318] In one embodiment, R 1 、R 2 、R c and R f Each independently is one of the following structures:
[0319]
[0320] In one embodiment, R a is H. In one embodiment, R d is H. In one embodiment, R a 、R b 、R d and R e are each independently H. In one embodiment, R b It is C1-C 24 In one embodiment, R b It is C1-C 12 In one embodiment, R b It is C2-C 24 In one embodiment, R b It is C2-C 12 In one embodiment, R e It is C1-C 24 In one embodiment, R e It is C1-C 12 In one embodiment, R e It is C2-C 24 In one embodiment, R e It is C2-C 12 Alkenyl.
[0321] In one embodiment, the compound is a compound in Table 1, or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof.
[0322] Table 1.
[0323]
[0324]
[0325]
[0326]
[0327]
[0328]
[0329]
[0330]
[0331]
[0332]
[0333]
[0334]
[0335]
[0336]
[0337]
[0338]
[0339]
[0340]
[0341]
[0342]
[0343] In one embodiment, the compound is a compound in Table 1A, or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof.
[0344] Table 1A.
[0345]
[0346]
[0347] In one embodiment, provided herein is a compound of Formula (X):
[0348]
[0349] or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof, wherein:
[0350] G 1 is a bond, C2-C 12 alkylene, or C2-C 12 alkenylene;
[0351] each L 1 is independently -OC(=O)R 1 , -C(=O)OR 1 , -OC(=O)OR 1 , -C(=O)R 1 , -OR 1 , -S(O) x R 1 , -S-SR 1 , -C(=O)SR 1 , -SC(=O)R 1 , -NR a C(=O)R 1 , -C(=O)NR b R c , -NR a C(=O)NR b R c , -OC(=O)NR b R c , -NR a C(=O)OR 1 , -SC(=S)R 1 , -C(=S)SR 1 , -C(=S)R 1 , -CH(OH)R 1 , -P(=O)(OR b )(OR c ), -(C6-C 10 arylene)-R 1 , -(6- to 10-membered heteroarylene)-R 1 , or R 1 ;
[0352] R 1 is C6-C 24 alkyl or C6-C 24 alkenyl;
[0353] R a and R b each independently is H, C1-C 12 alkyl or C2-C 12 alkenyl;
[0354] R c is C1-C 24 alkyl or C2-C 24 alkenyl;
[0355] R 3 is hydrogen, C1-C 12 alkyl, C2-C 12 alkenyl, C2-C 12 alkynyl, C3-C8 cycloalkyl, C3-C8 cycloalkenyl, C3-C8 cycloalkynyl, 4- to 8- membered heterocyclyl, C6-C 10 aryl, or 5- to 10-membered heteroaryl; or R 3 , G 1 or G 1 together with the nitrogen to which it is attached forms a cyclic moiety;
[0356] x is 0, 1, or 2;
[0357] n is 1 or 2; and
[0358] Z is -OH or halogen;
[0359] wherein each alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, heterocyclyl, aryl, heteroaryl, alkylene, alkenylene, cycloalkylene, cycloalkenylene, cycloalkynylene, heterocyclylene, arylene, heteroarylene, and cyclic moiety is independently optionally substituted.
[0360] In one embodiment, Z is -OH. In one embodiment, Z is halogen. In one embodiment, Z is -Cl.
[0361] In one embodiment, the compound of Formula (X) is an intermediate in a process for making a compound of Formula (I), for example, as exemplified in the Examples provided herein.
[0362] It should be understood that any of the embodiments of the compounds provided herein as illustrated above, as well as any particular substituents and / or variables of the compounds provided herein as illustrated above, can be independently combined with other embodiments and / or substituents and / or variables of the compounds to form embodiments not specifically set forth above. Additionally, where a list of substituents and / or variables of any particular group or variable is provided, it should be understood that each and every substituent and / or variable can be deleted from the particular embodiment and / or claim and the remaining list of substituents and / or variables is to be considered as being within the scope of the embodiments provided herein.
[0363] It should be understood that in the present specification, combinations of substituents and / or variables depicted by the various formulae are permissible only if such contributions result in stable compounds.
[0364] 5.4 Nanoparticle compositions
[0365] In one aspect, described herein are nanoparticle compositions comprising the lipid compounds described herein. In particular embodiments, the nanoparticle compositions comprise a compound according to Formula (I) (and its subformulae) as described herein.
[0366] In some embodiments, the maximum size of the nanoparticle compositions provided herein is 1 pm or less (e.g., < 1 pm, < 900 nm, < 800 nm, < 700 nm, < 600 nm, < 500 nm, < 400 nm, < 300 nm, < 200 nm, < 175 nm, < 150 nm, < 125 nm, < 100 nm, < 75 nm, < 50 nm, or less) when measured, e.g., by dynamic light scattering (DLS), transmission electron microscopy, scanning electron microscopy, or another method. In one embodiment, the lipid nanoparticles provided herein have at least one dimension in the range of about 40 nm to about 200 nm. In one embodiment, the at least one dimension is in the range of about 40 nm to about 100 nm.
[0367] Nanoparticle compositions that can be used in conjunction with the present disclosure include, for example, lipid nanoparticles (LNPs), nanolipoprotein particles, liposomes, lipid vesicles, and lipoplexes. In some embodiments, the nanoparticle compositions are vesicles comprising one or more lipid bilayers. In some embodiments, the nanoparticle compositions comprise two or more concentric bilayers separated by an aqueous compartment. The lipid bilayers can be functionalized and / or crosslinked to one another. The lipid bilayers can comprise one or more ligands, proteins, or channels.
[0368] The characteristics of a nanoparticle composition can depend on its components. For example, a nanoparticle composition comprising cholesterol as a structural lipid can have different characteristics than a nanoparticle composition comprising a different structural lipid. Similarly, the characteristics of a nanoparticle composition can depend on the absolute or relative amounts of its components. For example, a nanoparticle composition comprising a higher molar fraction of phospholipid can have different characteristics than a nanoparticle composition comprising a lower molar fraction of phospholipid. The characteristics can also vary depending on the method and conditions of preparation of the nanoparticle composition.
[0369] A nanoparticle composition can be characterized by a variety of methods. For example, microscopy (e.g., transmission electron microscopy or scanning electron microscopy) can be used to examine the morphology and size distribution of a nanoparticle composition. Dynamic light scattering or potentiometry (e.g., potentiometric titration) can be used to measure zeta potential. Dynamic light scattering can also be used to determine particle size. Instruments such as the Zetasizer Nano ZS (Malvern Instruments Ltd, Malvern, Worcestershire, UK) can also be used to measure a variety of characteristics of a nanoparticle composition, such as particle size, polydispersity index, and zeta potential.
[0370] Dh(size): The average size of a nanoparticle composition can be between tens of nanometers and hundreds of nanometers. For example, the average size can be about 40 nm to about 150 nm, such as about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm. In some embodiments, the average size of a nanoparticle composition can be about 50 nm to about 100 nm, about 50 nm to about 90 nm, about 50 nm to about 80 nm, about 50 nm to about 70 nm, about 50 nm to about 60 nm, about 60 nm to about 100 nm, about 60 nm to about 90 nm, about 60 nm to about 80 nm, about 60 nm to about 70 nm, about 70 nm to about 100 nm, about 70 nm to about 90 nm, about 70 nm to about 80 nm, about 80 nm to about 100 nm, about 80 nm to about 90 nm, or about 90 nm to about 100 nm. In certain embodiments, the average size of a nanoparticle composition can be about 70 nm to about 100 nm. In some embodiments, the average size can be about 80 nm. In other embodiments, the average size can be about 100 nm.
[0371] PDI: The nanoparticle composition can be relatively homogeneous. A polydispersity index can be used to indicate the homogeneity of the nanoparticle composition, e.g., the particle size distribution of the nanoparticle composition. A smaller (e.g., less than 0.3) polydispersity index generally indicates a narrower particle size distribution. The polydispersity index of the nanoparticle composition can be about 0 to about 0.25, e.g., 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of the nanoparticle composition can be about 0.10 to about 0.20.
[0372] Encapsulation efficiency: The encapsulation efficiency of a therapeutic agent and / or prophylactic agent describes the amount of therapeutic agent and / or prophylactic agent encapsulated or otherwise associated with the nanoparticle composition after preparation relative to the initial amount provided. The encapsulation efficiency desirably is high (e.g., close to 100%). The encapsulation efficiency can be measured, for example, by comparing the amount of therapeutic agent and / or prophylactic agent in a solution containing the nanoparticle composition before and after the nanoparticle composition is disrupted with one or more organic solvents or detergents. Fluorescence can be used to measure the amount of free therapeutic agent and / or prophylactic agent (e.g., RNA) in solution. For the nanoparticle compositions described herein, the encapsulation efficiency of the therapeutic agent and / or prophylactic agent can be at least 50%, e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency can be at least 80%. In certain embodiments, the encapsulation efficiency can be at least 90%.
[0373] Apparent pKa: The zeta potential of a nanoparticle composition can be used to indicate the zetapotential of the composition. For example, the zeta potential can describe the surface charge of the nanoparticle composition. Nanoparticle compositions with relatively lower positive or negative charge are generally desirable because substances with higher charge can have undesirable interactions with cells, tissues, and other components in the body. In some embodiments, the zeta potential of the nanoparticle composition can be from about -10 mV to about +20 mV, from about -10 mV to about +15 mV, from about -10 mV to about +10 mV, from about -10 mV to about +5 mV, from about -10 mV to about 0 mV, from about -10 mV to about -5 mV, from about -5 mV to about +20 mV, from about -5 mV to about +15 mV, from about -5 mV to about +10 mV, from about -5 mV to about +5 mV, from about -5 mV to about 0 mV, from about 0 mV to about +20 mV, from about 0 mV to about +15 mV, from about 0 mV to about +10 mV, from about 0 mV to about +5 mV, from about +5 mV to about +20 mV, from about +5 mV to about +15 mV, or from about +5 mV to about +10 mV.
[0374] In another embodiment, the self-replicating RNA can be formulated in a liposome. As a non-limiting example, the self-replicating RNA can be formulated in a liposome as described in International Publication No. WO20120067378, which is incorporated herein by reference in its entirety. In one aspect, the liposome can include a lipid having a pKa value that favors delivery of the mRNA. In another aspect, the liposome can have a substantially neutral surface charge at physiological pH and thus can be effective for immunization (see, e.g., the liposomes described in International Publication No. WO20120067378, which is incorporated herein by reference in its entirety).
[0375] In some embodiments, the nanoparticle composition includes a lipid component that includes at least one lipid, such as a compound according to one of Formula (I) (and its subformulae) described herein. For example, in some embodiments, the nanoparticle composition can include a lipid component that includes one of the compounds provided herein. The nanoparticle composition can also include one or more additional lipid or non-lipid components as described below.
[0376] In one embodiment, the nanoparticle composition including a compound provided herein and an mRNA exhibits increased mRNA expression levels (e.g., as compared to standard cationic lipid compounds known in the art, such as MC3). In one embodiment, the compound exhibits rapid tissue clearance (e.g., liver clearance) following administration of the nanoparticle composition including the compound to a subject.
[0377] 5.4.1 Cationic / Ionizable Lipids
[0378] Without being bound by theory, it is contemplated that certain charged or zwitterionic lipid components of the nanoparticle compositions improve cellular uptake of the nanoparticles, similar to the lipid components in cell membranes. Exemplary charged or ionizable lipids that can form part of the nanoparticle compositions of the present application include, but are not limited to, 3-(didodecylamino)-N1,N1,4-tridodecyl-1-piperazin- ethanamine (KL10), N1-[2-(didodecylamino)ethyl]-N1,N4,N4-tridodecyl-1,4-piperazinediethanamine (KL22), 14,25-ditridecyl-15,18,21,24-tetraaza-triacontane (KL25), 1,2-dilinoleyl- oxy-N,N-dimethylaminopropane (DLinDMA), 2,2-dilinoleyl-4-dimethylaminomethyl- [1,3]-dioxolane (DLin-K-DMA), 4-(dimethylamino)butanoic acid heptatriacont-6,9,28,31- tetraen-19-yl ester (DLin-MC3-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]- dioxolane (DLin-KC2-DMA), 1,2-dioleyloxy-N,N-dimethylaminopropane (DODMA), 2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12- dien-1-yloxy]propan-1-amine (Octyl-CLinDMA), (2R)-2-({8-[(3β)-cholest-5-en-3- yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (Octyl-CLinDMA(2R)), (2S)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3- [(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (Octyl-CLinDMA(2S)), (12Z,15Z)- N,N-dimethyl-2-nonylhenicosa-12,15-dien-1-amine, N,N-dimethyl-1-{(1S,2R)-2-octyl- cyclopropyl}heptadecan-8-amine.Additional exemplary charged or ionizable lipids that can form part of the nanoparticle compositions of the application include the lipids described in Sabnis et al., “A Novel Amino Lipid Series for mRNA Delivery: Improved Endosomal Escape and Sustained Pharmacology and Safety in Non-human Primates”, Molecular Therapy, Volume 26, Issue 6, 2018 (e.g., Lipid 5), which is incorporated by reference herein in its entirety.
[0379] In some embodiments, suitable cationic lipids include N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA); N-[1-(2,3-dioleoyloxy)propyl]-N,N,N- trimethylammonium chloride (DOTAP); 1,2-dioleoyl-sn-glycero-3-ethylphosphocholine (DOEPC); 1,2-dilauroyl-sn-glycero-3-ethylphosphocholine (DLEPC); 1,2-dimyristoyl-sn-glycero-3-ethylphosphocholine (DMEPC); 1,2-dimyristoyl-sn-glycero-3-ethylphosphocholine (14:1); N1-[2-((1S)-1-[(3-aminopropyl)amino]-4-[di(3-amino-propyl)amino]butylformamidyl)ethyl]-3,4-bis[oxy-2-(oleoyloxy)]-benzamide (MVL5); dioctadecylamidoglycylspermine (DOGS); 3b-[N-(N',N'-dimethylaminoethyl)carbamoyl]cholesterol (DC-Chol); dioctadecyldimethylammonium bromide (DDAB); SAINT-2, N-methyl-4-(dioleyl)pyridinium; 1,2-dimyristyl- oxypropyl-3-dimethylhydroxyethylammonium bromide (DMRIE); 1,2-dioleoyl-3-dimethyl- hydroxyethylammonium bromide (DORIE); 1,2-dioleoyloxypropyl-3-dimethylhydroxyethylammonium chloride (DORI); dialkylated amino acid (DILA 2(e.g., C18:1-norArg-C16); dioleyl dimethyl ammonium chloride (DODAC); 1-palmitoyl-2- oleoyl-sn-glycero-3-ethylphosphocholine (POEPC); 1,2-dimyristoyl-sn-glycero-3- ethylphosphocholine (MOEPC); dioleoyl (R)-5-(dimethylamino)pentane-1,2-diyl ester hydrochloride (DODAPen-Cl); dioleoyl (R)-5-guanidinium pentane-1,2-diyl ester hydrochloride (DOPen-G); and (R)-N,N,N-trimethyl-4,5-bis(oleoyloxy)pentan-1-aminium chloride (DOTAPen). Cationic lipids with charged head groups at physiological pH are also suitable, such as primary amines (e.g., DODAG N',N'-distearyl-N-4,8-diaza-10-aminodecanoyl glycine amide) and guanidinium head groups (e.g., bis-guanidinium-spermine-cholesterol (BGSC), bis-guanidinium-tren-cholesterol (BGTC), PONA, and dioleoyl (R)-5-guanidinium pentane-1,2-diyl ester hydrochloride (DOPen-G)). Another suitable cationic lipid is dioleoyl (R)-5-(dimethylamino)pentane-1,2-diyl ester hydrochloride (DODAPen-Cl). In certain embodiments, the cationic lipid is a specific enantiomer or racemic form, and includes various salt forms (e.g., chloride or sulfate) of the cationic lipids described above. For example, in some embodiments, the cationic lipid is N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP-Cl) or N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium sulfate (DOTAP-sulfate). In some embodiments, the cationic lipid is an ionizable cationic lipid, such as dioctadecyl dimethyl ammonium bromide (DDAB); 1,2-dilinoleyl oxy-3-dimethylaminopropane (DLinDMA); 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA); 4-(dimethylamino)butanoic acid heptatriaconta-6,9,28,31-tetraen-19-yl ester (DLin-MC3-DMA); 1,2-dioleoyloxy-3-dimethylaminopropane (DODAP); 1,2-dioleyloxy-3-dimethylaminopropane (DODMA); and N-morpholinocholesterol (Mo-CHOL). In certain embodiments, the lipid nanoparticle includes a combination of two or more cationic lipids (e.g., two or more of the cationic lipids described above).
[0380] Additionally, in some embodiments, the charged or ionizable lipids that can form part of the nanoparticle compositions of the present application are lipids that include a cyclic amine group. Additional cationic lipids suitable for use in the formulations and methods disclosed herein include those described in WO2015199952, WO2016176330, and WO2015011633, the entire contents of each are incorporated herein by reference in their entirety.
[0381] 5.4.2 Polymer-bound lipids
[0382] In some embodiments, the lipid component of the nanoparticle compositions can include one or more polymer-bound lipids, such as a pegylated lipid (PEG lipid). Without being bound by theory, it is contemplated that the polymer-bound lipid component in the nanoparticle compositions can improve colloidal stability and / or reduce protein adsorption of the nanoparticles. Exemplary polymer-bound lipids that can be used in conjunction with the present disclosure include, but are not limited to, PEG-modified phosphatidylethanolamines, PEG-modified phosphatidic acids, PEG-modified ceramides, PEG-modified dialkylamines, PEG-modified diacylglycerols, PEG-modified dialkylglycerols, and mixtures thereof. For example, the PEG lipid can be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, PEG-DSPE, ceramide-PEG2000, or Chol-PEG2000.
[0383] In one embodiment, the polymer-bound lipid is a pegylated lipid. For example, some embodiments include a pegylated diacylglycerol (PEG-DAG), such as 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG); a pegylated phosphatidylethanolamine (PEG-PE); a PEG succinate diacylglycerol (PEG-S-DAG), such as 4-O-(2',3'-ditetradecanoyloxy)propyl-1-O-(ω-methoxy(polyethoxy)ethyl) butanedioate (PEG-S-DMG); a pegylated ceramide (PEG-cer); or a PEG dialkoxylpropyl carbamate, such as ω-methoxy(polyethoxy)ethyl-N-(2,3-ditetradecyloxypropyl)carbamate or 2,3-ditetradecyloxypropyl-N-(ω-methoxy)(polyethoxy)ethyl)carbamate.
[0384] In one embodiment, the polymer-bound lipid is present at a concentration ranging from 1.0 mole % to 2.5 mole %. In one embodiment, the polymer-bound lipid is present at a concentration of about 1.7 mole %. In one embodiment, the polymer-bound lipid is present at a concentration of about 1.5 mole %.
[0385] In one embodiment, the molar ratio of cationic lipid to polymer conjugated lipid is in the range of about 35: 1 to about 25: 1. In one embodiment, the molar ratio of cationic lipid to polymer conjugated lipid is in the range of about 100: 1 to about 20: 1.
[0386] In one embodiment, the PEGylated lipid has the following formula:
[0387]
[0388] or a pharmaceutically acceptable salt, tautomer, or stereoisomer thereof, wherein:
[0389] R 12 and R 13 each independently is a linear or branched saturated or unsaturated alkyl chain containing 10 to 30 carbon atoms, wherein the alkyl chain is optionally interrupted by one or more ester linkages; and
[0390] w has an average value in the range of 30 to 60.
[0391] In one embodiment, R 12 and R 13 each independently is a linear saturated alkyl chain containing 12 to 16 carbon atoms. In other embodiments, the average w is in the range of 42 to 55, for example the average w is 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, or 55. In some particular embodiments, the average w is about 49.
[0392] In one embodiment, the PEGylated lipid has the following formula:
[0393]
[0394] wherein the average w is about 49.
[0395] 5.4.3 Structural Lipids
[0396] In some embodiments, the lipid component of the nanoparticle composition can include one or more structural lipids. Without being bound by theory, it is contemplated that structural lipids can stabilize the amphipathic structure of the nanoparticle, for example, but not limited to, the lipid bilayer structure of the nanoparticle. Exemplary structural lipids that can be used in conjunction with the present disclosure include, but are not limited to, cholesterol, coprostanol, sitosterol, ergosterol, elaidosterol, stigmasterol, brassicasterol, tomatidine, tomatidinol, ursolic acid, alpha-tocopherol, and mixtures thereof. In certain embodiments, the structural lipid is cholesterol. In some embodiments, the structural lipid includes cholesterol and a corticosteroid (e.g., prednisolone, dexamethasone, prednisone, and hydrocortisone) or a combination thereof.
[0397] In one embodiment, the lipid nanoparticle provided herein comprises a steroid or steroid analog. In one embodiment, the steroid or steroid analog is cholesterol. In one embodiment, the steroid is present at a concentration in the range of 39-49 mole %, 40-46 mole %, 40-44 mole %, 40-42 mole %, 42-44 mole %, or 44-46 mole %. In one embodiment, the steroid is present at a concentration of 40 mole %, 41 mole %, 42 mole %, 43 mole %, 44 mole %, 45 mole %, or 46 mole %.
[0398] In one embodiment, the molar ratio of cationic lipid to steroid is in the range of 1.0:0.9 to 1.0:1.2, or 1.0:1.0 to 1.0:1.2. In one embodiment, the molar ratio of cationic lipid to cholesterol is in the range of about 5:1 to 1:1. In one embodiment, the steroid is present at a concentration in the range of 32-40 mole % steroid.
[0399] 5.4.4 Phospholipids
[0400] In some embodiments, the lipid component of the nanoparticle composition can include one or more phospholipids, such as one or more (poly)unsaturated lipids. Without being bound by theory, it is contemplated that phospholipids can assemble into one or more lipid bilayer structures. Exemplary phospholipids that can form part of the nanoparticle compositions of the present application include, but are not limited to, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-di(undecanoyl)-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChems PC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 LysoPC), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-docosahexa-decanoyl-sn-glycero-3-phosphocholine, 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-docosahexa-decanoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), and sphingomyelin. In certain embodiments, the nanoparticle composition comprises DSPC. In certain embodiments, the nanoparticle composition comprises DOPE. In some embodiments, the nanoparticle composition comprises both DSPC and DOPE.
[0401] Additional exemplary neutral lipids include, for example, dipalmitoyl phosphatidylglycerol (DPPG), palmitoyloleyl phosphatidylethanolamine (POPE), and dioleoyl phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-l-carboxylate (DOPE-mal), dipalmitoyl phosphatidylethanolamine (DPPE), dimyristoyl phosphoethanolamine (DMPE), distearoyl-phosphatidylethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl phosphatidyl ethanolamine (SOPE), and 1,2-diretoyl-sn-glycero-3-phosphoethanolamine (trans DOPE). In one embodiment, the neutral lipid is 1,2-distearoyl-sn-glycero-3phosphocholine (DSPC). In one embodiment, the neutral lipid is selected from the group consisting of DSPC, DPPC, DMPC, DOPC, POPC, DOPE, and SM.
[0402] In one embodiment, the neutral lipid is phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylserine (PS), phosphatidic acid (PA), or phosphatidylglycerol (PG).
[0403] Additional phospholipids that can form part of the nanoparticle compositions of the present application also include those described in WO 2017 / 112865, the entire contents of which are incorporated herein by reference in their entirety.
[0404] 5.4.5 Therapeutic Payloads
[0405] According to the present disclosure, the nanoparticle compositions described herein can further comprise one or more therapeutic and / or prophylactic agents. These therapeutic and / or prophylactic agents are sometimes referred to in the present disclosure as “therapeutic payloads” or “payloads.” In some embodiments, the therapeutic payloads can be administered in vivo or ex vivo using the nanoparticles as a delivery vehicle.
[0406] In some embodiments, the nanoparticle composition comprises as a therapeutic payload: a small molecule compound (e.g., a small molecule drug), such as an anti-cancer agent (e.g., vincristine, doxorubicin, mitoxantrone, camptothecin, cisplatin, bleomycin, cyclophosphamide, methotrexate, and streptozotocin), an antitumor agent (e.g., actinomycin D, vincristine, vinblastine, cytosine arabinoside, anthracyclines, alkylating agents, platinum compounds, antimetabolites and nucleoside analogs, such as methotrexate and purine and pyrimidine analogs), an anti-infective agent, a local anesthetic (e.g., dibucaine and chlorpromazine), a beta-adrenergic blocking agent (e.g., propranolol, timolol, and labetalol), an antihypertensive agent (e.g., clonidine and hydralazine), an antidepressant (e.g., imipramine, amitriptyline, and doxepin), an anticonvulsant (e.g., phenytoin), an antihistamine (e.g., diphenhydramine, chlorpheniramine, and promethazine), an antibiotic / antibacterial agent (e.g., gentamycin, ciprofloxacin, and cefoxitin), an antifungal agent (e.g., miconazole, terconazole, econazole, isoconazole, butaconazole, clotrimazole, itraconazole, nystatin, naftifine, and amphotericin B), an antiparasitic agent, a hormone, a hormone antagonist, an immunomodulatory agent, a neurotransmitter antagonist, an anti-glaucoma agent, a vitamin, an anesthetic, and an imaging agent.
[0407] In some embodiments, the therapeutic payload comprises a cytotoxin, a radioactive ion, a chemotherapeutic agent, a vaccine, an immune response-inducing compound, and / or another therapeutic and / or prophylactic agent. Cytotoxins or cytotoxic agents include any agent that can be harmful to cells. Examples include, but are not limited to, taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, teniposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxyanthracin dione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, puromycin, a maytansinoid, such as maytansinol, rachelmycin (CC-1065), and analogs or homologs thereof. Radioactive ions include, but are not limited to, iodine (e.g., iodine 125 or iodine 131), strontium 89, phosphorus, palladium, cesium, iridium, phosphates, cobalt, yttrium 90, samarium 153, and praseodymium.
[0408] In other embodiments, the therapeutic payload of the nanoparticle compositions of the present application can include, but are not limited to, therapeutic and / or prophylactic agents such as antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil, dacarbazine), alkylating agents (e.g., mechlorethamine, thiotepa, chlorambucil, rachelmycin (CC-1065), melphalan, carmustine (BSNU), lomustine (CCNU), cyclophosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin)), bleomycins, mithramycin, and anthramycin (AMC)), and antimitotic agents (e.g., vincristine, vinblastine, paclitaxel, and maytansinoids).
[0409] In some embodiments, the nanoparticle compositions comprise biomolecules such as peptides and polypeptides as the therapeutic payload. The biomolecules that form part of the nanoparticle compositions of the present application can be of natural origin or synthetic. For example, in some embodiments, the therapeutic payload of the nanoparticle compositions of the present application can include, but are not limited to, gentamicin, amikacin, insulin, erythropoietin (EPO), granulocyte colony-stimulating factor (G-CSF), granulocyte-macrophage colony-stimulating factor (GM-CSF), factor VIR, luteinizing hormone-releasing hormone (LHRH) analogs, interferons, heparin, hepatitis B surface antigen, typhoid vaccine, cholera vaccine, and peptides and polypeptides.
[0410] 5.4.5.1 Nucleic Acids
[0411] In some embodiments, the nanoparticle compositions of the present application comprise one or more nucleic acid molecules (e.g., DNA or RNA molecules) as a therapeutic payload. Illustrative forms of nucleic acid molecules that can be included in the nanoparticle compositions of the present application as a therapeutic payload include, but are not limited to, one or more of the following: deoxyribonucleic acid (DNA), ribonucleic acid (RNA), including messenger mRNA (mRNA), hybrids thereof, RNAi inducing agents, RNAi agents, siRNA, shRNA, miRNA, antisense RNA, ribozymes, catalytic DNA, RNA that induces triple helix formation, aptamers, vectors, and the like. In certain embodiments, the therapeutic payload comprises RNA. RNA molecules that can be included in the nanoparticle compositions of the present application as a therapeutic payload include, but are not limited to, shortmers, agomirs, antagomirs, antisenses, ribozymes, small interfering RNAs (siRNAs), asymmetric interfering RNAs (aiRNAs), microRNAs (miRNAs), Dicer-substrate RNAs (dsRNAs), small hairpin RNAs (shRNAs), transfer RNAs (tRNAs), messenger RNAs (mRNAs), and other forms of RNA molecules known in the art. In particular embodiments, the RNA is mRNA.
[0412] In other embodiments, the nanoparticle compositions comprise siRNA molecules as a therapeutic payload. In particular, in some embodiments, the siRNA molecules are capable of selectively interfering with and down-regulating the expression of a gene of interest. For example, in some embodiments, upon administration of a nanoparticle composition comprising siRNA to a subject in need thereof, the siRNA payload selectively silences a gene associated with a particular disease, disorder, or condition. In some embodiments, the siRNA molecules comprise a sequence that is complementary to an mRNA sequence encoding a protein product of interest. In some embodiments, the siRNA molecules are immunomodulatory siRNAs.
[0413] In some embodiments, the nanoparticle compositions comprise shRNA molecules or vectors encoding shRNA molecules as a therapeutic payload. In particular, in some embodiments, the therapeutic payload, upon administration to a target cell, generates shRNA within the target cell. Constructs and mechanisms associated with shRNA are well known in the art.
[0414] In some embodiments, the nanoparticle composition comprises an mRNA molecule as a therapeutic payload. In particular, in some embodiments, the mRNA molecule encodes a polypeptide of interest, including any naturally or non-naturally occurring or otherwise modified polypeptide. The polypeptide encoded by the mRNA can be of any size and can have any secondary structure or activity. In some embodiments, the polypeptide encoded by the mRNA payload can have a therapeutic effect when expressed in a cell.
[0415] In some embodiments, the nucleic acid molecule of the present disclosure comprises an mRNA molecule. In particular embodiments, the nucleic acid molecule comprises at least one coding region (e.g., open reading frame (ORF)) encoding a peptide or polypeptide of interest. In some embodiments, the nucleic acid molecule further comprises at least one untranslated region (UTR). In particular embodiments, the untranslated region (UTR) is located upstream (5’ end) of the coding region, and is referred to herein as 5’-UTR. In particular embodiments, the untranslated region (UTR) is located downstream (3’ end) of the coding region, and is referred to herein as 3’-UTR. In particular embodiments, the nucleic acid molecule comprises both 5’-UTR and 3’-UTR. In some embodiments, the 5’-UTR comprises a 5’-cap structure. In some embodiments, the nucleic acid molecule comprises a Kozak sequence (e.g., in the 5’-UTR). In some embodiments, the nucleic acid molecule comprises a poly-A region (e.g., in the 3’-UTR). In some embodiments, the nucleic acid molecule comprises a polyadenylation signal (e.g., in the 3’-UTR). In some embodiments, the nucleic acid molecule comprises a stabilization region (e.g., in the 3’-UTR). In some embodiments, the nucleic acid molecule comprises a secondary structure. In some embodiments, the secondary structure is a stem-loop. In some embodiments, the nucleic acid molecule comprises a stem-loop sequence (e.g., in the 5’-UTR and / or 3’-UTR). In some embodiments, the nucleic acid molecule comprises one or more intron regions capable of being excised during splicing. In particular embodiments, the nucleic acid molecule comprises one or more regions selected from the 5’-UTR and the coding region. In particular embodiments, the nucleic acid molecule comprises one or more regions selected from the coding region and the 3’-UTR. In particular embodiments, the nucleic acid molecule comprises one or more regions selected from the 5’-UTR, the coding region, and the 3’-UTR.
[0416] coding region
[0417] In some embodiments, the nucleic acid molecules of the present disclosure comprise at least one coding region. In some embodiments, the coding region is an open reading frame (ORF) that encodes a single peptide or protein. In some embodiments, the coding region comprises at least two ORFs, each ORF encoding a peptide or protein. In embodiments where the coding region comprises more than one ORF, the encoded peptides and / or proteins can be the same as or different from one another. In some embodiments, the multiple ORFs in the coding region are separated by non-coding sequences. In particular embodiments, the non-coding sequence separating two ORFs comprises an internal ribosome entry site (IRES).
[0418] Without being bound by theory, it is contemplated that an internal ribosome entry site (IRES) can serve as the sole ribosome binding site, or act as one of multiple ribosome binding sites for an mRNA. An mRNA molecule comprising more than one functional ribosome binding site can encode several peptides or polypeptides that are independently translated by ribosomes (e.g., a multi-cistronic mRNA). Thus, in some embodiments, the nucleic acid molecules (e.g., mRNA) of the present disclosure comprise one or more internal ribosome entry sites (IRES). Examples of IRES sequences that can be used in conjunction with the present disclosure include, but are not limited to, those from a picornavirus (e.g., FMDV), a pestivirus (CFFV), a poliovirus (PV), an encephalomyocarditis virus (ECMV), a foot-and-mouth disease virus (FMDV), a hepatitis C virus (HCV), a classical swine fever virus (CSFV), a murine leukemia virus (mLV), a simian immunodeficiency virus (SIV), or a cricket paralysis virus (CrPV).
[0419] In various embodiments, the nucleic acid molecules of the present disclosure encode at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more peptides or proteins. The peptides and proteins encoded by the nucleic acid molecules can be the same or different. In some embodiments, the nucleic acid molecules of the present disclosure encode dipeptides (e.g., carnosine and anserine). In some embodiments, the nucleic acid molecules encode tripeptides. In some embodiments, the nucleic acid molecules encode tetrapeptides. In some embodiments, the nucleic acid molecules encode pentapeptides. In some embodiments, the nucleic acid molecules encode hexapeptides. In some embodiments, the nucleic acid molecules encode heptapeptides. In some embodiments, the nucleic acid molecules encode octapeptides. In some embodiments, the nucleic acid molecules encode nonapeptides. In some embodiments, the nucleic acid molecules encode decapeptides. In some embodiments, the nucleic acid molecules encode peptides or polypeptides having at least about 15 amino acids. In some embodiments, the nucleic acid molecules encode peptides or polypeptides having at least about 50 amino acids. In some embodiments, the nucleic acid molecules encode peptides or polypeptides having at least about 100 amino acids. In some embodiments, the nucleic acid molecules encode peptides or polypeptides having at least about 150 amino acids. In some embodiments, the nucleic acid molecules encode peptides or polypeptides having at least about 300 amino acids. In some embodiments, the nucleic acid molecules encode peptides or polypeptides having at least about 500 amino acids. In some embodiments, the nucleic acid molecules encode peptides or polypeptides having at least about 1000 amino acids.
[0420] In some embodiments, the nucleic acid molecules of the present disclosure are at least about 30 nucleotides (nt) in length. In some embodiments, the nucleic acid molecules are at least about 35 nt in length. In some embodiments, the nucleic acid molecules are at least about 40 nt in length. In some embodiments, the nucleic acid molecules are at least about 45 nt in length. In some embodiments, the nucleic acid molecules are at least about 50 nt in length. In some embodiments, the nucleic acid molecules are at least about 55 nt in length. In some embodiments, the nucleic acid molecules are at least about 60 nt in length. In some embodiments, the nucleic acid molecules are at least about 65 nt in length. In some embodiments, the nucleic acid molecules are at least about 70 nt in length. In some embodiments, the nucleic acid molecules are at least about 75 nt in length. In some embodiments, the nucleic acid molecules are at least about 80 nt in length. In some embodiments, the nucleic acid molecules are at least about 85 nt in length. In some embodiments, the nucleic acid molecules are at least about 90 nt in length. In some embodiments, the nucleic acid molecules are at least about 95 nt in length. In some embodiments, the nucleic acid molecules are at least about 100 nt in length. In some embodiments, the nucleic acid molecules are at least about 120 nt in length. In some embodiments, the nucleic acid molecules are at least about 140 nt in length. In some embodiments, the nucleic acid molecules are at least about 160 nt in length. In some embodiments, the nucleic acid molecules are at least about 180 nt in length. In some embodiments, the nucleic acid molecules are at least about 200 nt in length. In some embodiments, the nucleic acid molecules are at least about 250 nt in length. In some embodiments, the nucleic acid molecules are at least about 300 nt in length. In some embodiments, the nucleic acid molecules are at least about 400 nt in length. In some embodiments, the nucleic acid molecules are at least about 500 nt in length. In some embodiments, the nucleic acid molecules are at least about 600 nt in length. In some embodiments, the nucleic acid molecules are at least about 700 nt in length. In some embodiments, the nucleic acid molecules are at least about 800 nt in length. In some embodiments, the nucleic acid molecules are at least about 900 nt in length. In some embodiments, the nucleic acid molecules are at least about 1000 nt in length. In some embodiments, the nucleic acid molecules are at least about 1100 nt in length. In some embodiments, the nucleic acid molecules are at least about 1200 nt in length. In some embodiments, the nucleic acid molecules are at least about 1300 nt in length. In some embodiments, the nucleic acid molecules are at least about 1400 nt in length. In some embodiments, the nucleic acid molecules are at least about 1500 nt in length. In some embodiments, the nucleic acid molecules are at least about 1600 nt in length. In some embodiments, the nucleic acid molecules are at least about 1700 nt in length. In some embodiments, the nucleic acid molecules are at least about 1800 nt in length. In some embodiments, the nucleic acid molecules are at least about 1900 nt in length.In some embodiments, the length of the nucleic acid molecule is at least about 2000nt. In some embodiments, the length of the nucleic acid molecule is at least about 2500nt. In some embodiments, the length of the nucleic acid molecule is at least about 3000nt. In some embodiments, the length of the nucleic acid molecule is at least about 3500nt. In some embodiments, the length of the nucleic acid molecule is at least about 4000nt. In some embodiments, the length of the nucleic acid molecule is at least about 4500nt. In some embodiments, the length of the nucleic acid molecule is at least about 5000nt.
[0421] In certain embodiments, the therapeutic payload comprises a vaccine composition as described herein (e.g., a gene vaccine). In some embodiments, the therapeutic payload comprises a compound capable of eliciting immunity against one or more target diseases or diseases. In some embodiments, the target disease is associated with or caused by infection with a pathogen, such as a coronavirus (e.g., 2019-nCoV), influenza virus, measles virus, human papillomavirus (HPV), rabies virus, meningitis virus, pertussis virus, tetanus virus, plague virus, hepatitis virus, and tuberculosis virus. In some embodiments, the therapeutic payload comprises a nucleic acid sequence (e.g., mRNA) encoding a pathogen-specific pathogenic protein or its antigenic fragment or epitope. After being administered to a vaccinated subject, the vaccine allows expression of the encoded pathogenic protein (or its antigenic fragment or epitope), thereby eliciting immunity against the pathogen in the subject.
[0422] In some embodiments, the target disease is associated with or caused by the neoplastic growth of cells (e.g., cancer). In some embodiments, the therapeutic payload comprises a nucleic acid sequence (e.g., mRNA) encoding a tumor-associated antigen (TAA) or an antigenic fragment or epitope thereof that is specific to cancer. Upon administration to a vaccinated subject, the vaccine allows expression of the encoded TAA (or its antigenic fragment or epitope), thereby eliciting immunity against neoplastic cells expressing the TAA in the subject.
[0423] 5'-cap structure
[0424] Without being bound by theory, it is expected that the 5'-cap structure of the polynucleotide participates in nuclear export and increases polynucleotide stability, and binds to mRNA cap binding protein (CBP), which is responsible for polynucleotide stability in the cell and causes translational competence through the formation of mature circular mRNA species through the association of CBP with poly-A binding protein. The 5'-cap structure further facilitates the removal of 5'-proximal introns during mRNA splicing. Therefore, in some embodiments, the nucleic acid molecules of the present disclosure include a 5'-cap structure.
[0425] A nucleic acid molecule can be capped at the 5' end by cellular endogenous transcriptional machinery, thereby creating a 5'-p p p-5'-triphosphate linkage between a terminal guanosine cap residue and the 5' terminal transcribed sense nucleotides of the polynucleotide. This 5'-guanylate cap can then be methylated to create a N7-methyl-guanosine residue. The ribose of the terminal and / or anteterminal transcribed nucleotides of the 5' end of the polynucleotide can also optionally be 2'-0-methylated. 5'-decapping, which occurs via hydrolysis and cleavage of the guanylate cap structure, can target nucleic acid molecules, such as mRNA molecules, for degradation.
[0426] In some embodiments, the nucleic acid molecules of the present disclosure comprise one or more alterations to the native 5'-cap structure produced by endogenous processes. Without being bound by theory, modifications to the 5'-cap can increase the stability of the polynucleotide, increase the half-life of the polynucleotide, and can increase the translational efficiency of the polynucleotide.
[0427] Exemplary alterations to the native 5'-cap structure include creating a non-hydrolysable cap structure to prevent decapping, and thereby increase the half-life of the polynucleotide. In some embodiments, because cap structure hydrolysis requires cleavage of the 5'-p p p-5' phosphodiester linkage, in some embodiments, a modified nucleotide can be used during the capping reaction. For example, in some embodiments, Vaccinia Capping Enzyme from New England Biolabs (Ipswich, Mass.) can be used according to the manufacturer's instructions with an alpha-thio-guanosine nucleotide to create a phosphorothioate linkage in the 5'-p p p-5' cap. Additional modified guanosine nucleotides can be used, such as alpha-methylphosphonate and selenophosphate nucleotides.
[0428] Additional exemplary alterations to the native 5'-cap structure also include modifications at the 2' and / or 3' positions of the capped guanosine triphosphate (GTP), replacement of the sugar ring oxygen (creating a carbocyclic oxygen) with a methylene moiety (CH2), modifications at the triphosphate bridge portion of the cap structure, or modifications at the nucleobase (G) portion.
[0429] Additional exemplary alterations to the native 5'-cap structure include, but are not limited to, 2'-0-methylation of the ribose at the sugar 2'-hydroxyl of the 5'-terminal and / or 5'-terminal anteterminal nucleotides of the polynucleotide (as described above). A number of different 5'-cap structures can be used to create a 5'-cap of a polynucleotide (such as an mRNA molecule). Additional exemplary 5'-cap structures that can be used in conjunction with the present disclosure further include those described in International Patent Publication Nos. WO2008127688, WO2008016473, and WO2011015347, the entire contents of each are incorporated herein by reference.
[0430] In various embodiments, the 5'-terminal cap may comprise a cap analog. Cap analogs are also referred to herein as synthetic cap analogs, chemical caps, chemical cap analogs, or structural or functional cap analogs, which differ in chemical structure from a natural (i.e., endogenous, wild-type, or physiological) 5'-cap while retaining cap function. Cap analogs can be synthesized and / or attached to polynucleotides chemically (i.e., non-enzymatically) or enzymatically.
[0431] For example, the anti-reverse cap analog (ARCA) cap contains two guanosines linked via a 5'-5'-triphosphate group, one of which contains an N7-methyl group and a 3'-O-methyl group (i.e., N7,3'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine, i.e., m 7 G-3'mppp-G, which can be equivalently referred to as 3'O-Me-m7G(5')ppp(5')G. The 3'-O atom of another unmodified guanosine is attached to the 5'-terminal nucleotide of the capped polynucleotide (e.g., mRNA). The N7- and 3'-O-methylated guanosine provides the terminal portion of the capped polynucleotide (e.g., mRNA). Another exemplary cap structure is mCAP, which is similar to ARCA but has a 2'-O-methyl group on the guanosine (i.e., N7,2'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine, i.e., m7Gm-ppp-G).
[0432] In some embodiments, the cap analog can be a dinucleotide cap analog. As a non-limiting example, a dinucleotide cap analog can be modified with boranophosphate or phophoroselenoate at different phosphate positions, such as the dinucleotide cap analogs described in U.S. Patent No. 8,519,110, the entire contents of which are incorporated herein by reference in their entirety.
[0433] In some embodiments, the cap analog can be an N7-(4-chlorophenoxyethyl)- substituted dinucleotide cap analog known in the art and / or described herein. Non-limiting examples of N7-(4-chlorophenoxyethyl)-substituted dinucleotide cap analogs include N7-(4-chlorophenoxyethyl)-G(5')ppp(5')G and N7-(4-chlorophenoxyethyl)-m3'-OG(5')ppp(5')G cap analogs (see, e.g., Kore et al., Bioorganic & Medicinal Chemistry 201321:4570-4574 for various cap analogs and methods of synthesizing cap analogs; the entire contents of which are incorporated herein by reference). In other embodiments, the cap analog that can be used in conjunction with the nucleic acid molecules of the present disclosure is a 4-chloro / bromo phenoxyethyl analog.
[0434] In various embodiments, the cap analog can include a guanosine analog. Useful guanosine analogs include, but are not limited to, inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.
[0435] Without being bound by theory, it is contemplated that despite the cap analog allowing for capping of the polynucleotide simultaneously in an in vitro transcription reaction, up to 20% of the transcripts are uncapped. This, along with the structural differences between the cap analog and the natural 5'-cap structure of polynucleotides produced by cellular endogenous transcriptional machinery, can result in reduced translational ability and decreased cellular stability.
[0436] Accordingly, in some embodiments, the nucleic acid molecules of the present disclosure can also be post-transcriptionally capping using enzymes in order to produce a more authentic 5'-cap structure. As used herein, the phrase "more authentic" refers to a feature that closely reflects or mimics, structurally or functionally, an endogenous or wild-type feature. That is, a "more authentic" feature better represents an endogenous, wild-type, native, or physiological cellular function and / or structure, or it outperforms the corresponding endogenous, wild-type, native, or physiological feature in one or more aspects, as compared to a synthetic feature or analog of the prior art. Non-limiting examples of more authentic 5'-cap structures that can be used in conjunction with the nucleic acid molecules of the present disclosure are structures that, as compared to synthetic 5'-cap structures known in the art (or as compared to wild-type, native, or physiological 5'-cap structures), especially have enhanced binding to cap-binding proteins, increased half-life, reduced sensitivity to 5'-endonucleases, and / or reduced 5'-decapping. For example, in some embodiments, a recombinant vaccinia virus capping enzyme and a recombinant 2'-O-methyltransferase can produce a canonical 5'-5'-triphosphate linkage between the 5'-terminal nucleotide of a polynucleotide and a guanosine cap nucleotide, wherein the cap guanosine contains N7-methylation and the 5'-terminal nucleotide of the polynucleotide contains 2'-O-methylation. This structure is referred to as a Cap 1 structure. Such a cap leads to higher translational capacity, cellular stability, and reduced activation of cellular proinflammatory cytokines as compared to, for example, other 5' cap analog structures known in the art. Other exemplary cap structures include 7mG(5')ppp(5')N, pN2p (Cap 0), 7mG(5')ppp(5')NlmpNp (Cap 1), 7mG(5')-ppp(5')NlmpN2mp (Cap 2), and m(7)Gpppm(3)(6,6,2')Apm(2')Apm(2')Cpm(2)(3,2')Up (Cap 4).
[0437] Without being bound by theory, it is contemplated that the nucleic acid molecules of the present disclosure can be post-transcriptionally capped, and since this approach is more efficient, nearly 100% of the nucleic acid molecules can be capped.
[0438] Untranslated region (UTR)
[0439] In some embodiments, the nucleic acid molecules of the present disclosure comprise one or more untranslated regions (UTRs). In some embodiments, a UTR is located upstream of a coding region in a nucleic acid molecule and is referred to as a 5'-UTR. In some embodiments, a UTR is located downstream of a coding region in a nucleic acid molecule and is referred to as a 3'-UTR. The sequence of a UTR can be homologous or heterologous to the sequence of a coding region found in the nucleic acid molecule. Multiple UTRs can be included in a nucleic acid molecule and can have the same or different sequences and / or genetic origins. In accordance with the present disclosure, any portion of a UTR (including none) in a nucleic acid molecule can be codon-optimized and any portion can independently contain one or more different structural or chemical modifications before and / or after codon-optimization.
[0440] In some embodiments, the nucleic acid molecules (e.g., mRNA) of the present disclosure comprise UTRs and coding regions that are homologous with respect to each other. In other embodiments, the nucleic acid molecules (e.g., mRNA) of the present disclosure comprise UTRs and coding regions that are heterologous with respect to each other. In some embodiments, to monitor the activity of a UTR sequence, a nucleic acid molecule comprising a coding sequence for a UTR and a detectable probe can be administered in vitro (e.g., cell or tissue culture) or in vivo (e.g., to a subject) and the effect of the UTR sequence (e.g., modulating expression level, cellular localization of encoded product, or half-life of encoded product) can be measured using methods known in the art.
[0441] In some embodiments, the UTRs of the nucleic acid molecules (e.g., mRNA) of the present disclosure comprise at least one translational enhancer element (TEE) that functions to increase the amount of a polypeptide or protein produced by the nucleic acid molecule. In some embodiments, a TEE is located in the 5'-UTR of a nucleic acid molecule. In other embodiments, a TEE is located at the 3'-UTR of a nucleic acid molecule. In other embodiments, at least two TEEs are located at the 5'-UTR and 3'-UTR, respectively, of a nucleic acid molecule. In some embodiments, the nucleic acid molecules (e.g., mRNA) of the present disclosure can comprise one or more copies of a TEE sequence or comprise more than one different TEE sequence. In some embodiments, different TEE sequences present in the nucleic acid molecules of the present disclosure can be homologous or heterologous with respect to each other.
[0442] Various TEE sequences are known in the art and can be used in conjunction with the present disclosure. For example, in some embodiments, the TEE can be an internal ribosome entry site (IRES), an HCV-IRES, or an IRES element. Chappell et al., Proc. Natl. Acad. Sci. USA 101 :9590-9594, 2004; Zhou et al., Proc. Natl. Acad. Sci. 102:6273-6278, 2005. Additional internal ribosome entry sites (IRES) that can be used in conjunction with the present disclosure include, but are not limited to, the IRES described in U.S. Patent No. 7,468,275, U.S. Patent Publication No. 2007 / 0048776, and U.S. Patent Publication No. 2011 / 0124100, and International Patent Publication Nos. WO2007 / 025008 and WO2001 / 055369, the contents of each are incorporated herein by reference in their entirety. In some embodiments, the TEE can be a TEE described in Supplementary Table 1 and Supplementary Table 2 of Wellensiek et al., Genome-wide profiling of human cap-independent translation-enhancing elements, Nature Methods, August 2013; 10(8):747-750; the contents of each are incorporated herein by reference in their entirety.
[0443] Additional exemplary TEEs that can be used in conjunction with the present disclosure include, but are not limited to, the TEE sequences described in U.S. Patent No. 6,310,197, U.S. Patent No. 6,849,405, U.S. Patent No. 7,456,273, U.S. Patent No. 7,183,395, U.S. Patent Publication No. 2009 / 0226470, U.S. Patent Publication No. 2013 / 0177581, U.S. Patent Publication No. 2007 / 0048776, U.S. Patent Publication No. 2011 / 0124100, U.S. Patent Publication No. 2009 / 0093049, International Patent Publication No. WO2009 / 075886, International Patent Publication No. WO2012 / 009644, and International Patent Publication No. WO1999 / 024595, International Patent Publication No. WO2007 / 025008, International Patent Publication No. WO2001 / 055371, European Patent No. 2610341, European Patent No. 2610340, the contents of each are incorporated herein by reference in their entirety.
[0444] In various embodiments, the nucleic acid molecules (e.g., mRNA) of the present disclosure comprise at least one UTR comprising at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, or more than 60 TEE sequences. In some embodiments, the TEE sequences in the UTR of the nucleic acid molecule are copies of the same TEE sequence. In other embodiments, at least two of the TEE sequences in the UTR of the nucleic acid molecule have different TEE sequences. In some embodiments, the plurality of different TEE sequences are arranged in one or more repeat patterns in the UTR region of the nucleic acid molecule. For purposes of illustration only, the repeat patterns can be, for example, ABABAB, AABBAABBAABB, ABCABCABC, etc., where in these exemplary patterns, each capital letter (A, B, or C) represents a different TEE sequence. In some embodiments, at least two of the TEE sequences in the UTR of the nucleic acid molecule are contiguous with each other (i.e., without an intervening sequence therebetween). In other embodiments, at least two of the TEE sequences are separated by an intervening sequence. In some embodiments, the UTR can comprise TEE sequence-intervening sequence modules that are repeated at least once, at least twice, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, or more times in the UTR. In any of the embodiments described in this paragraph, the UTR can be the 5'-UTR, the 3'-UTR, or both the 5'-UTR and the 3'-UTR of the nucleic acid molecule.
[0445] In some embodiments, the UTR of the nucleic acid molecules (e.g., mRNA) of the present disclosure comprises at least one translational suppression element that functions to reduce the amount of polypeptide or protein produced from the nucleic acid molecule. In some embodiments, the UTR of the nucleic acid molecule comprises one or more miR sequences or fragments thereof (e.g., miR seed sequences) that are recognized by one or more microRNAs. In some embodiments, the UTR of the nucleic acid molecule comprises one or more stem-loop structures that downregulate the translational activity of the nucleic acid molecule. Other mechanisms for suppressing the translational activity associated with the nucleic acid molecule are known in the art. In any of the embodiments described in this paragraph, the UTR can be the 5'-UTR, the 3'-UTR, or both the 5'-UTR and the 3'-UTR of the nucleic acid molecule.
[0446] Poly-A region
[0447] During natural RNA processing, long stretches of adenosine nucleotides (poly-A regions) are typically added to messenger RNA (mRNA) molecules to increase the stability of the molecule. Immediately after transcription, the 3 '-end of the transcript is cleaved to release a 3 '-hydroxyl group. Next, a poly-A polymerase adds a stretch of adenosine nucleotides to the RNA. This process, called polyadenylation, adds a poly-A region that is between 100 and 250 residues in length. Without being bound by theory, it is expected that the poly-A region can confer multiple advantages to the nucleic acid molecules of the disclosure.
[0448] Accordingly, in some embodiments, the nucleic acid molecules (e.g., mRNA) of the disclosure comprise a polyadenylation signal. In some embodiments, the nucleic acid molecules (e.g., mRNA) of the disclosure comprise one or more polyadenylation (poly-A) regions. In some embodiments, the poly-A region consists entirely of adenine nucleotides or functional analogs thereof. In some embodiments, the nucleic acid molecule comprises at least one poly-A region at its 3 '-end. In some embodiments, the nucleic acid molecule comprises at least one poly-A region at its 5 '-end. In some embodiments, the nucleic acid molecule comprises at least one poly-A region at its 5 '-end and at least one poly-A region at its 3 '-end.
[0449] According to the present disclosure, in different embodiments, the poly-A region can have different lengths. In particular, in some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 30 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 35 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 40 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 45 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 50 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 55 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 60 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 65 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 70 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 75 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 80 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 85 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 90 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 95 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 100 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 110 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 120 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 130 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 140 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 150 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 160 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 170 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 180 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 190 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 200 nucleotides in length.In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 225 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 250 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 275 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 300 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 350 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 400 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 450 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 500 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 600 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 700 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 800 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 900 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 1000 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 1100 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 1200 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 1300 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 1400 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 1500 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 1600 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 1700 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 1800 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 1900 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 2000 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 2250 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecule of the present disclosure is at least 2500 nucleotides in length.In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 2750 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 3000 nucleotides in length.
[0450] In some embodiments, the length of the poly-A region in the nucleic acid molecules can be selected based on the total length of the nucleic acid molecule or a portion thereof (e.g., the length of the coding region of the nucleic acid molecule or the length of the open reading frame, etc.). For example, in some embodiments, the poly-A region comprises about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more percent of the total length of the nucleic acid molecule containing the poly-A region.
[0451] Without being bound by theory, it is contemplated that certain RNA binding proteins can bind to the poly-A region located at the 3' end of an mRNA molecule. These poly-A binding proteins (PABPs) can modulate mRNA expression, for example, interacting with the translation initiation machinery in the cell and / or protecting the 3'-poly-A tail from degradation. Thus, in some embodiments, the nucleic acid molecules (e.g., mRNA) of the present disclosure comprise at least one binding site for a poly-A binding protein (PABP). In other embodiments, the nucleic acid molecules are formed into a conjugate or complex with a PABP prior to loading into a delivery vehicle (e.g., a lipid nanoparticle).
[0452] In some embodiments, the nucleic acid molecules (e.g., mRNA) of the present disclosure comprise a poly-A-G quadruplex. A G-quadruplex is a hydrogen-bonded, four- guanosine nucleotide cyclic array that can be formed from G-rich sequences in DNA and RNA. In this embodiment, the G-quadruplex is incorporated at one end of the poly-A region. The resulting polynucleotide (e.g., mRNA) can be analyzed for stability, protein yield, and other parameters, including half-life at different time points. It has been found that the protein yield for the poly-A-G quadruplex structure is equal to at least 75% of the protein yield observed using a poly-A region comprising 120 nucleotides alone.
[0453] In some embodiments, the nucleic acid molecules (e.g., mRNA) of the present disclosure can include a poly-A region and can be stabilized by the addition of a 3'- stabilization region. In some embodiments, the 3'-stabilization region that can be used to stabilize the nucleic acid molecules (e.g., mRNA) includes a poly-A or poly-A-G quadruplex structure described in International Patent Publication No. WO 2013 / 103659, the contents of which are incorporated herein by reference in their entirety.
[0454] In other embodiments, 3 '-stabilizing regions that can be used in conjunction with the nucleic acid molecules of the present disclosure include chain terminating nucleosides such as, but not limited to, 3 '-deoxyadenosine (cordycepin); 3 '-deoxyuridine; 3 '-deoxycytosine; 3 '-deoxyguanosine; 3 '-deoxythymine; 2',3'-dideoxynucleosides such as 2',3'-dideoxyadenosine, 2',3'-dideoxyuridine, 2',3'-dideoxycytosine, 2',3'-dideoxyguanosine, 2',3'-dideoxythymine; 2'-deoxynucleosides; or O-methyl nucleosides; 3'-deoxynucleosides; 2',3'-dideoxynucleosides; 3'-O-methyl nucleosides; 3'-O-ethyl nucleosides; 3'-arabinosides, and other alternative nucleosides known in the art and / or described herein.
[0455] Secondary structure
[0456] Without being bound by theory, stem-loop structures are expected to direct RNA folding, protect the structural stability of nucleic acid molecules (e.g., mRNA), provide recognition sites for RNA binding proteins, and serve as substrates for enzymatic reactions. For example, incorporation of miR sequences and / or TEE sequences will alter the shape of the stem-loop region, which can increase and / or decrease translation (Kedde et al., A Pumilio-induced RNA structure switch in p27-3'UTR controls miR-221 and miR-222 accessibility. Nat Cell Biol., 2010 Oct; 12(10): 1014-20, the contents of which are incorporated herein by reference in their entirety).
[0457] Accordingly, in some embodiments, the nucleic acid molecules (e.g., mRNA) described herein, or a portion thereof, can be in a stem-loop structure, such as, but not limited to, a histone stem-loop. In some embodiments, the stem-loop structure is formed from a stem-loop sequence that is about 25 or about 26 nucleotides in length, such as, but not limited to, the structures described in International Patent Publication No. WO 2013 / 103659, the contents of which are incorporated herein by reference in their entirety. Additional examples of stem-loop sequences include those described in International Patent Publication No. WO 2012 / 019780 and International Patent Publication No. WO 201502667, the contents of each are incorporated herein by reference. In some embodiments, the stem-loop sequence comprises a TEE as described herein. In some embodiments, the stem-loop sequence comprises a miR sequence as described herein. In particular embodiments, the stem-loop sequence can include a miR-122 seed sequence. In particular embodiments, the nucleic acid molecule comprises the stem-loop sequence CAAAGGCTCTTTTCAGAGCCACCA (SEQ ID NO: 1). In other embodiments, the nucleic acid molecule comprises the stem-loop sequence CAAAGGCUCUUUUCAGAGCCACCA (SEQ ID NO: 2).
[0458] In some embodiments, the nucleic acid molecules (e.g., mRNA) of the present disclosure comprise a stem-loop sequence upstream (at the 5’ end) of the coding region in the nucleic acid molecule. In some embodiments, the stem-loop sequence is within the 5’-UTR of the nucleic acid molecule. In some embodiments, the nucleic acid molecules (e.g., mRNA) of the present disclosure comprise a stem-loop sequence downstream (at the 3’ end) of the coding region in the nucleic acid molecule. In some embodiments, the stem-loop sequence is within the 3’-UTR of the nucleic acid molecule. In some cases, the nucleic acid molecule can contain more than one stem-loop sequence. In some embodiments, the nucleic acid molecule comprises at least one stem-loop sequence in the 5’-UTR and at least one stem-loop sequence in the 3’-UTR.
[0459] In some embodiments, the nucleic acid molecule comprising a stem-loop structure further comprises a stabilizing region. In some embodiments, the stabilizing region comprises at least one chain terminating nucleoside, which functions to slow degradation and thereby increase the half-life of the nucleic acid molecule. Exemplary chain terminating nucleosides that can be used in conjunction with the nucleic acid molecules of the present disclosure include, but are not limited to, 3'-deoxyadenosine (cordycepin); 3'-deoxyuridine; 3'-deoxycytosine; 3'-deoxyguanosine; 3'-deoxythymine; 2',3'-dideoxynucleosides, such as 2',3'-dideoxyadenosine, 2',3'-dideoxyuridine, 2',3'-dideoxycytosine, 2',3'-dideoxyguanosine, 2',3'-dideoxythymine; 2'-deoxynucleosides; or O-methyl nucleosides; 3'-deoxynucleosides; 2',3'-dideoxynucleosides; 3'-O-methyl nucleosides; 3'-O-ethyl nucleosides; 3'-arabinosides, and other alternative nucleosides known in the art and / or described herein. In other embodiments, the stem-loop structure can be stabilized by altering the 3'-region of the polynucleotide, which can prevent and / or inhibit the addition of oligo(U) (International Patent Publication No. WO2013 / 103659, which is incorporated herein by reference in its entirety).
[0460] In some embodiments, the nucleic acid molecules of the present disclosure comprise at least one stem-loop sequence and a poly-A region or polyadenylation signal. Non-limiting examples of polynucleotide sequences comprising at least one stem-loop sequence and a poly-A region or polyadenylation signal include the sequences described in International Patent Publication No. WO2013 / 120497, International Patent Publication No. WO2013 / 120629, International Patent Publication No. WO2013 / 120500, International Patent Publication No. WO2013 / 120627, International Patent Publication No. WO2013 / 120498, International Patent Publication No. WO2013 / 120626, International Patent Publication No. WO2013 / 120499, and International Patent Publication No. WO2013 / 120628, the contents of each are incorporated herein by reference in their entirety.
[0461] In some embodiments, the nucleic acid molecules comprising a stem-loop sequence and a poly-A region or polyadenylation signal can encode a pathogen antigen or fragment thereof, such as the polynucleotide sequences described in International Patent Publication No. WO2013 / 120499 and International Patent Publication No. WO2013 / 120628, the contents of each are incorporated herein by reference in their entirety.
[0462] In some embodiments, the nucleic acid molecule comprising a stem-loop sequence and a poly-A region or polyadenylation signal can encode a therapeutic protein, such as the polynucleotide sequences described in International Patent Publication No. WO 2013 / 120497 and International Patent Publication No. WO 2013 / 120629, the contents of each are incorporated herein by reference in their entirety.
[0463] In some embodiments, the nucleic acid molecule comprising a stem-loop sequence and a poly-A region or polyadenylation signal can encode a tumor antigen or fragment thereof, such as the polynucleotide sequences described in International Patent Publication No. WO 2013 / 120500 and International Patent Publication No. WO 2013 / 120627, the contents of each are incorporated herein by reference in their entirety.
[0464] In some embodiments, the nucleic acid molecule comprising a stem-loop sequence and a poly-A region or polyadenylation signal can encode a sensitizing antigen or autoimmune self-antigen, such as the polynucleotide sequences described in International Patent Publication No. WO 2013 / 120498 and International Patent Publication No. WO 2013 / 120626, the contents of each are incorporated herein by reference in their entirety.
[0465] Functional nucleotide analogs
[0466] In some embodiments, the payload nucleic acid molecules described herein contain only classical nucleotides selected from A (adenosine), G (guanosine), C (cytosine), U (uridine), and T (thymidine). Without being bound by theory, it is contemplated that certain functional nucleotide analogs can impart useful properties to the nucleic acid molecules. In the context of the present disclosure, examples of such useful properties include, but are not limited to, increased stability of the nucleic acid molecule, decreased immunogenicity of the nucleic acid molecule in inducing an innate immune response, increased production of a protein encoded by the nucleic acid molecule, increased intracellular delivery and / or retention of the nucleic acid molecule, and / or decreased cytotoxicity of the nucleic acid molecule, etc.
[0467] Accordingly, in some embodiments, the payload nucleic acid molecule comprises at least one functional nucleotide analog as described herein. In some embodiments, the functional nucleotide analog contains at least one chemical modification to the nucleobase, sugar group, and / or phosphate group. Accordingly, the payload nucleic acid molecule comprising at least one functional nucleotide analog contains at least one chemical modification to the nucleobase, sugar group, and / or internucleoside linkage. Exemplary chemical modifications to the nucleobase, sugar group, or internucleoside linkage of a nucleic acid molecule are provided herein.
[0468] As described herein, between 0% and 100% of the nucleotides of all of the nucleotides in a payload nucleic acid molecule can be functional nucleotide analogs as described herein. For example, in various embodiments, between about 1% and about 20%, between about 1% and about 25%, between about 1% and about 50%, between about 1% and about 60%, between about 1% and about 70%, between about 1% and about 80%, between about 1% and about 90%, between about 1% and about 95%, between about 10% and about 20%, between about 10% and about 25%, between about 10% and about 50%, between about 10% and about 60%, between about 10% and about 70%, between about 10% and about 80%, between about 10% and about 90%, between about 10% and about 95%, between about 10% and about 100%, between about 20% and about 25%, between about 20% and about 50%, between about 20% and about 60%, between about 20% and about 70%, between about 20% and about 80%, between about 20% and about 90%, between about 20% and about 95%, between about 20% and about 100%, between about 50% and about 60%, between about 50% and about 70%, between about 50% and about 80%, between about 50% and about 90%, between about 50% and about 95%, between about 50% and about 100%, between about 70% and about 80%, between about 70% and about 90%, between about 70% and about 95%, between about 70% and about 100%, between about 80% and about 90%, between about 80% and about 95%, between about 80% and about 100%, between about 90% and about 95%, between about 90% and about 100%, or between about 95% and about 100% of the nucleotides in a nucleic acid molecule are functional nucleotide analogs as described herein. In any of these embodiments, the functional nucleotide analogs can be present at any location in the nucleic acid molecule, including the 5'-terminus, the 3'-terminus, and / or one or more internal locations. In some embodiments, a single nucleic acid molecule can contain different sugar modifications, different nucleobase modifications, and / or different types of internucleoside linkages (e.g., backbone structures).
[0469] As described herein, a range of from 0% to 100% of the nucleotides in one type of all nucleotides in a payload nucleic acid molecule (e.g., as one type of all purine-containing nucleotides, or as one type of all pyrimidine-containing nucleotides, or as one type of all A, G, C, T, or U) can be a functional nucleotide analog as described herein. For example, in various embodiments, about 1% to about 20%, about 1% to about 25%, about 1% to about 50%, about 1% to about 60%, about 1% to about 70%, about 1% to about 80%, about 1% to about 90%, about 1% to about 95%, about 10% to about 20%, about 10% to about 25%, about 10% to about 50%, about 10% to about 60%, about 10% to about 70%, about 10% to about 80%, about 10% to about 90%, about 10% to about 95%, about 10% to about 100%, about 20% to about 25%, about 20% to about 50%, about 20% to about 60%, about 20% to about 70%, about 20% to about 80%, about 20% to about 90%, about 20% to about 95%, about 20% to about 100%, about 50% to about 60%, about 50% to about 70%, about 50% to about 80%, about 50% to about 90%, about 50% to about 95%, about 50% to about 100%, about 70% to about 80%, about 70% to about 90%, about 70% to about 95%, about 70% to about 100%, about 80% to about 90%, about 80% to about 95%, about 80% to about 100%, about 90% to about 95%, about 90% to about 100%, or about 95% to about 100% of the nucleotides in one type of all nucleotides in a nucleic acid molecule are a functional nucleotide analog as described herein. In any of these embodiments, the functional nucleotide analogs can be present at any location in the nucleic acid molecule, including the 5'-terminus, the 3'-terminus, and / or one or more internal locations. In some embodiments, a single nucleic acid molecule can contain different sugar modifications, different nucleobase modifications, and / or different types of internucleoside linkages (e.g., backbone structures).
[0470] Modifications of nucleobases
[0471] In some embodiments, the functional nucleotide analogs contain non-canonical nucleobases. In some embodiments, canonical nucleobases (e.g., adenine, guanine, uracil, thymine, and cytosine) in a nucleotide can be modified or replaced to provide one or more functional analogs of the nucleotide. Exemplary modifications of nucleobases include, but are not limited to, one or more substitutions or modifications, including but not limited to alkyl, aryl, halo, oxo, hydroxyl, alkoxy, and / or thio substitutions; one or more fused or open rings, oxidations, and / or reductions.
[0472] In some embodiments, the non-canonical nucleobase is a modified uracil. Exemplary nucleobases and nucleosides having a modified uracil include pseudouridine (ψ), pyridin-4-one ribonucleoside, 5-azauracil, 6-azauracil, 2-thio-5-azauracil, 2-thiouracil (s 2 U), 4-thio-uracil (s 4 U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uracil (ho 5 U), 5-aminoallyl-uracil, 5-halouracil (e.g., 5-iodouracil or 5-bromouracil), 3- methyluracil (m 3 U), 5-methoxyuracil (mo 5 U), uracil 5-oxyacetic acid (cmo 5 U), uracil 5-oxyacetic acid methyl ester (mcmo 5 U), 5-carboxymethyl-uracil (cm 5 U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uracil (chm 5 U), 5-carboxyhydroxymethyl-uracil methyl ester (mchm 5 U), 5-methoxycarbonylmethyl-uracil (mcm 5 U), 5-methoxycarbonylmethyl-2-thiouracil (mcm 5 s 2 U), 5-aminomethyl-2-thiouracil (nm 5 s 2 U), 5-methylaminomethyluracil (mnm 5 U), 5-methylaminomethyl-2-thiouracil (mnm 5 s 2 U), 5-methylaminomethyl-2-selenouracil (mnm 5 se 2 U), 5-carbamoylmethyluracil (ncm 5 U), 5-carboxymethylaminomethyl-uracil (cmnm 5 U), 5-carboxymethylaminomethyl-2-thiouracil (cmnm 5 s 2 U), 5-propynyl-uracil, 1-propynyl-pseudouracil, 5-taurinomethyl-uracil (τm 5 U), 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uracil (τm 5 5s 2 U), 1-taurinomethyl-4-thio-pseudouridine, 5-methyl-uracil (m 5 U, i.e., having the nucleobase deoxythymidine), 1-methyl-pseudouridine (m1 ψ), 1-ethyl-pseudouridine (Et 1 ψ), 5-methyl-2-thiouracil (m 5 s 2 U), 1-methyl-4-thio-pseudouridine (m 1 s 4 ψ), 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine (m 3 ψ), 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouracil (D), dihydropseudouridine, 5,6-dihydrouracil, 5-methyl-dihydrouracil (m 5 D), 2-thio-dihydrouracil, 2-thio-dihydropseudouridine, 2-methoxy-uracil, 2-methoxy-4-thio-uracil, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl) uracil (acp 3 U), 1-methyl-3-(3-amino-3-carboxypropyl) pseudouridine (acp 3 ψ), 5-(isopentenylaminomethyl)uracil (m 5 U), 5-(isopentenylaminomethyl)-2-thio-uracil (m 5 s 2 U), 5,2'-O-dimethyl-uridine (m 5 Um), 2-thio-2'-O-methyl-uridine (s 2 Um), 5-methoxycarbonylmethyl-2'-O-methyl-uridine (mcm 5 Um), 5-carbamoylmethyl-2'-O-methyl-uridine (ncm 5 Um), 5-carboxymethylaminomethyl-2'-O-methyl-uridine (cmnm 5 Um), 3,2'-O-dimethyl-uridine (m 3 Um) and 5-(isopentenylaminomethyl)-2'-O-methyl-uridine (inm 5 Um), 1-thio-uracil, deoxythymidine, 5-(2-methoxycarbonylvinyl)-uracil, 5-(carbamoylhydroxymethyl)-uracil, 5-carbamoylmethyl-2-thio-uracil, 5-carboxymethyl-2-thio-uracil, 5-cyanomethyl-uracil, 5-methoxy-2-thio-uracil and 5-[3-(1-E-propenylamino)]uracil.
[0473] In some embodiments, the non-canonical nucleobase is a modified cytosine. Exemplary nucleobases and nucleosides having a modified cytosine include 5-azacytosine, 6-azacytosine, pseudisocytidine, 3-methylcytosine (m3C), N4-acetylcytosine (ac4C), 5-formylcytosine (f5C), N4-methyl-cytosine (m4C), 5-methyl-cytosine (m5C), 5-halo-cytosine (e.g. 5-iodo-cytosine), 5-hydroxymethyl-cytosine (hm5C), 1-methyl-pseudisocytidine, pyrrolocytosine, pyrroloisocytidine, 2-thiocytosine (s2C), 2-thio-5-methylcytosine, 4-thiopseudisocytidine, 4-thio-l-methyl-pseudisocytidine, 4-thio-l-methyl-l-deaza-pseudisocytidine, l-methyl-l-deaza-pseudisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytosine, 2-methoxy-5-methyl-cytosine, 4-methoxy-pseudisocytidine, 4-methoxy-l-methyl-pseudisocytidine, lysidine (k2C), 5,2'-O-dimethyl-cytidine (m5Cm), N4-acetyl-2'-O-methyl-cytidine (ac4Cm), N4,2'-O-dimethyl-cytidine (m4Cm), 5-formyl-2'-O-methyl-cytidine (f5Cm), N4,N4,2'-O-trimethyl-cytidine (m42Cm), 1-thiocytosine, 5-hydroxy-cytosine, 5-(3-azidopropyl)-cytosine, and 5-(2-azidoethyl)-cytosine.
[0474] In some embodiments, the non-canonical nucleobase is a modified adenine. Exemplary nucleobases and nucleosides having an alternative adenine include 2-amino-purine, 2,6-diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-halo-purine (e.g., 6-chloro-purine), 2-amino-6-methyl-purine, 8-azido-adenine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyl-adenine (mlA), 2-methyl-adenine (m2A), N6-methyl-adenine (m6A), 2-methylthio-N6-methyl-adenine (ms2m6A), N6-isopentenyl-adenine (i6A), 2-methylthio-N6-isopentenyl-adenine (ms2i6A), N6-(cis-hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis- hydroxyisopentenyl)adenine (ms2io6A), N6-glycinylcarbamoyl-adenine (g6A), N6- threonylcarbamoyl-adenine (t6A), N6-methyl-N6-threonylcarbamoyl-adenine (m6t6A), 2-methylthio-N6-threonylcarbamoyl-adenine (ms2g6A), N6,N6-dimethyl-adenine (m62A), N6-hydroxynorvalylcarbamoyl-adenine (hn6A), 2-methylthio-N6- hydroxynorvalylcarbamoyl-adenine (ms2hn6A), N6-acetyl-adenine (ac6A), 7-methyl- adenine, 2-methylthio-adenine, 2-methoxy-adenine, N6,2’-O-dimethyl-adenosine (m6Am), N6,N6,2’-O-trimethyl-adenosine (m62Am), 1,2’-O-dimethyl-adenosine (mlAm), 2-amino-N6-methyl-purine, 1-thio-adenine, 8-azido-adenine, N6-(19-amino- pentaoxaninyl)-adenine, 2,8-dimethyl-adenine, N6-formyl-adenine, and N6- hydroxymethyl-adenine.
[0475] In some embodiments, the non-canonical nucleobase is a modified guanine. Exemplary nucleobases and nucleosides having modified guanines include inosine (I), 1-methyl-inosine (ml), wyosine (imG), methylwyosine (mimG), 4-demethyl-wyosine (imG-14), iso-wyosine (imG2), wybutosine (yW), peroxywybutosine (o2yW), hydroxywybutosine (OHYW), undermodified hydroxywybutosine (OHYW*), 7-deaza-guanine, queuosine (Q), epoxyqueuosine (oQ), galactosyl-queuosine (galQ), mannosyl-queuosine (manQ), 7-cyano-7-deaza-guanine (preQO), 7-aminomethyl-7-deaza-guanine (preQl), archaeosine (G+), 7-deaza-8-aza-guanine, 6-thio-guanine, 6-thio-7-deaza-guanine, 6-thio-7-deaza-8-aza-guanine, 7-methyl-guanine (m7G), 6-thio-7-methyl-guanine, 7-methyl-inosine, 6-methoxy-guanine, 1-methyl-guanine (mlG), N2-methyl-guanine (m2G), N2,N2-dimethyl-guanine (m22G), N2,7-dimethyl-guanine (m2,7G), N2,N2,7-dimethyl-guanine (m2,2,7G), 8-oxo-guanine, 7-methyl-8-oxo-guanine, 1-methyl-6-thio-guanine, N2-methyl-6-thio-guanine, N2,N2-dimethyl-6-thio-guanine, N2-methyl-2'-O-methyl-guanosine (m2Gm), N2,N2-dimethyl-2'-O-methyl-guanosine (m22Gm), 1-methyl-2'-O-methyl-guanosine (mlGm), N2,7-dimethyl-2'-O-methyl-guanosine (m2,7Gm), 2'-O-methyl-inosine (Im), 1,2'-O-dimethyl-inosine (mlm), 1-thio-guanine, and O-6-methyl-guanine.
[0476] In some embodiments, the non-canonical nucleobases of the functional nucleotide analogs can independently be a purine, a pyrimidine, a purine analog, or a pyrimidine analog. For example, in some embodiments, the non-canonical nucleobases can be a modified adenine, cytosine, guanine, uracil, or hypoxanthine. In other embodiments, the non-canonical nucleobases can also include, for example, naturally occurring and synthetic derivatives of the bases, including pyrazolo[3,4-d]pyrimidine; 5-methylcytosine (5-me-C); 5-hydroxymethyl cytosine; xanthine; hypoxanthine; 2- aminoadenine; 6-methyl and other alkyl derivatives of adenine and guanine; 2-propyl and other alkyl derivatives of adenine and guanine; 2-thiouracil, 2-thiothymine and 2- thiocytosine; 5-propynyluracil and cytosine; 6-azo uracil, cytosine and thymine; 5-uracil (pseudouracil); 4-thiouracil; 8-halo (e.g., 8-bromo), 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines; 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines; 7-methylguanine and 7-methyladenine; 8-azaguanine and 8-azadenine; deazaguanine, 7-deazaguanine, 3-deazaguanine; deazadenine, 7-deazadenine, 3-deazadenine; pyrazolo[3,4-d]pyrimidine; imidazo[l,5-a]l,3,5-triazinone; 9-deazapurine; imidazo[4,5-d]pyrazine; thiazolo[4,5-d]pyrimidine; pyrazin-2-one; 1,2,4-triazine; pyridazine; or 1,3,5-triazine.
[0477] Modification of the sugar
[0478] In some embodiments, the functional nucleotide analogs contain non-canonical sugar groups. In various embodiments, the non-canonical sugar groups can be 5-carbon or 6-carbon sugars (e.g., pentose, ribose, arabinose, xylose, glucose, galactose, or deoxy derivatives thereof) with one or more substitutions, such as halo, hydroxyl, thiol, alkyl, alkoxy, alkenyloxy, alkynyloxy, cycloalkyl, aminoalkoxy, alkoxyalkoxy, hydroxyalkoxy, amino, azido, aryl, aminoalkyl, aminoalkenyl, aminoalkynyl, and the like.
[0479] In general, RNA molecules contain ribosyl groups, which are oxygen-containing 5-membered rings. Exemplary non-limiting alternative nucleotides include replacement of the oxygen in ribose (e.g., with S, Se, or an alkylene group, such as methylene or ethylene); addition of a double bond (e.g., replacement of ribose with a cyclopentenyl or cyclohexenyl group); annulation of the ribose ring (e.g., to form a 4-membered ring for a cyclobutane or oxetane); expansion of the ribose ring (e.g., to form a 6- or 7-membered ring with an additional carbon or heteroatom, such as for an alicyclic, aliphatic, alkenyl, or alkynyl sugar, such as for an anhydrohexitol, altritol, mannitol, cyclohexyl, cyclohexenyl, and N-morpholino (which also has an aminophosphate backbone)); polycyclic forms (e.g., tricyclic and “unlocked” forms, such as glycol nucleic acids (GNAs) (e.g., R-GNA or S-GNA, in which the ribose is replaced with a glycol unit linked to the phosphodiester bond), threose nucleic acids (TNAs, in which the ribose is replaced with an alpha-L-furanosyl-(3’ a 2’)), and peptide nucleic acids (PNAs, in which a 2-amino-ethyl-glycine linkage replaces the ribose and the phosphodiester backbone)).
[0480] In some embodiments, the sugar group contains one or more carbons having the opposite stereochemical configuration as the corresponding carbon in ribose. Thus, the nucleic acid molecule can include nucleotides containing, for example, arabinose or L-ribose as the sugar. In some embodiments, the nucleic acid molecule includes at least one nucleoside in which the sugar is L-ribose, 2’-O-methylribose, 2’-fluororibose, arabinose, a hexitol, LNA, or PNA.
[0481] Modifications of internucleoside linkages
[0482] In some embodiments, the payload nucleic acid molecules of the present disclosure can contain one or more modified internucleoside linkages (e.g., phosphate backbone). The phosphate group of the backbone can be altered by replacing one or more of the oxygen atoms with different substituents.
[0483] In some embodiments, the functional nucleotide analogs can include replacement of the unaltered phosphate moiety with another internucleoside linkage described herein. Examples of alternative phosphate groups include, but are not limited to, phosphorothioate, phosphoroselenoate, boranophosphate, boranophosphonate, phosphonite, phosphoramidate, phosphorodiamidate, alkyl or aryl phosphonates, and phosphotriesters. Both non-bridging oxygens of a phosphorodithioate are replaced with sulfur. The phosphate linkage can also be altered by replacing the linking oxygen with nitrogen (bridging phosphoramidate), sulfur (bridging phosphorothioate), and carbon (bridging methylenephosphonate).
[0484] Alternative nucleosides and nucleotides can include one or more non-bridging oxygens replaced by a borane moiety (BH3), sulfur (thio), methyl, ethyl and / or methoxy. As a non-limiting example, two non-bridging oxygens at the same position (e.g., alpha (α), beta (β) or gamma (γ) position) can be replaced by sulfur (thio) and methoxy. One or more oxygen atoms at the position of a replacement phosphate moiety (e.g., α-phosphorothioate) can impart RNA and DNA stability (e.g., stability against exonucleases and endonucleases) via non-natural thiophosphate backbone linkages. Phosphorothioate DNA and RNA have increased nuclease resistance and therefore have a longer half-life in a cellular environment.
[0485] Other internucleoside linkages that can be used in accordance with the present disclosure are described herein, including internucleoside linkages that do not contain a phosphorus atom.
[0486] Additional examples of nucleic acid molecules (e.g., mRNA), related compositions, formulations, and / or methods that can be used in conjunction with the present disclosure further include those described in WO 2002 / 098443, WO 2003 / 051401, WO 2008 / 052770, WO 2009127230, WO 2006122828, WO 2008 / 083949, WO 2010088927, WO 2010 / 037539, WO 2004 / 004743, WO 2005 / 016376, WO 2006 / 024518, WO 2007 / 095976, WO 2008 / 014979, WO 2008 / 077592, WO 2009 / 030481, WO 2009 / 095226, WO 2011069586, WO 2011026641, WO 2011 / 144358, WO 2012019780, WO 2012013326, WO 2012089338, WO 2012113513, WO 2012116811, WO 2012116810, WO 2013113502, WO 2013113501, WO 2013113736, WO 2013143698, WO 2013143699, WO 2013143700, WO 2013 / 120626, WO 2013120627, WO 2013120628, WO 2013120629, WO 2013174409, WO 2014127917, WO 2015 / 024669, WO 2015 / 024668, WO 2015 / 024667, WO 2015 / 024665, WO 2015 / 024666, WO 2015 / 024664, WO 2015101415, WO 2015101414, WO 2015024667, WO 2015062738, WO 2015101416, the contents of each of which are incorporated herein in their entirety.
[0487] 5.5 Formulations
[0488] In accordance with the present disclosure, the nanoparticle compositions described herein can include at least one lipid component and one or more additional components, such as therapeutic and / or prophylactic agents. The nanoparticle compositions can be designed for one or more particular applications or objectives. The constituents of the nanoparticle compositions can be selected based on the particular application or objective, and / or based on the efficacy, toxicity, expense, ease of use, availability, or other characteristics of one or more of the constituents. Similarly, the particular formulation of the nanoparticle composition can be selected for a particular application or objective based on, for example, the efficacy and toxicity of the particular combination of each of the constituents.
[0489] The lipid component of the nanoparticle composition can include, for example, lipids according to one of formula (I) (and subformulas thereof) described herein, phospholipids (e.g., unsaturated lipids, such as DOPE or DSPC), PEG lipids, and structural lipids. Each component of the lipid component can be provided in a specific fraction.
[0490] In one embodiment, a nanoparticle composition is provided herein, comprising a cationic or ionizable lipid compound, a therapeutic agent, and one or more excipients as provided herein. In one embodiment, the cationic or ionizable lipid compound comprises a compound according to one of formula (I) (and its subformulas) as described herein, and optionally one or more additional ionizable lipid compounds selected. In one embodiment, the one or more excipients are selected from neutral lipids, steroids, and polymer-bound lipids. In one embodiment, the therapeutic agent is encapsulated in or associated with the lipid nanoparticles.
[0491] In one embodiment, provided herein is a nanoparticle composition (lipid nanoparticle) comprising:
[0492] i) 40 mol% to 50 mol% of a cationic lipid;
[0493] ii) neutral lipids;
[0494] iii) steroids;
[0495] iv) polymer-bound lipids; and
[0496] v) Therapeutic agents.
[0497] As used herein, "molar percentage" refers to the molar percentage of a component relative to the total moles of all lipid components in the LNP (ie, the total moles of cationic lipids, neutral lipids, steroids, and polymer-bound lipids).
[0498] In one embodiment, the lipid nanoparticles comprise 41 to 49 mol%, 41 to 48 mol%, 42 to 48 mol%, 43 to 48 mol%, 44 to 48 mol%, 45 to 48 mol%, 46 to 48 mol%, or 47.2 to 47.8 mol% of cationic lipids. In one embodiment, the lipid nanoparticles comprise about 47.0 mol%, 47.1 mol%, 47.2 mol%, 47.3 mol%, 47.4 mol%, 47.5 mol%, 47.6 mol%, 47.7 mol%, 47.8 mol%, 47.9 mol%, or 48.0 mol% of cationic lipids.
[0499] In one embodiment, the neutral lipid is present at a concentration ranging from 5 mole% to 15 mole%, 7 mole% to 13 mole%, or 9 mole% to 11 mole%. In one embodiment, the neutral lipid is present at a concentration of about 9.5 mole%, 10 mole%, or 10.5 mole%. In one embodiment, the molar ratio of cationic lipid to neutral lipid ranges from about 4.1 : 1.0 to about 4.9: 1.0, about 4.5: 1.0 to about 4.8: 1.0, or about 4.7: 1.0 to 4.8: 1.0.
[0500] In one embodiment, the steroid is present at a concentration ranging from 39 mole% to 49 mole%, 40 mole% to 46 mole%, 40 mole% to 44 mole%, 40 mole% to 42 mole%, 42 mole% to 44 mole%, or 44 mole% to 46 mole%. In one embodiment, the steroid is present at a concentration of 40 mole%, 41 mole%, 42 mole%, 43 mole%, 44 mole%, 45 mole%, or 46 mole%. In one embodiment, the molar ratio of cationic lipid to steroid ranges from 1.0:0.9 to 1.0:1.2, or 1.0:1.0 to 1.0:1.2. In one embodiment, the steroid is cholesterol.
[0501] In one embodiment, the ratio of therapeutic agent to lipid in the LNP (i.e., N / P, where N represents the number of moles of cationic lipid and P represents the number of moles of phosphate present as part of the nucleic acid backbone) ranges from 2: 1 to 30: 1, for example, from 3: 1 to 22: 1. In one embodiment, the N / P ranges from 6: 1 to 20: 1 or 2: 1 to 12: 1. Exemplary N / P ranges include about 3: 1, about 6: 1, about 12: 1, and about 22: 1.
[0502] In one embodiment, provided herein is a lipid nanoparticle comprising:
[0503] i) a cationic lipid having an effective pKa greater than 6.0;
[0504] ii) 5 mole% to 15 mole% of a neutral lipid;
[0505] iii) 1 mole% to 15 mole% of an anionic lipid;
[0506] iv) 30 mole% to 45 mole% of a steroid;
[0507] v) a polymer-bound lipid; and
[0508] vi) a therapeutic agent, or a pharmaceutically acceptable salt or prodrug thereof,
[0509] wherein the mole percentages are determined based on the total number of moles of lipids present in the lipid nanoparticle.
[0510] In an embodiment, the cationic lipid can be any of a variety of lipid species that carry a net positive charge at a selected pH, e.g., physiological pH. Exemplary cationic lipids are described below. In an embodiment, the pKa value of the cationic lipid is greater than 6.25. In an embodiment, the pKa value of the cationic lipid is greater than 6.5. In an embodiment, the pKa value of the cationic lipid is greater than 6.1, greater than 6.2, greater than 6.3, greater than 6.35, greater than 6.4, greater than 6.45, greater than 6.55, greater than 6.6, greater than 6.65, or greater than 6.7.
[0511] In an embodiment, the lipid nanoparticle comprises 40-45 mole percent of the cationic lipid. In an embodiment, the lipid nanoparticle comprises 45-50 mole percent of the cationic lipid.
[0512] In an embodiment, the molar ratio of the cationic lipid to the neutral lipid is in the range of about 2: 1 to about 8: 1. In an embodiment, the lipid nanoparticle comprises 5-10 mole percent of the neutral lipid.
[0513] Exemplary anionic lipids include, but are not limited to, phosphatidylglycerol, dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), or 1,2-distearoyl-sn-glycero-3-phospho-(1'-rac-glycerol) (DSPG).
[0514] In an embodiment, the lipid nanoparticle comprises 1-10 mole percent of the anionic lipid. In an embodiment, the lipid nanoparticle comprises 1-5 mole percent of the anionic lipid. In an embodiment, the lipid nanoparticle comprises 1-9 mole percent, 1-8 mole percent, 1-7 mole percent, or 1-6 mole percent of the anionic lipid. In an embodiment, the molar ratio of the anionic lipid to the neutral lipid is in the range of 1: 1 to 1: 10.
[0515] In an embodiment, the steroid is cholesterol. In an embodiment, the molar ratio of the cationic lipid to the cholesterol is in the range of about 5: 1 to 1: 1. In an embodiment, the lipid nanoparticle comprises 32-40 mole percent of the steroid.
[0516] In an embodiment, the sum of the mole percent of the neutral lipid and the mole percent of the anionic lipid is in the range of 5-15 mole percent. In an embodiment, the sum of the mole percent of the neutral lipid and the mole percent of the anionic lipid is in the range of 7-12 mole percent.
[0517] In one embodiment, the molar ratio of anionic lipid to neutral lipid is in the range of 1 : 1 to 1 : 10. In one embodiment, the sum of the molar percentage of neutral lipid and the molar percentage of steroid is in the range of 35 molar % to 45 molar %.
[0518] In one embodiment, the lipid nanoparticle comprises:
[0519] i) 45 molar % to 55 molar % of cationic lipid;
[0520] ii) 5 molar % to 10 molar % of neutral lipid;
[0521] iii) 1 molar % to 5 molar % of anionic lipid; and
[0522] iv) 32 molar % to 40 molar % of steroid.
[0523] In one embodiment, the lipid nanoparticle comprises 1.0 molar % to 2.5 molar % of polymer-bound lipid. In one embodiment, the polymer-bound lipid is present at a concentration of about 1.5 molar %.
[0524] In one embodiment, the neutral lipid is present at a concentration in the range of 5 molar % to 15 molar %, 7 molar % to 13 molar %, or 9 molar % to 11 molar %. In one embodiment, the neutral lipid is present at a concentration of about 9.5 molar %, 10 molar %, or 10.5 molar %. In one embodiment, the molar ratio of cationic lipid to neutral lipid is in the range of about 4.1 : 1.0 to about 4.9 : 1.0, about 4.5 : 1.0 to about 4.8 : 1.0, or about 4.7 : 1.0 to 4.8 : 1.0.
[0525] In one embodiment, the steroid is cholesterol. In one embodiment, the steroid is present at a concentration in the range of 39 molar % to 49 molar %, 40 molar % to 46 molar %, 40 molar % to 44 molar %, 40 molar % to 42 molar %, 42 molar % to 44 molar %, or 44 molar % to 46 molar %. In one embodiment, the steroid is present at a concentration of 40 molar %, 41 molar %, 42 molar %, 43 molar %, 44 molar %, 45 molar %, or 46 molar %. In one embodiment, the molar ratio of cationic lipid to steroid is in the range of 1.0 : 0.9 to 1.0 : 1.2, or 1.0 : 1.0 to 1.0 : 1.2.
[0526] In one embodiment, the molar ratio of cationic lipid to steroid is in the range of 5 : 1 to 1 : 1.
[0527] In one embodiment, the lipid nanoparticle comprises 1.0 to 2.5 mole percent of polymer-bound lipid. In one embodiment, the polymer-bound lipid is present at a concentration of about 1.5 mole percent.
[0528] In one embodiment, the molar ratio of cationic lipid to polymer-bound lipid is in the range of about 100: 1 to about 20: 1. In one embodiment, the molar ratio of cationic lipid to polymer-bound lipid is in the range of about 35: 1 to about 25: 1.
[0529] In one embodiment, the average diameter of the lipid nanoparticle is in the range of 50 to 100 nm or 60 to 85 nm.
[0530] In one embodiment, the composition comprises a cationic lipid provided herein, DSPC, cholesterol, and a PEG-lipid, and mRNA. In one embodiment, the molar ratio of the cationic lipid provided herein, DSPC, cholesterol, and PEG-lipid is about 50: 10:38.5: 1.5.
[0531] The nanoparticle compositions can be designed for one or more specific applications or targets. For example, the nanoparticle compositions can be designed for delivery of a therapeutic and / or prophylactic agent, such as RNA, to a particular cell, tissue, organ, or system or group thereof within a mammal. The physicochemical properties of the nanoparticle compositions can be altered to increase selectivity for a particular body target. For example, the particle size can be adjusted based on the fenestration size of different organs. The therapeutic and / or prophylactic agent included in the nanoparticle composition can also be selected based on one or more desired delivery targets. For example, the therapeutic and / or prophylactic agent can be selected for a particular indication, condition, disease, or disorder and / or for delivery to a particular cell, tissue, organ, or system or group thereof, such as local or specific delivery. In certain embodiments, the nanoparticle composition can comprise mRNA encoding a polypeptide of interest that is capable of being translated within a cell to produce the polypeptide of interest. Such compositions can be designed for specific delivery to a particular organ. In certain embodiments, the composition can be designed for specific delivery to the liver of a mammal.
[0532] The amount of therapeutic and / or prophylactic agent in a nanoparticle composition can depend on the size, composition, desired target and / or application, or other properties of the nanoparticle composition, as well as the properties of the therapeutic and / or prophylactic agent. For example, the amount of RNA that can be used in a nanoparticle composition can depend on the size, sequence, and other characteristics of the RNA. The relative amounts of therapeutic and / or prophylactic agent and other components, such as lipids, in a nanoparticle composition can also vary. In some embodiments, the wt / wt ratio of the lipid component to the therapeutic and / or prophylactic agent in a nanoparticle composition can be about 5: 1 to about 60: 1, such as 5: 1, 6: 1, 7: 1, 8: 1, 9: 1, 10: 1, 11: 1, 12: 1, 13: 1, 14: 1, 15: 1, 16: 1, 17: 1, 18: 1, 19: 1, 20: 1, 25: 1, 30: 1, 35: 1, 40: 1, 45: 1, 50: 1, and 60: 1. For example, the wt / wt ratio of the lipid component to the therapeutic and / or prophylactic agent can be about 10: 1 to about 40: 1. In certain embodiments, the wt / wt ratio is about 20: 1. The amount of therapeutic and / or prophylactic agent in a nanoparticle composition can be measured, for example, using absorption spectroscopy, such as ultraviolet-visible spectroscopy.
[0533] In some embodiments, a nanoparticle composition comprises one or more RNAs, and one or more RNAs, lipids, and amounts thereof can be selected to provide a particular N:P ratio. The N:P ratio of a composition refers to the molar ratio of nitrogen atoms in the one or more lipids to the number of phosphate groups in the RNA. In some embodiments, a lower N:P ratio is selected. One or more RNAs, lipids, and amounts thereof can be selected to provide an N:P ratio of about 2: 1 to about 30: 1, such as 2: 1, 3: 1, 4: 1, 5: 1, 6: 1, 7: 1, 8: 1, 9: 1, 10: 1, 12: 1, 14: 1, 16: 1, 18: 1, 20: 1, 22: 1, 24: 1, 26: 1, 28: 1, or 30: 1. In certain embodiments, the N:P ratio can be about 2: 1 to about 8: 1. In other embodiments, the N:P ratio is about 5: 1 to about 8: 1. For example, the N:P ratio can be about 5.0: 1, about 5.5: 1, about 5.67: 1, about 6.0: 1, about 6.5: 1, or about 7.0: 1. For example, the N:P ratio can be about 5.67: 1.
[0534] The physical properties of a nanoparticle composition can depend on its components. For example, a nanoparticle composition comprising cholesterol as a structural lipid can have different characteristics than a nanoparticle composition comprising a different structural lipid. Similarly, the characteristics of a nanoparticle composition can depend on the absolute or relative amounts of its components. For example, a nanoparticle composition comprising a higher molar fraction of phospholipid can have different characteristics than a nanoparticle composition comprising a lower molar fraction of phospholipid. The characteristics can also vary depending on the method and conditions of preparation of the nanoparticle composition.
[0535] A nanoparticle composition can be characterized by a variety of methods. For example, microscopy (e.g., transmission electron microscopy or scanning electron microscopy) can be used to examine the morphology and size distribution of a nanoparticle composition. Dynamic light scattering or potentiometry (e.g., potentiometric titration) can be used to measure zeta potential. Dynamic light scattering can also be used to determine particle size. Instruments such as the Zetasizer Nano ZS (Malvern Instruments Ltd, Malvern, Worcestershire, UK) can also be used to measure a variety of characteristics of a nanoparticle composition, such as particle size, polydispersity index, and zeta potential.
[0536] In various embodiments, the average size of a nanoparticle composition can be between tens of nanometers and hundreds of nanometers. For example, the average size can be about 40 nm to about 150 nm, such as about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm. In some embodiments, the average size of a nanoparticle composition can be about 50 nm to about 100 nm, about 50 nm to about 90 nm, about 50 nm to about 80 nm, about 50 nm to about 70 nm, about 50 nm to about 60 nm, about 60 nm to about 100 nm, about 60 nm to about 90 nm, about 60 nm to about 80 nm, about 60 nm to about 70 nm, about 70 nm to about 100 nm, about 70 nm to about 90 nm, about 70 nm to about 80 nm, about 80 nm to about 100 nm, about 80 nm to about 90 nm, or about 90 nm to about 100 nm. In certain embodiments, the average size of a nanoparticle composition can be about 70 nm to about 100 nm. In some embodiments, the average size can be about 80 nm. In other embodiments, the average size can be about 100 nm.
[0537] The nanoparticle composition can be relatively homogeneous. A polydispersity index can be used to indicate the homogeneity of the nanoparticle composition, e.g., the particle size distribution of the nanoparticle composition. A smaller (e.g., less than 0.3) polydispersity index generally indicates a narrower particle size distribution. The polydispersity index of the nanoparticle composition can be about 0 to about 0.25, e.g., 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of the nanoparticle composition can be about 0.10 to about 0.20.
[0538] The zeta potential of the nanoparticle composition can be used to indicate the electrokinetic potential of the composition. For example, the zeta potential can describe the surface charge of the nanoparticle composition. Nanoparticle compositions with relatively lower positive or negative charge are generally desirable because highly charged substances can have undesirable interactions with cells, tissues, and other components in the body. In some embodiments, the zeta potential of the nanoparticle composition can be about -10 mV to about +20 mV, about -10 mV to about +15 mV, about -10 mV to about +10 mV, about -10 mV to about +5 mV, about -10 mV to about 0 mV, about -10 mV to about -5 mV, about -5 mV to about +20 mV, about -5 mV to about +15 mV, about -5 mV to about +10 mV, about -5 mV to about +5 mV, about -5 mV to about 0 mV, about 0 mV to about +20 mV, about 0 mV to about +15 mV, about 0 mV to about +10 mV, about 0 mV to about +5 mV, about +5 mV to about +20 mV, about +5 mV to about +15 mV, or about +5 mV to about +10 mV.
[0539] The encapsulation efficiency of a therapeutic agent and / or prophylactic agent describes the amount of therapeutic agent and / or prophylactic agent encapsulated or otherwise associated with the nanoparticle composition after preparation relative to the initial amount provided. The encapsulation efficiency desirably is high (e.g., close to 100%). The encapsulation efficiency can be measured, for example, by comparing the amount of therapeutic agent and / or prophylactic agent in a solution containing the nanoparticle composition before and after the nanoparticle composition is disrupted with one or more organic solvents or detergents. Fluorescence can be used to measure the amount of free therapeutic agent and / or prophylactic agent (e.g., RNA) in solution. For the nanoparticle compositions described herein, the encapsulation efficiency of a therapeutic agent and / or prophylactic agent can be at least 50%, e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency can be at least 80%. In certain embodiments, the encapsulation efficiency can be at least 90%.
[0540] The nanoparticle compositions can optionally comprise one or more coatings. For example, the nanoparticle compositions can be formulated as capsules, films, or tablets having a coating. Capsules, films, or tablets comprising the compositions described herein can have any useful size, tensile strength, hardness, or density.
[0541] 5.6 Pharmaceutical Compositions
[0542] According to the present disclosure, the nanoparticle compositions can be formulated, in whole or in part, as a pharmaceutical composition. A pharmaceutical composition can comprise one or more nanoparticle compositions. For example, a pharmaceutical composition can comprise one or more nanoparticle compositions comprising one or more different therapeutic agents and / or prophylactic agents. A pharmaceutical composition can further comprise one or more pharmaceutically acceptable excipients or auxiliary ingredients, such as described herein. General guidelines for the formulation and manufacture of pharmaceutical compositions and agents can be found in, e.g., Remington’s The Science and Practice of Pharmacy, 21st Ed., A. R. Gennaro; Lippincott, Williams & Wilkins, Baltimore, Md., 2006. Conventional excipients and auxiliary ingredients can be used in any pharmaceutical composition unless the combination of any conventional excipient or auxiliary ingredient with one or more components of the nanoparticle composition is incompatible. An excipient or auxiliary ingredient is incompatible with one or more components of the nanoparticle composition if the combination of the excipient or auxiliary ingredient with the components of the nanoparticle composition causes any undesirable biological effect or other deleterious effect.
[0543] In some embodiments, the one or more excipients or auxiliary ingredients can constitute more than 50% of the total mass or volume of the pharmaceutical composition comprising the nanoparticle composition. For example, the one or more excipients or auxiliary ingredients can constitute 50%, 60%, 70%, 80%, 90%, or a higher percentage of the pharmaceutical composition. In some embodiments, the pharmaceutically acceptable excipient is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% pure. In some embodiments, the excipient is approved for human and veterinary use. In some embodiments, the excipient is approved by the U.S. Food and Drug Administration. In some embodiments, the excipient is pharmaceutical grade. In some embodiments, the excipient meets the standards of the United States Pharmacopeia (USP), the European Pharmacopoeia (EP), the British Pharmacopoeia, and / or the International Pharmacopoeia.
[0544] The relative amounts of the one or more nanoparticle compositions, the one or more pharmaceutically acceptable excipients, and / or any additional ingredients in a pharmaceutical composition according to the present disclosure will vary depending on the identity, size, and / or condition of the subject being treated and further depending on the route of administration of the composition. For example, the pharmaceutical composition can comprise between 0.1% and 100% (wt / wt) of the one or more nanoparticle compositions.
[0545] In certain embodiments, the nanoparticle compositions and / or pharmaceutical compositions of the present disclosure are stored and / or transported refrigerated or frozen (e.g., at a temperature of 4°C or less, e.g., between about -150°C and about 0°C or between about -80°C and about -20°C (e.g., about -5°C, -10°C, -15°C, -20°C, -25°C, -30°C, -40°C, -50°C, -60°C, -70°C, -80°C, -90°C, -130°C, or -150°C). For example, a pharmaceutical composition comprising a compound of any of Formula (I) (and subformulae thereof) is a solution that is stored and / or transported refrigerated at, e.g., about -20°C, 30°C, -40°C, -50°C, -60°C, -70°C, or -80°C. In certain embodiments, the present disclosure also relates to a method of increasing the stability of a nanoparticle composition and / or pharmaceutical composition comprising a compound of any of Formula (I) (and subformulae thereof) by storing the nanoparticle composition and / or pharmaceutical composition at a temperature of 4°C or less, e.g., between about -150°C and about 0°C or between about -80°C and about -20°C, e.g., at a temperature of about -5°C, -10°C, -15°C, -20°C, -25°C, -30°C, -40°C, -50°C, -60°C, -70°C, -80°C, -90°C, -130°C, or -150°C. For example, the nanoparticle compositions and / or pharmaceutical compositions disclosed herein are stable for about at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 1 month, at least 2 months, at least 4 months, at least 6 months, at least 8 months, at least 10 months, at least 12 months, at least 14 months, at least 16 months, at least 18 months, at least 20 months, at least 22 months, or at least 24 months at a temperature of, e.g., 4°C or less (e.g., between about 4°C and -20°C). In one embodiment, the formulation is stable for at least 4 weeks at about 4°C. In certain embodiments, the pharmaceutical compositions of the present disclosure comprise a nanoparticle composition disclosed herein and a pharmaceutically acceptable carrier selected from one or more of the following: Tris, acetate (e.g., sodium acetate), citrate (e.g., sodium citrate), saline, PBS, and sucrose. In certain embodiments, the pharmaceutical compositions of the present disclosure have a pH of between about 7 and 8 (e.g., 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, or 8.0, or between 7.5 and 8 or between 7 and 7.8). For example, the pharmaceutical compositions of the present disclosure comprise a nanoparticle composition disclosed herein, Tris, saline, and sucrose, and have a pH of about 7.5-8, which are suitable for storage and / or transport at, e.g., about -20°C.For example, a pharmaceutical composition of the present disclosure comprises a nanoparticle composition disclosed herein and PBS, and has a pH of about 7-7.8, which is suitable for storage and / or transport at, for example, about 4°C or lower. In the context of the present disclosure, “stability,” “stabilization,” and “stable” refer to a nanoparticle composition and / or pharmaceutical composition disclosed herein that is resistant to chemical or physical changes (e.g., degradation, changes in particle size, aggregation, changes in encapsulation, etc.) under given manufacturing, preparation, transport, storage, and / or use conditions, for example, when subjected to stress, such as shear forces, freeze / thaw stress, etc.
[0546] A nanoparticle composition and / or a pharmaceutical composition comprising one or more nanoparticle compositions can be administered to any patient or subject, including one that can benefit from a therapeutic effect provided by delivery of a therapeutic and / or prophylactic agent to one or more particular cells, tissues, organs, or systems, or groups thereof, such as the renal system. Although the description provided herein regarding nanoparticle compositions and pharmaceutical compositions comprising nanoparticle compositions is primarily directed to compositions suitable for administration to humans, it will be understood by those skilled in the art that such compositions are generally suitable for administration to any other mammal. Modifications of the compositions suitable for administration to humans to render them suitable for administration to various animals are well known, and within the scope of ordinary skill in veterinary pharmacology to design and / or perform such modifications, if any, by routine experimentation. It is contemplated that subjects to which the compositions are administered include, but are not limited to, humans, other primates, and other mammals, including commercially relevant mammals, such as cows, pigs, horses, sheep, cats, dogs, mice, and / or rats.
[0547] A pharmaceutical composition comprising one or more nanoparticle compositions can be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparative methods include the step of bringing the active ingredient into association with the excipient and / or one or more other accessory ingredients, and then, if necessary or desirable, bringing the product to a condition of homogeneity, isolating, shaping, and / or packaging it in its desired single- or multi-dose unit.
[0548] Pharmaceutical compositions according to the present disclosure can be prepared, packaged, and / or sold in bulk, as single unit doses, and / or as multiple unit doses. As used herein, a “unit dose” is a discrete amount of the pharmaceutical composition comprising a predetermined quantity of the active ingredient (e.g., a nanoparticle composition) likely to prolong the therapeutic or prophylactic effect in a subject, in association with the appropriate pharmaceutical excipient(s). The quantity to be administered, and the particular
[0549] Pharmaceutical compositions can be prepared in various forms adapted to various routes and methods of administration. For example, pharmaceutical compositions can be prepared in the form of liquid dosage forms (e.g., emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups, and elixirs), injectable forms, solid dosage forms (e.g., capsules, tablets, pills, powders, and granules), dosage forms for topical and / or transdermal administration (e.g., ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalers, and patches), suspensions, powders, and other forms.
[0550] Liquid dosage forms for oral and parenteral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups, and / or elixirs. In addition to the active ingredient, the liquid dosage forms can include inert diluents commonly used in the art, such as water or other solvents, solubilizing agents and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3- butylene glycol, dimethylformamide, oils, in particular cottonseed oil, groundnut oil, corn germ oil, baby oil, olive oil, castor oil, and sesame seed oil, glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and mixtures of these TM with solubilizing agents, such as a Cremophor EL®
[0551] Injectable preparations, such as sterile injectable aqueous or oleaginous suspensions, can be formulated according to the known art using suitable dispersing or wetting agents and / or suspending agents. The sterile injectable preparation can be a sterile injectable solution, suspension, and / or emulsion in a nontoxic parenterally acceptable diluent or solvent, such as in 1,3-butanediol. Among the acceptable vehicles and solvents that can be employed are water, Ringer's solution, USP, and isotonic sodium chloride solution. Sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil can be employed including synthetic mono- or diglycerides. Fatty acids, such as oleic acid, find use in the preparation of injectables.
[0552] The injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter, and / or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium just prior to use.
[0553] The present disclosure features methods of delivering a therapeutic and / or prophylactic agent to a mammalian cell or organ, producing a polypeptide of interest in a mammalian cell, and treating a disease or condition in a mammal in need thereof, comprising administering to the mammal a nanoparticle composition comprising the therapeutic and / or prophylactic agent and / or contacting a mammalian cell with the nanoparticle composition.
[0554] 6. Examples
[0555] The examples in this section are provided as examples only and are not intended to be limiting.
[0556] General Methods.
[0557] General preparative HPLC method: HPLC purification was performed on a Waters 2767 equipped with a diode array detector (DAD) on an Inertsil Pre-C8 OBD column, generally using water containing 0.1% TFA as solvent A and acetonitrile as solvent B.
[0558] General LCMS method: LCMS analysis was performed on a Shimadzu (LC-MS2020) system. Chromatography was performed on a SunFire C18, generally using water containing 0.1% formic acid as solvent A and acetonitrile containing 0.1% formic acid as solvent B.
[0559] 6.1 Example 1: Preparation of starting materials and intermediates.
[0560] Preparation of Compound A
[0561]
[0562] To a solution of 2-hexyldecan-1-ol (2.0 g, 8.33 mmol, 1.0 eq.) and 6-bromohexanoic acid (2.0 g, 10.0 mmol, 1.2 eq.) in 30 mL of dichloromethane was added diisopropylethylamine (2.7 g, 2.08 mmol, 2.5 eq.) and DMAP (203 mg, 1.67 mmol, 0.2 eq.). After stirring for 5 min at ambient temperature, EDCI (2.4 g, 12.5 mmol, 1.5 eq.) was added and the reaction mixture was stirred at room temperature overnight, after which TLC showed complete disappearance of the starting alcohol. The reaction mixture was diluted with CH2Cl2(300 mL) and washed with saturated NaHCO3(100 mL), water (100 mL), and brine (100 mL). The combined organic layers were dried over Na2SO4, and the solvent was removed in vacuo. Evaporation of the solvent gave the crude product, which was purified by column chromatography (silica gel, 0-1% ethyl acetate (EA) in hexanes) to give Compound A (2.0 g, 57%) as a colorless oil.
[0563] Preparation of compound B
[0564]
[0565] A mixture of cyclohexanone (2.0 g, 20.0 mmol, 1.0 eq.), titanium(IV) isopropoxide (7.4 g, 26 mmol, 1.3 eq.) and 2-aminoethanol (3.66 g, 60.0 mmol, 3.0 eq.) in methanol (10.0 mL) was stirred at room temperature under argon for 5 hours. Then sodium borohydride (760.0 mg, 20.0 mmol, 1.0 eq.) was added at 0 °C and the resulting mixture was stirred for another 2 hours. Then the reaction was quenched by the addition of water (10.0 mL). Stirring was continued at room temperature for 20 minutes, then the reaction mixture was acidified with hydrochloric acid (1 M, 5 mL) and filtered over a pad of celite, washing with water and EA. The organic layer was separated, dried over Na2S04, evaporated under reduced pressure and purified by flash column chromatography (FCC) (PE / EA = 5 / 1-0 / 1) to give compound B (1.5 g, 52% yield) as a yellow oil.
[0566] Preparation of compound C
[0567]
[0568] To a solution of compound A (446.0 mg, 1.0 mmol, 1.0 eq.) and ethanolamine (180.0 mg, 3.0 mmol, 3.0 eq.) in acetonitrile (ACN, 10.0 mL) was added Cs2C03(97.5 mg, 0.3 mmol, 0.3 eq.), K2C03(414.0 mg, 3.0 mmol, 3.0 eq.) and Nal (14.6 mg, 0.1 mmol, 0.1 eq.) at room temperature. The mixture was stirred at 85 °C for 16 hours. LCMS showed the reaction was complete, the mixture was evaporated under reduced pressure and purified by FCC (DCM / MeOH = 1 / 0-20 / 1) to give compound C (0.35 g, 82% yield) as a yellow oil.
[0569] Preparation of compound D
[0570]
[0571] A mixture of cyclobutanone (8.0 g, 114 mol, 1.0 eq.) and 2-aminoethanol (20.9 g, 342 mol, 3.0 eq.) in methanol (100 mL) was stirred at room temperature under argon for 16 h. Then sodium borohydride (4.3 g, 114 mmol, 1.0 eq.) was added at 0 °C and the resulting mixture was stirred for another 16 h. The reaction mixture was then concentrated under reduced pressure. Water (200 mL) was added and extracted with dichloromethane (DCM). The combined organic layers were dried over Na2S04, evaporated under reduced pressure and purified by column chromatography (silica gel, 2-10% MeOH in DCM) to give compound D (3.9 g, 30% yield) as a light yellow oil.
[0572] Preparation of compound E
[0573]
[0574] Step 1 : Preparation of compound E-1
[0575] To a solution of PMB-NH2 (5.166 g, 37.66 mmol, 4.0 eq.) in EtOH (30 mL) was added 1,2-epoxytetradecane (2.0 g, 9.416 mmol, 1.0 eq.). The reaction mixture was stirred at room temperature for 16 h. LCMS showed the reaction was complete. The mixture was evaporated under reduced pressure and purified by FCC to give compound E-1 (1.42 g, 43.09%) as a white solid. LCMS: Rt: 0.815 min; MS m / z (ESI): 350.3 [M+H] + .
[0576] Step 2: Preparation of compound E-2
[0577] To a solution of compound E-1 (1.42 g, 4.057 mmol, 1.0 eq.) in ACN (25 mL) was added compound A (5.106 mg, 12.17 mmol, 3.0 eq.), K2C03(1.668 g, 12.17 mmol, 3.0 eq.), Cs2C03(397 mg, 1.217 mmol, 0.3 eq.) and NaI (30 mg, 0.2029 mmol, 0.05 eq.). The reaction mixture was stirred at 80 °C for 16 h. LCMS showed the reaction was complete. The solvent was removed and purified by FCC to give compound E-2 (2.5 g, 89.55%) as a colorless oil. LCMS: Rt: 0.241 min; MS m / z (ESI): 688.5 [M+H] + .
[0578] Step 3: Preparation of compound E
[0579] To a solution of compound E-2 (250 mg, 0.3633 mmol) in MeOH (10 mL) was added Pd / C (50 mg). The reaction mixture was stirred at room temperature under H2for 16 h. LCMS showed the reaction was completed. After removal of the solvent, purification by preparative HPLC afforded compound E (105 mg, 50.88% yield) as a colorless oil.
[0580] 1 H NMR (400 MHz, CDC13): 3.97 (d, J = 6 Hz, 2H), 3.58 (s, 1H), 2.73-2.58 (m, 3H), 2.45-2.40 (m, 1H), 2.33-2.29 (m, 2H), 1.66-1.60 (m, 2H), 1.51-1.40 (m, 2H), 1.39-1.34 (m, 4H), 1.26 (s, 46H), 0.90-0.86 (m, 9H). LCMS: Rt: 1.083 min; MS m / z (ESI): 568.5 [M+H] + .
[0581] Preparation of compound F
[0582]
[0583] To a mixture of cyclopropylamine (5.7 g, 100 mmol, 2.5 eq.) in EtOH (50 mL) was added 2-bromoethanol (5 g, 40 mmol, 1 eq.). The reaction mixture was stirred at 50 °C for 16 h. LCMS showed the reaction was completed. Removal of the solvent afforded compound F (6.6 g crude) as a yellow oil.
[0584] Preparation of compound G
[0585]
[0586] Cyclopentanone (16.8 g, 200 mmol, 1 eq.) and 2-aminoethanol (13.4 g, 220 mmol, 1.1 eq.) with 3 drops of acetic acid (AcOH) in MeOH (300 mL) was stirred at room temperature overnight, then to the mixture was added NaBH4(8.4 g, 220 mmol, 1.1 eq.) at 0 °C. The mixture was stirred at room temperature for 2 h. The mixture was quenched with water (100 mL), extracted with EA (3 x 100 mL), dried, and concentrated. Purification by silica gel column chromatography (MeOH:DCM = 0% to 10%) afforded compound G (17.8 g, 49.0% yield) as a yellow oil.
[0587] Preparation of compound H
[0588]
[0589] To a solution of 2-octyldecan-1-ol (1.5 g, 5.545 mmol, 1.0 eq.) in DCM (15 mL) was added 6-bromohexanoic acid (1.3 g, 6.654 mmol, 1.2 eq.), EDCI (1.6 g, 8.318 mmol, 1.5 eq.), DMAP (135 mg, 1.109 mmol, 0.2 eq.) and diisopropylethylamine (DIEA, 1.4 g, 11.09 mmol, 2.0 eq.). The reaction mixture was stirred at 50 °C for 16 h. TLC showed the reaction was complete. The solvent was removed and the crude product was purified by FCC to give compound H (1.2 g, 48.36%) as a yellow oil.
[0590] Preparation of compound K
[0591]
[0592] A mixture of cycloheptanone (15 g, 134 mmol, 1 eq.) and 2-aminoethanol (9 g, 147 mmol, 1.1 eq.) with 3 drops of AcOH in MeOH (250 mL) was stirred at room temperature overnight, then NaBH4(5.6 g, 147 mmol, 1.1 eq.) was added to the mixture at 0 °C. The mixture was stirred at room temperature for 2 h. The mixture was quenched with water (100 mL), extracted with EA (3 x 100 mL), dried and concentrated. Purification by silica gel column chromatography (MeOH:DCM = 0% to 10%) gave compound K (10.3 g, 69.2% yield) as a yellow oil.
[0593] Preparation of compound L
[0594]
[0595] A mixture of cyclooctanone (2.0 g, 15.85 mmol, 1 eq.) and 2-aminoethanol (1.07 g, 17.43 mmol, 1.1 eq.) with 3 drops of AcOH in MeOH (30 mL) was stirred at room temperature overnight, then NaBH4(660 mg, 17.43 mmol, 1.1 eq.) was added to the mixture at 0 °C. The mixture was stirred at room temperature for 2 h. The mixture was quenched with water (100 mL), extracted with EA (3 x 100 mL) and dried. After concentration, the residue was purified by silica gel column chromatography (MeOH:DCM = 0% to 10%) to give compound L (960 mg, 35% yield) as a yellow oil.
[0596] Preparation of SM2:
[0597]
[0598] A mixture of compound 26-1 (250 mg, 0.56 mmol, 1.0 eq.), 2-aminoethanol (243 mg, 1.68 mmol, 3.0 eq.), K2CO3(232 mg, 1.68 mmol, 3.0 eq.), Cs2CO3(7 mg, 0.02 mmol, 0.03 eq.) and sodium iodide (30 mg, 0.2 mmol, 0.3 eq.) in ACN (10 mL) was stirred at 100 °C overnight. The mixture was concentrated and purified by silica gel column chromatography (MeOH:DCM = 0% to 10%) to afford the desired product SM2 (1.78 g, 62.1% yield) as a yellow oil. LCMS: Rt: 1.427 min; MS m / z (ESI): 428.5 [M+H] + .
[0599] Preparation of SM4:
[0600]
[0601] A mixture of compound SM4-1 (2.1 g, 4.5 mmol, 1.0 eq.), 2-aminoethanol (830 mg, 13.6 mmol, 3.0 eq.), K2CO3(1.9 g, 13.6 mmol, 3.0 eq.), Cs2CO3(440 mg, 1.4 mmol, 0.3 eq.), NaI (200 mg, 1.4 mmol, 0.3 eq.) in ACN (15 mL) was stirred at reflux overnight. The mixture was diluted with water, extracted with EA, concentrated and purified by silica gel column chromatography (MeOH:DCM = 0% to 10%) to afford the desired product SM4 (860 mg, 41% yield) as a yellow oil. LCMS: Rt: 1.000 min; MS m / z (ESI): 442.4 [M+H] + .
[0602] Preparation of SM9:
[0603]
[0604] To a solution of compound SM9-1 (1.0 g, 2.166 mmol, 1.0 eq.) in ACN (15 mL) was added compound SM6 (0.4 g, 6.498 mmol, 3.0 eq.), K2CO3 (0.9 g, 6.498 mmol, 3.0 eq.), Cs2CO3 (212 mg, 0.6498 mmol, 0.3 eq.), Nal (32 mg, 0.2166 mmol, 0.1 eq.). The reaction mixture was stirred at 80 °C for 16 hours. LCMS showed the reaction was completed. The solvent was removed, FCC was performed to give compound SM9 (350 mg, 37.87%) as yellow oil.
[0605] Preparation of SM10:
[0606]
[0607] Step 1: Preparation of compound SM10-2
[0608] To a mixture of compound SM10-1 (2.0 g, 6.700 mmol, 1.0 eq.), compound SM8 (0.83 g, 8.040 mmol, 1.2 eq.), DIEA (2.6 g, 20.10 mmol, 3.0 eq.) in DCM (30 mL) was added HATU (3.8 g, 10.50 mmol, 1.5 eq.). The reaction mixture was stirred at room temperature for 1 hour. TLC showed the reaction was completed. The mixture was poured into water and washed with DCM. The organic was separated and dried over Na2SO4. The solvent was removed, FCC was performed to give compound SM10-2 (2.4 g, 93.36%) as colorless oil.
[0609] Step 2: Preparation of compound SM10-3
[0610] To a mixture of compound SM10-2 (2.4 g, 6.255 mmol, 1.0 eq.), DIEA (1.62 g, 12.51 mmol, 2.0 eq.) in DCM (60 mL) was added MsCl (0.86 g, 7.506 mmol, 1.2 eq.) at 0 °C under N2. The reaction mixture was stirred at 0 °C for 1 hour. TLC showed the reaction was completed. The mixture was poured into water and washed with DCM. The organic was separated and dried over Na2SO4. The solvent was removed, FCC was performed to give compound SM10-3 (2.5 g, 86.57%) as yellow oil.
[0611] Step 3: Preparation of compound SM10-4
[0612] To a solution of compound SM10-3 (1.5 g, 3.249 mmol, 1.0 eq.) in ACN (30 mL) was added compound B (0.45 g, 3.899 mmol, 1.2 eq.), K2CO3 (1.35 g, 9.747 mmol, 3.0 eq.), Cs2CO3 (318 mg, 0.9747 mmol, 0.3 eq.), Nal (49 mg, 0.3249 mmol, 0.1 eq.). The reaction mixture was stirred at 80 °C for 16 h. LCMS showed the reaction was completed. The solvent was removed, FCC was performed to give compound SM10-4 (700 mg, 44.81%) as yellow oil. LCMS: Rt: 0.830 min; MS m / z (ESI): 481.4 [M+H] + .
[0613] Step 4: Preparation of compound SM10
[0614] To a solution of compound SM10-4 (300 mg, 0.6240 mmol, 1.0 eq.) in DCM (15 mL) was added SOCl2 (223 mg, 1.872 mmol, 3.0 eq.). The reaction mixture was stirred at 35 °C for 16 h. LCMS showed the reaction was completed. The solvent was removed to give compound SM10 (310 mg, crude) as yellow oil. LCMS: Rt: 0.860 min; MS m / z (ESI): 499.3 [M+H] + .
[0615] Preparation of SM11:
[0616]
[0617] Step 1: Preparation of compound SM11-2
[0618] A mixture of compound SM10-1 (1.5 g, 5.025 mmol, 1.0 eq.), compound SM7 (1.26 g, 7.538 mmol, 1.5 eq.), TsOH (300 mg) in toluene (20 mL) was stirred at reflux for 2 h. TLC showed the reaction was completed. The mixture was evaporated under reduced pressure, FCC was performed to give compound SM11-2 (1.4 g, 62.26%) as yellow oil.
[0619] Step 2: Preparation of compound SM11
[0620] To a solution of compound SM11-2 (1.0 g, 2.235 mmol, 1.0 eq.) in ACN (15 mL) was added compound SM6 (0.41 g, 6.704 mmol, 3.0 eq.), K2CO3 (0.93 g, 6.704 mmol, 3.0 eq.), Cs2CO3 (218 mg, 0.6704 mmol, 0.3 eq.), Nal (33 mg, 0.2235 mmol, 0.1 eq.). The reaction mixture was stirred at 80 °C for 16 h. LCMS showed the reaction was completed. The solvent was removed, FCC was performed to give compound SM11 (700 mg, 44.81%) as yellow oil. LCMS: Rt: 0.890 min; MS m / z (ESI): 428.3 [M+H] + .
[0621] Preparation of SM:
[0622]
[0623] Step 1: Preparation of compound SM-2
[0624] To a mixture of NaH (12 g, 227.1 mmol, 2.5 eq.) in DMF (100 mL) was added compound SM-1 (12 g, 90.84 mmol, 1.0 eq.) at 0 °C under N2. The reaction mixture was stirred at 0 °C for 1 h. To which was added C8H 17 Br (44 g, 227.1 mmol, 2.5 eq.) in DMF (100 mL). The reaction mixture was stirred at rt for 16 h. TLC showed the reaction was completed. The mixture was poured into water and washed with EA. The organic was separated and dried over Na2SO4. The solvent was removed, FCC was performed to give compound SM-2 (17.8 g, 54.96%) as colorless oil. 1 HNMR (400 MHz, CCl3D): 3.71 (s, 6H), 1.88-1.84 (m, 4H), 1.59 (s, 1H), 1.25 (s, 19H), 1.14-1.10 (m, 4H), 0.89-0.86 (m, 6H).
[0625] Step 2: Preparation of compound SM-3
[0626] To a solution of SM-2 (17.8 g, 49.93 mmol, 1.0 eq.) in DMF (260 mL) was added LiCl (21.17 g, 499.3 mmol, 10.0 eq.). The reaction mixture was stirred at 120 °C for 12 h. TLC showed the reaction was complete. The mixture was poured into water and washed with EA. The organics were separated and dried over Na2S04. The solvent was removed, FCC was performed to give compound SM-3 (10 g, 67.10%) as colorless oil. 1 HNMR (400 MHz, CCI3D): 0.89-0.86 (m, 6H), 1.25 (s, 22H), 1.45-1.40 (m, 2H), 1.59 (s, 4H), 2.36-2.30 (m, 1H), 3.67 (s, 3H).
[0627] Step 3: Preparation of compound SM
[0628] To a solution of compound SM-3 (10 g, 33.50 mmol, 1.0 eq.) in THF (100 mL) was added slowly LiAlH4(2.546 g, 67.00 mmol, 2.0 eq.) at 0 °C. The reaction mixture was stirred at reflux for 1 h. TLC showed the reaction was complete. After cooling to 0 °C, the mixture was quenched by successive addition of water (3.4 mL), 15% aqueous NaOH solution (3.4 mL) and water (10 mL). The resulting mixture was diluted with EA and the precipitate was removed by filtration. The filtrate was evaporated under reduced pressure, FCC was performed to give compound SM (8.5 g, 93.80%) as yellow oil. 1 HNMR (400 MHz, CCI3D): 0.90-0.86 (m, 6H), 1.27 (s, 27H), 1.43 (s, 3H), 3.54 (d, J = 5.2 Hz, 2H).
[0629] Preparation of SM15:
[0630]
[0631] To a solution of compound 26-1 (400 mg, 0.89 mmol, 1.0 eq.) in ACN (30 mL) was added compound SM15-1 (140 mg, 1.79 mmol, 2.0 eq.), K2CO3(370 mg, 2.68 mmol, 3.0 eq.), Cs2CO3(90 mg, 0.27 mmol, 0.3 eq.) and Nal (40 mg, 0.27 mmol, 0.3 eq.). The reaction mixture was stirred at 80 °C for 10 h. LCMS showed the reaction was completed. The solvent was removed, FCC was performed to give compound SM15 (120 mg, 30%). LCMS: Rt: 0.900 min; MS m / z (ESI): 442.3 [M+H] + .
[0632] Preparation of SM16:
[0633]
[0634] To a solution of compound 71-7 (420 mg, 0.88 mmol, 1.0 eq.) and compound SM6 (108 mg, 1.76 mmol, 2.0 eq.) in ACN (20 mL) was added K2CO3(365 mg, 2.64 mmol, 3.0 eq.), Cs2CO3(85 mg, 0.26 mmol, 0.3 eq.) and Nal (39 mg, 0.26 mmol, 0.3 eq.). The mixture was stirred at 80 °C for 16 h. LCMS showed the reaction was completed. The reaction mixture was concentrated and purified by silica gel column chromatography (DCM / MeOH = 10 / 1) to give compound SM16 (146 mg, 37% yield) as yellow oil. LCMS: Rt: 0.810 min; MS m / z (ESI): 444.3 [M+H] + .
[0635] Preparation of SM18:
[0636]
[0637] A mixture of compound SM18-1 (2.0 g, 4.48 mmol, 1.0 eq.), tert-butyl (2- aminoethyl)carbamate (1.0 g, 6.72 mmol, 1.5 eq.), K2CO3 (1.8 g, 13.4 mmol, 3.0 eq.), Cs2CO3 (440 mg, 1.34 mmol, 0.3 eq.), Nal (200 mg, 1.34 mmol, 0.3 eq.) in ACN (20 mL) was stirred at 90 °C overnight. LCMS showed the target product. The mixture was concentrated and the residue was purified by column chromatography to give the product SM18 (860 mg, 36.5% yield) as a white solid. LCMS: Rt: 0.870 min; MS m / z (ESI): 526.5 [M+H] + .
[0638] Preparation of SM20:
[0639]
[0640] Step 1: Preparation of compound SM20-1
[0641] To a solution of compound 26-1 (1.0 g, 2.24 mmol, 1.0 eq.) and compound B (511.0 mg, 4.48 mmol, 2.0 eq.) in ACN (20.0 mL) was added Cs2CO3 (218.0 mg, 0.67 mmol, 0.3 eq.), K2CO3 (927.0 mg, 6.72 mmol, 3.0 eq.) and Nal (33.0 mg, 0.22 mmol, 0.1 eq.) at room temperature. The mixture was stirred at 85 °C for 16 hours. LCMS showed the reaction was completed, the mixture was evaporated under reduced pressure and purified by FCC (DCM / MeOH = 1 / 0-20 / 1) to give compound SM20-1 (0.6 g, 56% yield) as a brown oil. LCMS: Rt: 0.950 min; MS m / z (ESI): 482.4 [M+H] + .
[0642] Step 2: Preparation of compound SM20
[0643] To a solution of compound SM20-1 (0.2 g, 0.41 mmol, 1.0 eq.) in DCM (5.0 mL) was added SOCl2 (144.0 mg, 1.23 mmol, 3.0 eq.) at room temperature. The mixture was stirred for 16 hours. LCMS showed the reaction was completed, the mixture was evaporated under reduced pressure to give compound SM20 (0.23 g, crude) as a brown oil. LCMS: Rt: 1.330 min; MS m / z (ESI): 500.3 [M+H]+ .
[0644] Preparation of SM22:
[0645]
[0646] Step 1: Preparation of compound SM22-2
[0647] To a solution of compound SM22-1 (30.0 g, 98.25 mmol, 1.0 eq.) in DMF (800 mL) was added NaCN (9.63 g, 196.5 mmol, 2.0 eq.). The reaction was stirred at 60 °C for 10 h. The reaction mixture was poured into water (500 mL) and extracted with EtOAc (3 x 500 mL). The combined organic layers were washed with brine, dried over anhydrous Na2SO4 and concentrated in vacuo. The crude product was purified by flash column chromatography (EtOAc: PE = 1:20) to give the target product as a yellow oil (18.3 g, 74% yield).
[0648] Step 2: Preparation of compound SM22-3
[0649] To a solution of compound SM22-2 (17.0 g, 67.61 mmol, 1.0 eq.) in EtOH (200 mL) was added H2SO4 (40 mL). The reaction was stirred at 90 °C for 48 h. The reaction mixture was poured into water (500 mL) and extracted with EtOAc (3 x 500 mL). The combined organic layers were washed with brine, dried over anhydrous Na2SO4 and concentrated in vacuo to give the target product as a yellow oil (15 g, 75% yield).
[0650] Step 3: Preparation of compound SM22
[0651] To a solution of compound SM22-3 (14 g, 46.90 mmol, 1.0 eq.) in MeOH (240 mL) and H2O (60 mL) was added LiOH H2O (9.84 g, 234.5 mmol, 5.0 eq.). The reaction was stirred at 50 °C for 10 h. The reaction mixture was concentrated in vacuo to give the crude target product. The crude product was dissolved in water. The residue was adjusted to pH = 2 with 6 M HC1 and extracted with EtOAc (3 x 500 mL). The combined organic layers were washed with brine, dried over anhydrous Na2SO4 and concentrated in vacuo to give compound SM22 as a yellow oil (15 g, 75% yield). 1HNMR (400 MHz, CCI3D): 0.87 (t, J = 8 Hz, 6H), 1.22-1.46 (m, 24H), 1.85-1.95 (m, 2H), 2.22-2.34 (m, 1H).
[0652] Preparation of SM23:
[0653]
[0654] Step 1: Preparation of compound SM23-1
[0655] To a solution of compound SM22 (4 g, 14.79 mmol, 1.0 eq.) in CH2Cl2(100 mL) was added DIEA (5.73 g, 44.37 mmol, 3.0 eq.), compound SM7 (2.96 g, 17.75 mmol, 1.2 eq.), EDCI (4.25 g, 22.18 mmol, 1.5 eq.) and DMAP (550 mg, 4.44 mmol, 0.3 eq.). The reaction was stirred at 50 °C for 10 h. The reaction mixture was concentrated in vacuo and purified by flash column chromatography (EtOAc: PE = 20: 1) to give the target product as yellow oil (4 g, 64% yield).
[0656] Step 2: Preparation of compound SM23
[0657] To a solution of compound SM23-1 (1.5 g, 3.58 mmol, 1.0 eq.) in CH3CN (50 mL) was added K2CO3(1.48 g, 10.73 mmol, 3.0 eq.), Cs2CO3(0.4 g, 1.07 mmol, 0.3 eq.), Nal (0.16 g, 1.07 mmol, 0.3 eq.) and compound SM6 (0.45 g, 7.15 mmol, 2.0 eq.). The reaction was stirred at 80 °C for 10 h. The reaction mixture was concentrated in vacuo. The crude product was purified by flash column chromatography (CH2Cl2: MeOH = 10: 1) to give the target product as yellow oil (800 mg, 56% yield). LCMS: Rt: 0.898 min; MS m / z (ESI): 400.3 [M+H] + .
[0658] Preparation of SM24:
[0659]
[0660] To a solution of compound SM24-1 (20.2 g, 83.3 mmol, 1.0 eq.) and compound W (19.5 g, 100 mol, 1.2 eq.) in DCM (300 mL) was added EDCI (24.0 g, 125 mmol, 1.5 eq.), DMAP (2.0 g, 16.7 mmol, 0.2 eq.) and DIEA (27.0 g, 208 mmol, 2.5 eq.). The reaction mixture was stirred at room temperature for 16 hours. TLC showed the reaction was completed. The reaction mixture was concentrated and purified by column chromatography (silica gel, 0-1% EA in PE) to give compound SM24 (17 g, 49%) as colorless oil.
[0661] Preparation of SM26:
[0662]
[0663] Step 1: Preparation of compound SM26-2
[0664] To a mixture of compound SM26-1 (2 g, 7.080 mmol, 1.0 eq.) and compound SM7 (1.42 g, 8.496 mmol, 1.2 eq.) was added DIEA (1.8 g, 14.16 mmol, 2.0 eq.), EDCI (2 g, 10.62 mmol, 1.5 eq.), DMAP (0.17 g, 1.416 mmol, 0.2 eq.) in DCM (30 mL). The reaction mixture was stirred at 50 °C for 16 hours. TLC showed the reaction was completed. The mixture was poured into water and washed with DCM. The organic was separated and dried over Na2S04. The solvent was removed, FCC was performed to give compound SM26-2 (1.5 g, 49.10%) as yellow oil.
[0665] Step 2: Preparation of compound SM26
[0666] To a solution of compound SM26-2 (1.5 g, 3.476 mmol, 1.0 eq.) in ACN (30 mL) was added compound SM6 (0.64 g, 10.43 mmol, 3.0 eq.), K2C03(1.4 g, 10.43 mmol, 3.0 eq.), Cs2C03(0.34 g, 1.043 mmol, 0.3 eq.), Nal (0.16 g, 1.043 mmol, 0.3 eq.). The reaction mixture was stirred at 80 °C for 16 hours. LCMS showed the reaction was completed. The solvent was removed, FCC was performed to give compound SM26 (800 mg, 55.90%) as yellow oil.
[0667] Preparation of SM30:
[0668]
[0669] Step 1: Preparation of compound SM30-2
[0670] To a solution of compound SM30-1 (6.3 g, 35.2 mmol, 1.0 eq.) in DCM (150 mL) was added TsOH.H2O (1.3 g, 7.0 mmol, 0.2 eq.) and Na2SO4(15.0 g, 105.6 mmol, 3.0 eq.). The mixture was stirred at room temperature overnight. The mixture was filtered and concentrated. The residue was purified by silica gel column chromatography (PE / EA = 100 / 1) to give compound SM30-2 (9.7 g, 66% yield) as colorless oil.
[0671] Step 2: Preparation of compound SM30
[0672] To a solution of compound SM30-2 (4.2 g, 10.0 mmol, 1.0 eq.) and ethanolamine (1.8 g, 30.0 mmol, 3.0 eq.) in ACN (50 mL) was added K2CO3(4.1 g, 30.0 mmol, 3.0 eq.), Cs2CO3(977 mg, 3.0 mmol, 0.3 eq.) and NaI (450 mg, 3.0 mmol, 0.3 eq.). The mixture was stirred at 80 °C for 16 hours. LCMS showed the reaction was completed. The mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na2SO4and concentrated. The residue was concentrated and purified by silica gel column chromatography (PE / EA = 10 / 1-3 / 1-1 / 1-0 / 1) to give compound SM30 (2.3 g, 58% yield) as colorless oil. LCMS: Rt: 1.010 min; MS m / z (ESI): 402.4 [M+H] + .
[0673] Preparation of SM34:
[0674]
[0675] Step 1: Preparation of compound SM34-2
[0676] To a solution of compound SM22-1 (30 g, 98.2 mmol, 1.0 eq.) in DMF (400 mL) was added compound SM34-1 (36.4 g, 196.4 mmol, 2.0 eq.). The mixture was stirred at 90 °C for 16 h. The reaction mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na2SO4 and concentrated. The residue was purified by silica gel column chromatography (PE / EA = 100 / 1) to give compound SM34-2 (31.6 g, 86% yield) as yellow oil.
[0677] Step 2: Preparation of compound SM34-3
[0678] To a solution of compound SM34-2 (15.8 g, 42.5 mmol, 1.0 eq.) in EtOH (500 mL) was added hydrazine monohydrate (5.0 g, 85.0 mmol, 2.0 eq.). The mixture was stirred at reflux for 16 h. LCMS showed the reaction was complete. The mixture was filtered and washed with EtOH. The filtrate was concentrated and purified by silica gel column chromatography (DCM / MeOH = 20 / 1) to give compound SM34-3 (9.1 g, 88% yield) as yellow oil.
[0679] Step 3: Preparation of compound SM34-4
[0680] To a solution of compound SM34-3 (6.5 g, 26.9 mol, 1.2 eq.) in DCM (100 mL) was added compound W (4.4 g, 22.4 mmol, 1.0 eq.), HATU (12.8 g, 33.6 mmol, 1.5 eq.) and DIPEA (8.7 g, 67.2 mmol, 3.0 eq.). The mixture was stirred at room temperature for 16 h. The reaction mixture was poured into water and extracted with DCM. The combined organic layers were washed with brine, dried over Na2SO4 and concentrated. The residue was purified by silica gel column chromatography to give compound SM34-4 (7.4 g, 65.6% yield) as yellow oil.
[0681] Step 4: Preparation of compound SM34
[0682] To a solution of compound SM34-4 (7.4 g, 18.0 mmol, 1.0 eq.) and compound SM6 (3.3 g, 54.0 mmol, 3.0 eq.) in THF (50 mL) was added DIPEA (6.9 g, 54.0 mmol, 3.0 eq.) and Nal (800 mg, 5.4 mmol, 0.3 eq.). The mixture was stirred at 70 °C for 10 h. LCMS showed the reaction was completed. The reaction mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na2SO4 and concentrated. The residue was purified by silica gel column chromatography to give compound SM34 (6.3 g, 88% yield) as colorless oil. LCMS: Rt: 1.620 min; MS m / z (ESI): 399.5 [M+H] + .
[0683] Preparation of SM38:
[0684]
[0685] A mixture of compound 71-7 (600 mg, 1.25 mmol, 1.0 eq.), isopropylamine (739 mg, 12.5 mmol, 10.0 eq.), K2CO3 (519 mg, 3.76 mmol, 3.0 eq.), Cs2CO3 (124 mg, 0.38 mmol, 0.3 eq.), Nal (51 mg, 0.38 mmol, 0.3 eq.) in ACN (10 mL) was stirred at reflux overnight. LCMS showed the product. The mixture was diluted with EA and washed with water and brine, dried and concentrated. The residue was purified by FCC to give compound SM38 (320 mg, 58.0% yield) as colorless oil.
[0686] Preparation of SM39:
[0687]
[0688] To a solution of compound SM24 (10 g, 23.9 mmol, 1.0 eq.) in CH3CN (150 mL) was added K2CO3 (9.9 g, 71.7 mmol, 3.0 eq.), Cs2CO3 (2.3 g, 7.17 mmol, 0.3 eq.), Nal (1.1 g, 7.17 mmol, 0.3 eq.) and compound SM6 (2.9 g, 47.8 mmol, 2.0 eq.). The reaction mixture was stirred at 80 °C for 16 h. The reaction mixture was concentrated in vacuum. The crude product was purified by flash column chromatography (CH2Cl2:MeOH = 20:1-10:1) to give compound SM39 (5.1 g, yield: 53%) as yellow oil. LCMS: Rt: 0.880 min; MS m / z (ESI): 400.3 [M+H].
[0689] 6.2 Example 2: Preparation of compound 1.
[0690]
[0691] Step 1: Preparation of compound 1-1
[0692] A mixture of compound A (1.26 g, 3 mmol, 1.5 eq.), compound B (280 mg, 2 mmol, 1 eq.), DIEA (774 mg, 6 mmol, 3 eq.) and Nal (0.1 eq.) in tetrahydrofuran (THF, 6 mL) was stirred at 70 °C overnight. The mixture was concentrated under vacuum and purified by silica gel column chromatography (MeOH:DCM = 0:1 to 1:80) to give the desired product compound 1-1 (269 mg, 28.5% yield) as yellow oil. LCMS: Rt: 1.000 min; MS m / z (ESI): 482.5 [M+H] + .
[0693] Step 2: Preparation of compound 1-2
[0694] A mixture of compound 1-1 (269 mg, 0.56 mmol, 1 eq.) and SOCl2 (200 mg, 1.68 mmol, 3 eq.) in DCM (6 mL) was stirred at 35 °C overnight. The mixture was concentrated under vacuum to give the desired product compound 1-2 (313 mg, crude) as yellow oil. LCMS: Rt: 0.970 min; MS m / z (ESI): 500.4 [M+H] + .
[0695] Step 3: Preparation of compound 1
[0696] A mixture of compound 1-2 (313 mg, 0.63 mmol, 1.2 eq.), compound C (211 mg, 0.53 mmol, 1 eq.), DIEA (205 mg, 1.59 mmol, 3 eq.) and NaI catalyst in THF (4 mL) was stirred at 70 °C overnight. The mixture was concentrated under vacuum, purified by preparative HPLC to give compound 1 (79 mg, 14.6% yield) as light brown oil.
[0697] 1 H NMR (400 MHz, CDC13) δ: 0.83-0.93 (m, 12H), 1.04-1.16 (m, 2H), 1.18-1.39 (m, 60H), 1.40-1.55 (m, 3H), 1.56-1.74 (m, 9H), 1.86 (s, 2H), 2.25-2.39 (m, 5H), 2.56 (s, 3H), 2.70 (s, 3H), 3.62 (s, 2H), 3.89-4.04 (m, 4H). LCMS: Rt: 2.000 min; MS m / z (ESI): 863.7 [M+H] + .
[0698] The following compounds were prepared in a similar manner to compound 1 using the corresponding starting materials.
[0699]
[0700] 6.3 Example 3: Preparation of compound 2.
[0701]
[0702] Step 1: Preparation of compound 2-1
[0703] To a solution of 1-undecanol (10 g, 58.03 mmol, 1.0 eq.) in DCM (120 mL) was added 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDCI, 16.69 g, 87.05 mmol, 1.5 eq.), 4-dimethylaminopyridine (DMAP, 1.42 g, 11.61 mmol, 0.2 eq.), DIEA (15 g, 116.06 mmol, 2.0 eq.) and 6-bromohexanoic acid (12.45 g, 63.84 mmol, 1.1 eq.). The reaction mixture was stirred at 55 °C for 16 hours. TLC showed the reaction was complete. The solvent was removed and the crude product was purified by FCC to give compound 2-1 (8.6 g, 42.43%) as colorless oil.
[0704] 1H NMR (400 MHz, CDC13) δ: 4.08-4.05 (m, 2H), 3.55-3.52 (m, 2H), 2.34-2.30 (m, 2H), 1.83-1.76 (m, 2H), 1.69-1.60 (m, 4H), 1.51-1.43 (m, 2H), 1.23 (s, 16H), 0.89-0.86 (m, 3H).
[0705] Step 2: Preparation of compound 2-2
[0706] To a solution of compound 2-1 (1 g, 2.863 mmol, 1.2 eq.) in ACN (20 mL) was added compound D (275 mg, 2.386 mmol, 1.0 eq.), K2CO3 (989 mg, 7.158 mmol, 3.0 eq.), Cs2CO3 (233 mg, 0.7158 mmol, 0.3 eq.) and Nal (18 mg, 0.1193 mmol, 0.05 eq.). The reaction mixture was stirred at 85 °C for 16 h. LCMS showed the reaction was completed. The solvent was removed and the crude product was purified by FCC to afford compound 2-2 (170 mg, 18.57%) as yellow oil. LCMS: Rt: 0.811 min; MS m / z (ESI): 384.3 [M+H] + .
[0707] Step 3: Preparation of compound 2-3
[0708] To a solution of compound 2-2 (170 mg, 0.4432 mmol, 1.0 eq.) in DCM (10 mL) was added SOCl2 (158 mg, 1.330 mmol, 3.0 eq.). The reaction mixture was stirred at 35 °C for 16 h. LCMS showed the reaction was completed. The solvent was removed to afford compound 2-3 (180 mg, crude) as yellow oil. LCMS: Rt: 0.860 min; MS m / z (ESI): 402.3 [M+H] + .
[0709] Step 4: Preparation of compound 2
[0710] To a mixture of compound 2-3 (170 mg, 0.4476 mmol, 1.0 eq.) and DIEA (289 mg, 2.238 mmol, 5.0 eq.) in THF (10 mL) was added compound E (381 mg, 0.6715 mmol, 1.5 eq.) and Nal (20 mg). The reaction mixture was stirred at 70 °C for 16 hours. LCMS showed the reaction was completed. After removal of the solvent, purification by preparative HPLC afforded compound 2 (35 mg, 8.37% yield) as colorless oil.
[0711] 1 H NMR (400 MHz, CDC13) δ: 4.07-4.04 (m, 2H), 3.9 (d, J = 5.6 Hz, 2H), 3.53 (m, 1H), 3.08-3.04 (m, 1H), 2.49-2.37 (m, 9H), 2.32-2.25 (m, 5H), 1.98-1.88 (m, 4H), 1.66-1.58 (m, 9H), 1.49-1.38 (m, 7H), 1.26 (s, 63H), 0.90-0.86 (m, 12H). LCMS: Rt: 0.994 min; MS m / z (ESI): 933.8 [M+H] + .
[0712] 6.4 Example 4: Preparation of compound 3.
[0713]
[0714] Step 1: Preparation of compound 3-1
[0715] To a solution of compound 2-1 (1.0 g, 2.86 mmol, 2.0 eq.) and compound F (145 mg, 1.43 mmol, 1.0 eq.) in ACN (30 mL) was added K2CO3 (593 mg, 4.29 mmol, 3.0 eq.), Cs2CO3 (140 mg, 0.429 mmol, 0.3 eq.) and Nal (64 mg, 0.429 mmol, 0.3 eq.). The mixture was stirred at 80 °C for 48 hours. LCMS showed the reaction was completed. The reaction mixture was concentrated and purified by silica gel column chromatography (DCM / MeOH = 50 / 1-25 / 1) to afford compound 3-1 (350 mg, 66% yield) as yellow oil. LCMS: Rt: 0.800 min; MS m / z (ESI): 370.3 [M+H] + .
[0716] Step 2: Preparation of compound 3-2
[0717] To a solution of compound 3-1 (200 mg, 0.54 mmol, 1.0 eq.) in DCM (10 mL) was added SOCl2(193 mg, 1.62 mmol, 3.0 eq.). The mixture was stirred at 30 °C for 16 h. LCMS showed the reaction was completed. The mixture was concentrated under reduced pressure to give compound 3-2 (200 mg, 95%) as yellow oil.
[0718] Step 3: Preparation of compound 3
[0719] To a solution of compound 3-2 (200 mg, 0.52 mmol, 1.0 eq.) and compound C (416 mg, 1.04 mmol, 2.0 eq.) in THF (10 mL) was added N,N-diisopropylethylamine (DIPEA, 202 mg, 1.56 mmol, 3.0 eq.) and NaI (24 mg, 0.16 mmol, 0.3 eq.). The mixture was stirred at 70 °C for 16 h. LCMS showed the reaction was completed. The mixture was concentrated and purified by prep-HPLC to give compound 3 (80 mg, 8% yield) as yellow oil.
[0720] 1 H NMR (400 MHz, CDCl3) d: 0.48-0.50 (m, 4H), 0.86-0.90 (m, 9H), 1.26-1.30 (m, 45H), 1.49-1.66 (m, 11H), 1.72-1.77 (m, 1H), 2.28-2.32 (m, 4H), 2.52-2.76 (m, 10H), 3.52-3.58 (m, 2H), 3.96-3.98 (m, 2H), 4.04-4.07 (m, 2H). LCMS: Rt: 1.250 min; MS m / z (ESI): 751.6 [M+H] + .
[0721] The following compounds were prepared in a similar manner to compound 3 using the corresponding starting materials.
[0722]
[0723]
[0724]
[0725]
[0726] 6.5 Example 5: Preparation of compound 6.
[0727]
[0728] Step 1: Preparation of compound 6-1
[0729] A mixture of compound 2-1 (786 mg, 2.24 mmol, 1.2 eq.), compound B (268 mg, 1.87 mol, 1 eq.), DIEA (724 mg, 5.61 mmol, 3 eq.) and Nal (0.1 eq.) in THF (10 mL) was stirred at 70 °C overnight. The mixture was concentrated under vacuum and purified by silica gel column chromatography (MeOH:DCM = 0:1 to 1:20) to give compound 6-1 (1.18 g, crude) as a light brown oil. LCMS: Rt: 0.910 min; MS m / z (ESI): 412.3 [M+H] + .
[0730] Step 2: Preparation of compound 6-2
[0731] A mixture of compound 6-1 (412 mg, 1 mmol, 1 eq.) and SOCl2 (357 mg, 3 mmol, 3 eq.) in DCM (6 mL) was stirred at 35 °C overnight. The mixture was concentrated under vacuum to give compound 6-2 (430 mg, crude) as a yellow oil. LCMS: Rt: 0.930 min; MS m / z (ESI): 430.3 [M+H] + .
[0732] Step 3: Preparation of compound 6
[0733] A mixture of compound 6-2 (215 mg, 0.5 mmol, 1 eq.), compound C (150 mg, 0.4 mmol, 0.75 eq.), DIEA (195 mg, 1.5 mmol, 3 eq.) and catalytic amount of Nal in THF (3 mL) was stirred at 70 °C overnight. The mixture was concentrated under vacuum, purified by preparative HPLC to give compound 6 (15 mg, 12.8% yield) as a light brown oil.
[0734] 1H NMR (400 MHz, CDC13) δ: 0.83-0.92 (m, 9H), 1.18-1.36 (m, 40H), 1.38-1.48 (m, 4H), 1.49-1.75 (m, 27H), 1.85-2.15 (m, 5H), 2.16-2.27 (m, 1H), 2.30-2.39 (m, 3H), 3.11-3.25 (m, 2H), 3.35-3.48 (m, 1H), 3.93-3.99 (m, 2H), 4.01-4.11 (m, 2H). LCMS: Rt: 1.720 min; MS m / z (ESI): 793.6 [M+H] + .
[0735] 6.6 Example 6: Preparation of compound 8.
[0736]
[0737] Step 1: Preparation of 8-1
[0738] To a solution of compound A (0.85 g, 1.98 mmol) in CH3CN (50 mL) was added K2CO3 (410 mg, 2.97 mmol), Cs2CO3 (100 mg, 0.29 mmol), Nal (50 mg, 0.29 mmol) and compound G (127 mg, 0.99 mmol). The reaction was stirred at 80 °C for 10 h. The reaction mixture was concentrated in vacuo. The crude product was purified by flash column chromatography (CH2Cl2:MeOH = 10:1) to give compound 8-1 (300 mg, yield: 65%) as yellow oil. LCMS: Rt: 0.88 min; MS m / z (ESI): 468.4 [M+H] + .
[0739] Step 2: Preparation of compound 8-2
[0740] To a solution of compound 8-1 (300 mg, 0.64 mmol) in CH2Cl2 (10 mL) was added SOCl2 (250 mg, 2.05 mmol). The reaction was stirred at 30 °C for 10 h. The reaction mixture was concentrated in vacuo to give compound 8-2 (310 mg, yield: 100%) as yellow oil.
[0741] Step 3: Preparation of compound 8
[0742] To a solution of compound 8-2 (300 mg, 0.62 mmol) in THF (10 mL) was added DIEA (240 mg, 1.85 mmol), Nal (100 mg, 0.65 mmol) and compound C (530 mg, 1.31 mmol). The reaction was stirred at 70 °C for 10 h. The reaction mixture was filtered and concentrated in vacuo. The crude product was purified by preparative HPLC to give compound 8 (45 mg, yield: 8.5%) as yellow oil.
[0743] 1 H NMR (400 MHz, CDC13) δ: 0.87-0.90 (t, J = 6.8 Hz, 12H), 1.26 (m, 50H), 1.40-1.51 (m, 8H), 1.60-1.66 (m, 8H), 1.77-1.73 (m, 3H), 2.31-2.33 (m, 4H), 2.48-2.61 (m, 10H), 3.05-3.09 (m, 1H), 3.48-3.55 (m, 4H), 3.96-3.97 (m, 4H). LCMS: Rt: 1.740 min; MS m / z (ESI): 849.7 [M+H] + .
[0744] The following compounds were prepared in a similar manner as compound 8 using the corresponding starting materials.
[0745]
[0746]
[0747]
[0748] 6.7 Example 7: Preparation of compound 10.
[0749]
[0750] Step 1: Preparation of compound 10-1
[0751] To a solution of compound H (446.0 mg, 1.0 mmol, 1.0 eq.) and ethanolamine (180.0 mg, 3.0 mmol, 3.0 eq.) in ACN (10.0 mL) was added Cs2CO3(97.5 mg, 0.3 mmol, 0.3 eq.), K2CO3(414.0 mg, 3.0 mmol, 3.0 eq.) and NaI (14.6 mg, 0.1 mmol, 0.1 eq.) at room temperature. The mixture was stirred at 85 °C for 16 h. LCMS showed the reaction was completed, the mixture was evaporated under reduced pressure, and purified by FCC (DCM / MeOH = 1 / 0-20 / 1) to give compound 10-1 (0.35 g, 82% yield) as yellow oil. LCMS: Rt: 0.942 min; MS m / z (ESI): 428.3 [M+H] + .
[0752] Step 2: Preparation of compound 10-2
[0753] To a solution of compound H (1.0 g, 2.24 mmol, 1.0 eq.) and compound D (511.0 mg, 4.48 mmol, 2.0 eq.) in ACN (20.0 mL) was added Cs2CO3(218.0 mg, 0.67 mmol, 0.3 eq.), K2CO3(927.0 mg, 6.72 mmol, 3.0 eq.) and NaI (33.0 mg, 0.22 mmol, 0.1 eq.) at room temperature. The mixture was stirred at 85 °C for 16 h. LCMS showed the reaction was completed, the mixture was evaporated under reduced pressure, and purified by FCC (DCM / MeOH = 1 / 0-20 / 1) to give compound 10-2 (0.6 g, 56% yield) as brown oil. LCMS: Rt: 0.950 min; MS m / z (ESI): 482.4 [M+H] + .
[0754] Step 3: Preparation of compound 10-3
[0755] To a solution of compound 10-2 (0.2 g, 0.41 mmol, 1.0 eq.) in DCM (5.0 mL) was added SOCl2(144.0 mg, 1.23 mmol, 3.0 eq.) at room temperature. The mixture was stirred for 16 h. LCMS showed the reaction was completed, the mixture was evaporated under reduced pressure to give compound 10-3 (0.23 g, crude) as brown oil. LCMS: Rt: 1.330 min; MS m / z (ESI): 500.3 [M+H] + .
[0756] Step 4: Preparation of compound 10
[0757] To a solution of compound 10-3 (150.0 mg, 0.3 mmol, 1.0 eq.) and compound 10-1 (192.0 mg, 0.45 mmol, 1.5 eq.) in THF (5.0 mL) was added DIEA (193 mg, 1.5 mmol, 5.0 eq.) at 0 °C. The mixture was stirred at 70 °C for 16 hours. LCMS showed the reaction was completed, the mixture was evaporated under reduced pressure, and purified with prep-HPLC to give compound 10 (80.0 mg, 25% yield) as brown oil.
[0758] 1 H NMR (400 MHz, CDCl3) δ: 0.86-0.89 (m, 12H), 1.26-1.32 (m, 61H), 1.41-1.65 (m, 12H), 1.85-2.02 (m, 4H), 2.28-2.61 (m, 14H), 3.00-3.12 (m, 1H), 3.53-3.55 (m, 2H), 3.97 (d, J = 5.6 Hz, 4H). LCMS: Rt: 2.520 min; MS m / z (ESI): 891.7 [M+H] + .
[0759] 6.8 Example 8: Preparation of compound 11.
[0760]
[0761] Step 1: Preparation of compound 11-A
[0762] To a solution of 2-octyl-1-decanol (2.7 g, 10.0 mmol, 1.0 eq.) and DIPEA (2.6 g, 20.0 mmol, 2.0 eq.) in DCM (50 mL) was added dropwise MsCl (1.4 g, 12.0 mmol, 1.2 eq.) at 0 °C. The mixture was stirred at room temperature for 2 hours. The reaction mixture was washed with water, brine, dried over Na2SO4and concentrated to give compound 11-A (3.1 g, 91% yield) as yellow oil. 1 H NMR (400 MHz, CDCl3) δ: 0.86-0.90 (m, 6H), 1.26-1.32 (m, 29H), 3.00 (s, 3H), 4.11-4.13 (m, 2H).
[0763] Step 2: Preparation of compound 11-1
[0764] To a solution of 11-A (18.0 g, 51.6 mmol, 1.0 eq.) in DMF (300 mL) was added potassium phthalimide (19.1 g, 103.2 mmol, 2.0 eq.). The mixture was stirred at 90 °C for 16 h. The reaction mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na2SO4and concentrated. Purification by silica gel column chromatography (PE / EA = 100 / 1) afforded compound 11-1 (14.6 g, 71% yield) as colorless oil. 1 H NMR (400 MHz, CDC13) δ: 0.85-0.88 (m, 6H), 1.24-1.29 (m, 28H), 1.82-1.89 (m, 1H), 3.56-3.58 (m, 2H), 7.72-7.72 (m, 2H), 7.83-7.85 (m, 2H).
[0765] Step 3: Preparation of compound 11-2
[0766] To a solution of compound 11-1 (14.6 g, 36.5 mmol, 1.0 eq.) in EtOH (400 mL) was added hydrazine monohydrate (3.65 g, 73.0 mmol, 2.0 eq.). The mixture was stirred at reflux for 16 h. LCMS showed the reaction was completed. The mixture was filtered and washed with EtOH. The filtrate was concentrated and purified by silica gel column chromatography (DCM / MeOH = 100 / 1-50 / 1) to afford compound 11-2 (6.9 g, 70% yield) as yellow oil. LCMS: Rt: 1.260 min; MS m / z (ESI): 270.3 [M+H] + .
[0767] Step 4: Preparation of compound 11-3
[0768] To a solution of compound 11-2 (6.9 g, 25.6 mmol, 1.0 eq.) in DCM (250 mL) was added 6-bromohexanoic acid (6.0 g, 30.7 mmol, 1.2 eq.), HATU (11.7 g, 30.7 mmol, 1.2 eq.) and DIPEA (9.9 g, 76.8 mmol, 3.0 eq.). The mixture was stirred at room temperature for 16 h. The reaction mixture was poured into water and extracted with DCM. The combined organic layers were washed with brine, dried over Na2SO4and concentrated. Purification by silica gel column chromatography (PE / EA = 10 / 1-8 / 1) afforded compound 11-3 (7.1 g, 62% yield) as yellow oil.
[0769] Step 5: Preparation of compound 11-4
[0770] To a solution of compound 11-3 (800 mg, 1.79 mmol, 1.5 eq.) and compound D (137 mg, 1.19 mmol, 1.0 eq.) in ACN (40 mL) were added K2CO3 (493 mg, 3.57 mmol, 3.0 eq.), Cs2CO3 (116 mg, 0.357 mmol, 0.3 eq.) and NaI (54 mg, 0.357 mmol, 0.3 eq.). The mixture was stirred at 80 °C for 16 h. LCMS showed the reaction was completed. The reaction mixture was concentrated and purified by silica gel column chromatography (DCM / MeOH = 10 / 1) to give compound 11-4 (400 mg, 70% yield) as yellow oil. LCMS: Rt: 0.920 min; MS m / z (ESI): 481.4 [M+H] + .
[0771] Step 6: Preparation of compound 11-5
[0772] To a solution of compound 11-4 (200 mg, 0.42 mmol, 1.0 eq.) in DCM (10 mL) was added SOCl2 (150 mg, 1.26 mmol, 3.0 eq.). The mixture was stirred at 30 °C for 16 h. LCMS showed the reaction was completed. The mixture was concentrated under reduced pressure to give compound 11-5 (200 mg, 95%) as yellow oil. LCMS: Rt: 0.980 min; MS m / z (ESI): 499.3 [M+H] + .
[0773] Step 7: Preparation of compound 11-6
[0774] To a solution of compound 11-3 (610 mg, 1.36 mmol, 1.0 eq.) and ethanolamine (166 mg, 2.72 mmol, 2.0 eq.) in ACN (20 mL) were added K2CO3 (564 mg, 4.08 mmol, 3.0 eq.), Cs2CO3 (134 mg, 0.41 mmol, 0.3 eq.) and NaI (61 mg, 0.41 mmol, 0.3 eq.). The mixture was stirred at 80 °C for 16 h. LCMS showed the reaction was completed. The reaction mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na2SO4 and concentrated. Purification by silica gel column chromatography (DCM / MeOH = 10 / 1) gave compound 11-6 (320 mg, 55% yield) as yellow oil. LCMS: Rt: 0.96 min; MS m / z (ESI): 427.3 [M+H] + .
[0775] Step 8: Preparation of compound 11
[0776] To a solution of compound 11-5 (175 mg, 0.35 mmol, 1.0 eq.) and compound 11-6 (150 mg, 0.35 mmol, 1.0 eq.) in THF (10 mL) was added DIPEA (136 mg, 1.05 mmol, 3.0 eq.) and Nal (10 mg, 0.07 mmol, 0.2 eq.). The mixture was stirred at 70 °C for 16 h. LCMS showed the reaction was completed. The mixture was concentrated and purified by prep-HPLC to give compound 11 (34 mg, 11% yield) as yellow oil.
[0777] 1 H NMR (400 MHz, CDC13) δ: 0.86-0.90 (m, 12H), 1.26-1.34 (m, 64H), 1.41-1.54 (m, 6H), 1.59-1.77 (m, 6H), 1.99-2.07 (m, 2H), 2.17-2.21 (m, 4H), 2.47-2.71 (m, 10H), 3.15-3.18 (m, 4H), 3.55-3.62 (m, 2H), 5.73-5.84 (m, 2H). LCMS: Rt: 1.610 min; MS m / z (ESI): 889.8 [M+H] + .
[0778] The following compounds were prepared in a similar manner to compound 11 using the corresponding starting materials.
[0779]
[0780]
[0781]
[0782]
[0783] 6.9 Example 9: Preparation of compound 15.
[0784]
[0785] To a solution of compound 11-6 (221 mg, 0.52 mmol, 1.0 eq.) and compound 10-3 (259 mg, 0.52 mmol, 1.0 eq.) in THF (10 mL) was added DIPEA (202 mg, 1.56 mmol, 3.0 eq.) and Nal (16 mg, 0.104 mmol, 0.2 eq.). The mixture was stirred at 70 °C for 16 h. LCMS showed the reaction was completed. The mixture was concentrated and purified by prep-HPLC to give compound 15 (121 mg, 26% yield) as yellow oil.
[0786] 1 H NMR (400 MHz, CDC13) δ: 0.86-0.92 (m, 12H), 1.26-1.30 (m, 67H), 1.46-1.72 (m, 12H), 1.98-2.09 (m, 2H), 2.15-2.19 (m, 2H), 2.31-2.71 (m, 8H), 3.16-3.23 (m, 2H), 3.56-3.66 (m, 2H), 3.95-4.03 (m, 2H), 7.30 (s, 1H). LCMS: Rt: 1.68 min; MS m / z (ESI): 890.7 [M+H] + .
[0787] The following compounds were prepared in a similar manner to compound 15 using the corresponding starting materials.
[0788]
[0789]
[0790]
[0791]
[0792] 6.10 Example 10: Preparation of compound 18.
[0793]
[0794] Step 1: Preparation of compound 18-1
[0795] To a stirred solution of dimethyl malonate (5 g, 38 mmol, 1 eq.) in DMF (76 mL) was added sodium hydride (3.8 g, 95 mmol, 2.5 eq.) under argon atmosphere at room temperature. After 0.5 h, (Z)-1-bromodec-4-ene (21 g, 95 mmol, 2.5 eq.) was added to the mixture, which was stirred at room temperature overnight. The mixture was quenched with water (130 mL) and extracted with EA (3 x 65 mL); the combined organic layers were washed with brine (2 x 65 mL), dried over anhydrous sodium sulfate and concentrated in vacuo. Purification by silica gel column chromatography (EA:PE = 0-5%) afforded compound 18-1 (10.5 g, 68.2% yield) as colorless oil.
[0796] Step 2: Preparation of compound 18-2
[0797] A mixture of compound 18-1 (10.5 g, 25.7 mmol, 1 eq.) and LiCl (10.9 g, 257 mmol, 10 eq.) in DMF (180 mL) was stirred at 120 °C for 24 h. The mixture was diluted with water, extracted with EA, washed with brine, dried and concentrated. The residue was purified by silica gel column chromatography (EA:PE = 0-5%) to afford compound 18-2 (7.5 g, 83.2% yield) as colorless oil. 1 H NMR (400 MHz, CDC13) δ: 0.80-0.95 (m, 6H), 1.18-1.37 (m, 16H), 1.40-1.52 (m, 2H), 1.54-1.66 (m, 3H), 1.90-2.08 (m, 7H), 2.24-2.41 (m, 1H), 3.60-3.75 (m, 3H), 5.24-5.49 (m, 4H).
[0798] Step 3: Preparation of compound 18-3
[0799] A mixture of compound 18-2 (7.5 g, 21.5 mmol, 1 eq.), LiAlH4(1.6 g, 43 mmol, 2 eq.) in THF (100 mL) was stirred at 80 °C overnight. The mixture was quenched with water, filtered; the filtrate was concentrated and purified by silica gel column chromatography (EA:PE = 0-5%) to afford compound 18-3 (6.2 g, 89.8% yield) as yellow oil.
[0800] Step 4: Preparation of compound 18-4
[0801] A solution of compound 18-3 (1.8 g, 5.5 mmol, 1 eq.), 6-bromohexanoic acid (1.3 g, 6.6 mmol, 1.2 eq.), DIEA (2.14 g, 16.5 mmol, 3 eq.), DMAP (337 mg, 2.76 mmol, 0.5 eq.) and EDCI (1.27 g, 6.6 mmol, 1.2 mmol) in DCM (20 mL) was stirred at 40 °C overnight. The mixture was concentrated and purified by silica gel column chromatography (EA: PE = 0% - 2%) to give compound 18-4 (2.1 g, 75.2% yield) as colorless oil.
[0802] 1 H NMR (400 MHz, CDC13) d: 0.83-0.93 (m, 6H), 1.23-1.40 (m, 20H), 1.41-1.54 (m, 2H), 1.62-1.72 (m, 3H), 1.83-2.10 (m, 10H), 2.25-2.46 (m, 2H), 3.18-3.52 (m, 2H), 3.87-4.03 (m, 2H), 5.18-5.58 (m, 4H).
[0803] Step 5: Preparation of compound 18-5
[0804] A mixture of compound 18-4 (300 mg, 0.6 mmol, 1 eq.), compound B (133 mg, 0.9 mmol, 1.5 eq.), DIEA (232 mg, 1.8 mmol, 3 eq.) and sodium iodide (30 mg, 0.2 mmol, 0.3 eq.) in THF (6 mL) was stirred at 70 °C overnight. The mixture was concentrated and purified by silica gel column chromatography (MeOH: DCM = 0% to 10%) to give compound 18-5 (147 mg, 43.6% yield) as colorless oil. LCMS: Rt: 0.900 min; MS m / z (ESI): 562.4 [M+H] + .
[0805] Step 6: Preparation of compound 18-6
[0806] A mixture of compound 18-5 (147 mg, 0.26 mmol, 1 eq.) and SOCl2 (93 mg, 0.78 mmol, 3 eq.) in DCM (5 mL) was stirred at 35 °C overnight. The mixture was concentrated to give compound 18-6 (137 mg, 90.2% yield). LCMS: Rt: 1.210 min; MS m / z (ESI): 580.4 [M+H] + .
[0807] Step 7: Preparation of compound 18-7
[0808] A mixture of compound 18-4 (1971 mg, 2 mmol, 1 eq.), 2-aminoethanol (147 mg, 2.4 mmol, 1.2 mmol), K2CO3 (828 mg, 6 mmol, 3 eq.), Cs2CO3 (20 mg, 0.06 mmol, 0.03 eq.) and NaI (15 mg, 0.1 mmol, 0.05 eq.) in ACN (40 mL) was stirred at 80 °C overnight. The mixture was concentrated and purified by silica gel column chromatography (MeOH:DCM = 0% to 10%) to give compound 18-7 (610 mg, 65.4% yield) as brown oil. LCMS: Rt: 0.910 min; MS m / z (ESI): 480.4 [M+H] + .
[0809] Step 8: Preparation of compound 18
[0810] A mixture of compound 18-6 (137 mg, 0.24 mmol, 1 eq.), compound 18-7 (138 mg, 0.29 mmol, 1.2 eq.), sodium iodide (10 mg, 0.07 mmol, 0.3 eq.) and DIEA (93 mg, 0.72 mmol, 3 eq.) in THF (5 mL) was stirred at 70 °C overnight. The mixture was concentrated in vacuum. Purification by preparative HPLC gave compound 18 (21 mg, 8.7% yield) as light brown oil.
[0811] 1 H NMR (400 MHz, CDC13) d: 0.83-0.92 (m, 12H), 1.15-1.23 (m, 3H), 1.24-1.36 (m, 47H), 1.37-1.52 (m, 5H), 1.56-1.69 (m, 12H), 1.71-1.79 (m, 4H), 1.95-2.05 (m, 14H), 2.21-2.33 (m, 4H), 2.42-2.60 (m, 9H), 3.49-3.56 (m, 1H), 3.95-3.99 (m, 3H), 5.30-5.42 (m, 8H). LCMS: Rt: 0.640 min; MS m / z (ESI): 1023.7 [M+H] + .
[0812] 6.11 Example 11: Preparation of compound 19.
[0813]
[0814] Step 1: Preparation of compound 19-1
[0815] To a solution of cis-4-decen-l-ol (1.56 g, 10.0 mmol, 1.0 eq.) and 6-bromohexanoic acid (2.9 g, 15.0 mmol, 1.5 eq.) in 30 mL of dichloromethane was added DIEA (3.87 g, 30.0 mmol, 3.0 eq.) and DMAP (244.0 mg, 2.0 mmol, 0.2 eq.). After stirring for 5 min at ambient temperature, EDCI (2.86 g, 15.0 mmol, 1.5 eq.) was added and the reaction mixture was stirred at room temperature overnight, after which TLC showed complete disappearance of the starting alcohol. The reaction mixture was diluted with dichloromethane (300 mL) and washed with saturated NaHCO3(100 mL), water (100 mL) and brine (100 mL). The combined organic layers were dried over Na2SO4and the solvent was removed in vacuo. Evaporation of the solvent gave the crude product, which was purified by silica gel column chromatography (0-2% EA in PE) to give compound 19-1 (1.3 g, 39%) as a colorless oil.
[0816] Step 2: Preparation of compound 19-2
[0817] To a solution of compound 19-1 (664.0 mg, 2.0 mmol, 1.0 eq.) and compound B (572.0 mg, 4.0 mmol, 2.0 eq.) in ACN (10.0 mL) was added Cs2CO3(195.0 mg, 0.6 mmol, 0.3 eq.), K2CO3(828.0 mg, 6.0 mmol, 3.0 eq.) and NaI (28.0 mg, 0.2 mmol, 0.1 eq.) at room temperature. The mixture was stirred at 85 °C for 16 h. LCMS showed the reaction was complete, the mixture was evaporated under reduced pressure and purified by FCC (DCM / MeOH = 1 / 0-20 / 1) to give compound 19-2 (0.37 g, 47% yield) as a yellow oil. LCMS: Rt: 0.740 min; MS m / z (ESI): 396.3 [M+H] + .
[0818] Step 3: Preparation of compound 19-3
[0819] To a solution of compound 19-2 (170.0 mg, 0.43 mmol, 1.0 eq.) in DCM (5.0 mL) was added SOCl2(152.0 mg, 1.29 mmol, 3.0 eq.) at room temperature. The mixture was stirred for 16 h. LCMS showed the reaction was completed, concentrated under reduced pressure to give compound 19-3 (0.2 g, crude) as brown oil. LCMS: Rt: 0.785 min; MS m / z (ESI): 414.3 [M+H] + .
[0820] Step 4: Preparation of compound 19
[0821] To a solution of compound 19-3 (200.0 mg, 0.48 mmol, 1.0 eq.) and compound 10-1 (247.0 mg, 0.58 mmol, 1.2 eq.) in THF (5.0 mL) was added DIEA (309.0 mg, 2.4 mmol, 5.0 eq.) at 0 °C. The mixture was stirred at 70 °C for 16 h. LCMS showed the reaction was completed, concentrated under reduced pressure and purified by prep-HPLC to give compound 19 (80.0 mg, 21% yield) as yellow oil.
[0822] 1 H NMR (400 MHz, CDC13) δ: 0.86-0.89 (m, 9H), 1.26-1.45 (m, 43H), 1.60-1.80 (m, 17H), 1.98-2.16 (m, 4H), 2.28-2.61 (m, 15H), 3.52-3.54 (m, 2H), 3.96-4.08 (m, 4H), 5.26-5.46 (m, 2H). LCMS: Rt: 1.137 min; MS m / z (ESI): 805.7 [M+H] + .
[0823] 6.12 Example 12: Preparation of compound 20.
[0824]
[0825] Step 1: Preparation of compound 20-1
[0826] To a solution of myristic alcohol (2.1 g, 10.0 mmol, 1.0 eq.) in THF (20.0 mL) was added NaH (0.8 g, 20.0 mmol, 2.0 eq.). The mixture was stirred at room temperature for 2 hours, then 1-bromo-2,3-epoxypropane (2.5 g, 15.0 mmol, 1.5 eq.) was added and stirred at 70 °C for 16 hours. LCMS showed the reaction was completed, added water, extracted with EA, concentrated and purified by FCC (PE / EA = 20 / 1) to give compound 20-1 (2.6 g, 96% yield) as colorless oil. 1 H NMR (400 MHz, CDC13) δ: 0.86-0.89 (m, 3H), 1.21-1.35 (m, 20H), 1.58-1.67 (m, 2H), 2.60-2.78 (m, 1H), 2.79-2.81 (m, 1H), 3.13-3.17 (m, 1H), 3.36-3.50 (m, 3H), 3.51-3.72 (m, 1H).
[0827] Step 2: Preparation of compound 20-2
[0828] To a solution of cyclobutanone (840 mg, 12.0 mmol, 1.2 eq.) in MeOH (10 mL) was added 2-(benzyloxy)ethan-1-amine (1.5 g, 10.0 mmol, 1.0 eq.). The mixture was stirred at 25 °C for 2 hours. Then to the mixture was added NaCNBH3 (1.0 g, 15.0 mmol, 1.5 eq.). The mixture was stirred at 25 °C for 16 hours. LCMS showed the reaction was completed. The mixture was evaporated under reduced pressure and purified by FCC (DCM / MeOH = 20 / 1) to give compound 20-2 (1.0 g, crude) as yellow oil.
[0829] Step 3: Preparation of compound 20-3
[0830] A solution of compound 20-1 (0.8 g, 2.96 mmol, 1.0 eq.) and compound 20-2 (1.0 g, 3.84 mmol, 1.3 eq.) in EtOH (10.0 mL) was stirred at 70 °C for 16 hours. LCMS showed the reaction was completed. The reaction mixture was concentrated and purified by FCC (DCM / MeOH = 30 / 1) to give compound 20-3 (0.5 g, 35% yield) as yellow oil. LCMS: Rt: 0.840 min; MS m / z (ESI): 476.3 [M+H] + .
[0831] Step 4: Preparation of compound 20-4
[0832] To a solution of compound 20-3 (475 mg, 1.0 mmol, 1.0 eq.) in THF (10.0 mL) was added NaH (160 mg, 4.0 mmol, 4.0 eq.). The mixture was stirred at room temperature for 2 hours, then C8H 17 Br (576 mg, 3.0 mmol, 3.0 eq.) and stirred at 70 °C for 16 hours. LCMS showed the reaction was completed, added water, extracted with EA, concentrated and purified by FCC (PE / EA = 20 / 1) to give compound 20-4 (300 mg, 51% yield) as colorless oil. LCMS: Rt: 1.280 min; MS m / z (ESI): 588.4 [M+H] + .
[0833] Step 5: Preparation of compound 20-5
[0834] To a solution of compound 20-4 (250 mg, 0.43 mmol, 1.0 eq.) in EA (10 mL) was added Pd / C (25.0 mg) and HCl (5 drops). The mixture was stirred at room temperature under H2for 16 hours. LCMS showed the reaction was completed, filtered and concentrated to give compound 20-5 (250 mg, crude) as yellow oil. LCMS: Rt: 1.023 min; MS m / z (ESI): 498.4 [M+H] + .
[0835] Step 6: Preparation of compound 20-6
[0836] To a solution of compound 20-5 (240 mg, 0.5 mmol, 1.0 eq.) in DCM (5.0 mL) was added SOCl2(177.0 mg, 1.5 mmol, 3.0 eq.) at room temperature. The mixture was stirred for 16 hours. LCMS showed the reaction was completed, the mixture was concentrated under reduced pressure to give compound 20-6 (0.27 g, crude) as brown oil.
[0837] Step 7: Preparation of compound 20
[0838] To a solution of compound 20-6 (120.0 mg, 0.23 mmol, 1.0 eq.) and compound 10-1 (120.0 mg, 0.28 mmol, 1.2 eq.) in THF (5.0 mL) was added DIEA (148.0 mg, 1.1 mmol, 5.0 eq.) at 0 °C. The mixture was stirred at 70 °C for 16 hours. LCMS showed the reaction was completed, the mixture was evaporated under reduced pressure and purified by preparative HPLC to give compound 20 (30.0 mg, 14% yield) as yellow oil.
[0839] 1 H NMR (400 MHz, CDC13) δ: 0.86-0.89 (m, 12H), 1.21-1.35 (m, 65H), 1.50-1.65 (m, 11H), 1.98-2.00 (m, 3H), 2.28-2.32 (m, 2H), 2.53-2.62 (m, 9H), 3.40-3.59 (m, 10H), 3.96 (d, J = 5.6 Hz, 2H). LCMS: Rt: 4.600 min; MS m / z (ESI): 907.8 [M+H] + .
[0840] 6.13 Example 13: Preparation of compound 22.
[0841]
[0842] Step 1: Preparation of compound 22-1
[0843] To a mixture of NaH (3 g, 74.07 mmol, 2.5 eq.) in DMF (30 mL) was added dimethyl malonate (4 g, 30 mmol, 1.0 eq.) at 0 °C under N2. The reaction mixture was stirred at 0 °C for 0.5 h. 1-bromoheptane (13.4 g, 75 mmol, 2.5 eq.) in DMF (30 mL) was added. The reaction mixture was stirred at room temperature for 16 h. TLC showed the reaction was completed. The reaction mixture was quenched with water and washed with EA. The organic layer was separated and dried over Na2S04. The solvent was removed and purified by FCC to give compound 22-1 (5.3 g, 53.78%) as colorless oil. 1 HNMR (400 MHz, CDC13) δ: 3.71 (s, 6H), 1.88-1.84 (m, 4H), 1.31-1.26 (m, 16H), 1.14-1.10 (m, 4H), 0.89-0.86 (m, 6H).
[0844] Step 2: Preparation of compound 22-2
[0845] To a solution of compound 22-1 (5.3 g, 16.13 mmol, 1.0 eq.) in DMF (100 mL) was added LiCl (6.8 g, 161.3 mmol, 10.0 eq.). The reaction mixture was stirred at 120 °C for 12 h. TLC showed the reaction was completed. The reaction mixture was quenched with water and washed with EA. The organic layer was separated and dried over Na2S04. The solvent was removed and purified by FCC to give compound 22-2 (3.4 g, 78.07%) as colorless oil. 1HNMR (400 MHz, CDC13) δ: 3.67 (s, 3H), 2.33-2.31 (m, 1H), 1.60-1.40 (m, 6H), 1.25 (s, 18H), 0.89-0.86 (m, 6H).
[0846] Step 3: Preparation of compound 22-3
[0847] To a solution of compound 22-2 (3.4 g, 12.57 mmol, 1.0 eq.) in THF (60 mL) was added LiAlH4(955 mg, 25.14 mmol, 2.0 eq.) slowly at 0 °C. The reaction mixture was stirred at reflux for 1 h. TLC showed the reaction was completed. After cooling to 0 °C, the mixture was quenched by successive addition of water (1.3 mL), 15% NaOH aqueous solution (1.3 mL) and water (3.9 mL). The resulting mixture was diluted with EA and the precipitate was removed by filtration. The filtrate was concentrated under reduced pressure and the crude product was purified by FCC to give compound 22-3 (2.3 g, 75.48%) as yellow oil. 1 H NMR (400 MHz, CDC13) δ: 3.54 (d, J = 5.6 Hz, 2H), 1.46-1.40 (m, 2H), 1.27 (s, 24H), 0.90-0.87 (m, 6H).
[0848] Step 4: Preparation of compound 22-4
[0849] To a solution of compound 22-3 (1 g, 4.125 mmol, 1.0 eq.) in DCM (15 mL) was added 6-bromohexanoic acid (0.966 g, 4.950 mmol, 1.2 eq.), EDCI (1.19 g, 6.188 mmol, 1.5 eq.), DMAP (101 mg, 0.8250 mmol, 0.2 eq.) and DIEA (1.07 g, 8.250 mmol, 2.0 eq.). The reaction mixture was stirred at 50 °C for 16 h. TLC showed the reaction was completed. The solvent was removed and purified by FCC to give compound 22-4 (1 g, 57.79%) as yellow oil.
[0850] Step 5: Preparation of compound 22-5
[0851] To a solution of compound 22-4 (0.33 g, 0.79 mmol, 1.0 eq.) in ACN (15 mL) was added ethanolamine (49 mg, 0.79 mmol, 1.0 eq.), K2CO3(329 mg, 2.384 mmol, 3.0 eq.), Cs2CO3(78 mg, 0.2384 mmol, 0.3 eq.) and Nal (6 mg, 0.0397 mmol, 0.05 eq.). The reaction mixture was stirred at 80 °C for 16 h. LCMS showed the reaction was complete. The solvent was removed and purified by FCC to afford compound 22-5 (280 mg, 47.73%) as yellow oil.
[0852] Step 4: Preparation of compound 22
[0853] To a solution of compound 22-5 (230.0 mg, 0.53 mmol, 1.0 eq.) and compound 6-2 (257.0 mg, 0.64 mmol, 1.2 eq.) in THF (10.0 mL) was added DIEA (413.0 mg, 3.2 mmol, 5.0 eq.) at 0 °C. The mixture was stirred at 70 °C for 16 h. LCMS showed the reaction was complete, the mixture was evaporated under reduced pressure and purified by preparative HPLC to afford compound 22 (100.0 mg, 24% yield) as colorless oil.
[0854] 1 H NMR (400 MHz, CDC13) d: 0.86-0.89 (m, 9H), 1.26-1.35 (m, 52H), 1.46-1.49 (m, 3H), 1.60-1.65 (m, 8H), 1.78 (s, 3H), 2.28-2.32 (m, 5H), 2.49-2.60 (m, 10H), 3.54 (s, 2H), 3.95-4.06 (m, 4H). LCMS: Rt: 1.250 min; MS m / z (ESI): 793.7 [M+H] + .
[0855] 6.14 Example 14: Preparation of compound 25.
[0856]
[0857] Step 1: Preparation of compound 25-2
[0858] To a mixture of compound 25-1 (5 g, 23.25 mmol, 1.0 eq.) in CH3CN (200 mL) was added BnNH2(5 g, 46.5 mmol, 2.0 eq.) and K2CO3(9.64 g, 69.75 mmol, 3.0 eq.). The reaction mixture was stirred at 80 °C for 10 h. LCMS showed the reaction was completed. The solvent was removed, FCC was performed to give compound 25-2 (3.0 g, 53% yield) as colorless oil. LCMS: Rt: 0.740 min; MS m / z (ESI): 242.1 [M+H] + .
[0859] Step 2: Preparation of compound 25-4
[0860] A mixture of compound 25-2 (2.5 g, 10.36 mmol, 1.0 eq.), compound 25-3 (5.56 g, 20.72 mmol, 2.0 eq.) in EtOH (100 mL) was stirred at 70 °C for 10 h. LCMS showed the reaction was completed. The solvent was removed, FCC was performed to give compound 25-4 (2.5 g, 47% yield) as yellow oil. LCMS: Rt: 1.320 min; MS m / z (ESI): 510.4 [M+H] + .
[0861] Step 3: Preparation of compound 25-5
[0862] To a mixture of NaH (710 mg, 17.65 mmol, 6.0 eq.) in THF (60 mL) was added compound 25-4 (1.5 g, 2.94 mmol, 1.0 eq.) at room temperature under N2. The reaction mixture was stirred at room temperature for 2 h. To which was added C8H 17 Br (2.27 g, 11.77 mmol, 4.0 eq.). The reaction mixture was stirred at 70 °C for 10 h. LCMS showed the reaction was completed. The mixture was poured into water and washed with EA. The organic was separated and dried over Na2SO4. The solvent was removed, FCC was performed to give compound 25-5 (0.8 g, 43% yield) as yellow oil. LCMS: Rt: 0.733 min; MS m / z (ESI): 622.5 [M+H] + .
[0863] Step 4: Preparation of compound 25-6
[0864] To a solution of compound 25-5 (0.8 g, 1.29 mmol, 1.0 eq.) in ethyl acetate (100 mL) was added Pd / C (1.0 g). The reaction mixture was stirred at room temperature under H2for 48 h. LCMS showed the reaction was complete. The mixture was filtered through celite. The solvent was removed to give compound 25-6 (350 mg, 61% yield) as a yellow oil. LCMS: Rt: 1.040 min; MS m / z (ESI): 442.4 [M+H] + .
[0865] Step 5: Preparation of compound 25
[0866] To a mixture of compound 25-6 (350 mg, 0.8 mmol, 1.0 eq.), DIEA (200 mg, 1.6 mmol, 2.0 eq.) in THF (20 mL) was added compound 25-7 (200 mg, 0.4 mmol, 0.5 eq.), Nal (60 mg). The reaction mixture was stirred at 70 °C for 10 h. LCMS showed the reaction was complete. After removal of the solvent, the residue was purified by prep-HPLC to give the title compound (20 mg, 12% yield) as a yellow oil.
[0867] 1 H NMR (400 MHz, CDC13) δ: 0.87 (t, J = 8 Hz, 12H), 1.26-1.97 (m, 91H), 2.19-2.64 (m, 10H), 3.28-3.53 (m, 9H). LCMS: Rt: 0.627 min; MS m / z (ESI): 919.8 [M+H] + .
[0868] 6.15 Example 15: Preparation of compound 26.
[0869]
[0870] Step 1: Preparation of compound 26-2
[0871] To a solution of compound 26-1 (500 mg, 1.12 mmol, 1.0 eq.) and compound SM1 (170 mg, 2.24 mmol, 2.0 eq.) in ACN (10 mL) was added Cs2CO3(95 mg, 0.34 mmol, 0.3 eq.), K2CO3(465 mg, 3.36 mmol, 3.0 eq.) and Nal (14 mg, 0.1 mmol, 0.1 eq.) at room temperature. The mixture was stirred at 85 °C for 16 h. LCMS showed the reaction was completed. The mixture was evaporated under reduced pressure and purified by FCC (DCM / MeOH = 1 / 0-20 / 1) to give compound 26-2 (500 mg, 81% yield) as yellow oil. LCMS: Rt: 1.680 min; MS m / z (ESI): 442.4 [M+H] + .
[0872] Step 2: Preparation of compound 26-3
[0873] To a solution of compound 26-2 (100 mg, 0.23 mmol, 1.0 eq.) in DCM (10 mL) was added SOCl2(82 mg, 0.69 mmol, 3.0 eq.) at room temperature. The mixture was stirred at 35 °C for 16 h. LCMS showed the reaction was completed. The mixture was evaporated under reduced pressure to give compound 26-3 (100 mg, crude) as yellow oil. LCMS: Rt: 0.920 min; MS m / z (ESI): 460.3 [M+H] + .
[0874] Step 3: Preparation of compound 26
[0875] To a solution of compound 26-3 (110 mg, 0.24 mmol, 1.0 eq.) and compound SM2 (100 mg, 0.24 mmol, 1.0 eq.) in THF (10 mL) was added DIEA (413 mg, 3.2 mmol, 5.0 eq.) and Nal (5 mg, 0.02 mmol, 0.1 eq.) at 0 °C. The mixture was stirred at 70 °C for 16 h. LCMS showed the reaction was completed. The mixture was evaporated under reduced pressure and purified by prep-HPLC to give compound 26 (20 mg, 10% yield) as colorless oil. 1H NMR (400 MHz...
Claims
1. A compound of formula (I): or a pharmaceutically acceptable salt or stereoisomer thereof, wherein: G 1 and G 2 Each is independently a bond, an unsubstituted C2-C 12 Alkylene or unsubstituted C2-C 12 Alkenylene, where G 1 and G 2 One -CH2- in is optionally replaced by -O-; Each L 1 are independently -OC(=O)R 1 、-C(=O)OR 1 、-OR 1 、-NR a C(=O)R 1 or -C(=O)NR b R c ; Each L 2 are independently -OC(=O)R 2 、-C(=O)OR 2 、-OR 2 、-NR d C(=O)R 2 or -C(=O)NR e R f ; R 1 and R 2 Each independently is C6-C 24 Alkyl or C6-C 24 alkenyl; R a 、R b 、R d and R e Each independently represents H, C1-C 24 Alkyl or C2-C 24 alkenyl; R c and R f Each independently is C6-C 24 Alkyl or C6-C 24 alkenyl; G 3 is an unsubstituted C2-C 12 Alkylene or unsubstituted C2-C 12 alkenylene; R 3 is C3-C8 cycloalkyl, optionally substituted with one or more C1-C6 alkyl, halogen, C1-C6 haloalkyl or hydroxy; R 4 It is C1-C 12 alkyl, optionally substituted with one or more hydroxyl groups; n is 1 or 2; m is 1 or 2.
2. The compound according to claim 1, which is a compound of formula (III-A), (III-B), (III-C) or (III-D): Where s is an integer from 2 to 12, or a pharmaceutically acceptable salt or stereoisomer thereof.
3. The compound according to claim 1, which is a compound of formula (IV-A), (IV-B), (IV-C), (IV-D), (IV-E), (IV-F), (IV-G) or (IV-H): Where s is an integer from 2 to 12, wherein y is an integer from 2 to 12; and wherein z is an integer from 2 to 12, or a pharmaceutically acceptable salt or stereoisomer thereof.
4. The compound according to claim 1, which is a compound of formula (VA), (VB), (VC), (VD), (VE), (VF), (VG), (VH) or (VI): wherein y is an integer from 2 to 12; and wherein z is an integer from 2 to 12, or a pharmaceutically acceptable salt or stereoisomer thereof.
5. The compound of claim 1 , which is a compound of Formula (IX-A), (IX-B), (IX-C), (IX-D), (IX-E), (IX-F), (IX-G), (IX-H), (IX-I), (IX-J), (IX-K), (IX-L), (IX-M), (IX-N), (IX-O), (IX-P), (IX-Q), (IX-R), (IX-S), (IX-T), (IX-U), (IX-V), (IX-W), (IX-X), (IX-Y), (IX-Z) or (IX-AA): wherein s is an integer from 2 to 12, and y is an integer from 2 to 12; z is an integer from 2 to 12; y0 is an integer from 1 to 11; z0 is an integer from 1 to 11; y1 is an integer from 0 to 9; z1 is an integer from 0 to 9; y2 is an integer from 2 to 5; y3 is an integer from 2 to 6; y4 is an integer from 0 to 3; y5 is an integer from 1 to 5; z2 is an integer from 2 to 5; z3 is an integer from 2 to 6; z4 is an integer from 0 to 3; and z5 is an integer from 1 to 5; or a pharmaceutically acceptable salt or stereoisomer thereof.
6. A compound, or a pharmaceutically acceptable salt or stereoisomer thereof, 7. The compound according to claim 6, which is Compound 135.
8. A composition comprising the compound according to any one of claims 1 to 7 and a therapeutic agent or a preventive agent.
9. The composition according to claim 8, wherein the composition is a nanoparticle, The composition further comprises at least one of the following components (i) to (iii): (i) 1,2-distearoyl-sn-glycero-3-phosphocholine, wherein the molar ratio of the compound to 1,2-distearoyl-sn-glycero-3-phosphocholine is 2:1 to 8:1, (ii) a steroid, wherein the steroid is cholesterol, wherein the molar ratio of the compound to the steroid is from 5:1 to 1:1, (iii) one or more polymer-bound lipids, wherein the polymer-bound lipid is DMG-PEG2000 or DMPE-PEG2000, wherein the molar ratio of the compound to the polymer-bound lipid is 100:1 to 20:
1.
10. A lipid nanoparticle comprising the compound of any one of claims 1 to 7 or the composition of any one of claims 8 to 9.
11. A pharmaceutical composition comprising the compound of any one of claims 1 to 7 or the composition of any one of claims 8 to 9, and a pharmaceutically acceptable excipient or diluent.
12. Use of a pharmaceutical composition in the preparation of a product for vaccination, the pharmaceutical composition comprising the compound of any one of claims 1 to 7 or the composition of any one of claims 8 to 9 or the lipid nanoparticles of claim 10, and a pharmaceutically acceptable excipient or diluent.
Citation Information
Patent Citations
Compositions and methods related to mRNA translational enhancer elements
EP2610340A1
Compositions and methods related to mRNA translational enhancer elements
EP2610341A1
Translation enhancer-element dependent vector systems
US20070048776A1
Methods of Identifying Synthetic Transcriptional and Translational Regulatory Elements, and Compositions Related to Same
US20090093049A1
Compositions and methods related to mRNA translational enhancer elements
US20090226470A1