Process for the production of 3-hydroxypropionic acid
By activating the electron transport system in a glycerol-containing culture medium, controlling dissolved oxygen, and adding glucose, the problems of low 3-HP productivity and yield were solved, enabling efficient 3-HP production and commercial application.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- LG CHEM LTD
- Filing Date
- 2021-11-05
- Publication Date
- 2026-08-04
AI Technical Summary
The production rate and yield of 3-hydroxypropionic acid (3-HP) in existing technologies are low, and there are many byproducts in the biosynthesis process, making it difficult to achieve commercial application.
Cells with 3-HP production capacity were seeded into a glycerol-containing medium and fermented under conditions that activated the electron transport system. Dissolved oxygen was controlled and glucose was added to improve 3-HP production and avoid cell proliferation.
It significantly improved the productivity and yield of 3-HP, reduced the generation of by-products, and promoted the commercial application of 3-HP.
Smart Images

Figure CN116323957B_ABST
Abstract
Description
Technical Field
[0001] Cross-references to related applications
[0002] This application claims priority based on Korean Patent Application Nos. 10-2020-0147146 and 10-2020-0147147, filed on November 5, 2020, all of the contents disclosed in the corresponding Korean Patent Applications are incorporated herein by reference.
[0003] This specification relates to a method for producing 3-hydroxypropionic acid (3-HP) and / or a method for increasing the production capacity of 3-HP, and more specifically, to a method for producing 3-HP and / or increasing the productivity of 3-HP by using cells with 3-HP production capacity as catalysts and by regulating energy and / or coenzyme balance during the culture process for producing 3-HP. Background Technology
[0004] 3-Hydroxypropionic acid is a platform compound that can be converted into various chemicals, such as acrylic acid, methyl acrylate, and acrylamide. Since being selected as one of the top 12 value-added biochemicals by the U.S. Department of Energy (DOE) in 2004, it has been actively studied by academia and industry.
[0005] The production of 3-HP mainly employs two methods: chemical and biological. However, in the case of chemical methods, it has been pointed out that the initial materials are expensive and that the production process generates toxic substances, which is not environmentally friendly. Therefore, environmentally friendly biological processes have attracted much attention.
[0006] Glucose and glycerol are primarily used as substrates for the biosynthesis of 3-HP by microorganisms, but due to low yield and productivity, 3-HP has not yet been commercialized despite its potential. Summary of the Invention
[0007] Technical issues
[0008] Therefore, the inventors have developed a fermentation technology that can increase the production concentration of 3-HP while maintaining high yield and productivity for the commercialization of 3-HP.
[0009] One example of this application provides a method for producing 3-hydroxypropionic acid (3-HP) and / or a method for increasing the productivity of 3-HP, comprising seeding cells with 3-hydroxypropionic acid (3-HP) production capacity into a culture medium containing glycerol as a carbon source, and producing 3-HP under conditions that activate an electron transport system.
[0010] Technical solution
[0011] This application provides a method for producing 3-hydroxypropionic acid (3-HP) and / or a method for improving the productivity of 3-HP, comprising seeding cells with 3-hydroxypropionic acid (3-HP) production capacity into a culture medium containing glycerol as a carbon source, and producing 3-HP under conditions that activate the electron transport system.
[0012] More specifically, the method may include,
[0013] (1) Cells capable of producing 3-hydroxypropionic acid (3-HP) were seeded into a production culture medium; and
[0014] (2) Production of 3-HP by culturing inoculated cells.
[0015] The production medium may contain glycerol as a carbon source. The production medium used in cell inoculation may not contain glucose as a carbon source.
[0016] The culture can be carried out under the following conditions: (i) the dissolved oxygen (DO) in the production medium is maintained at a level below 50%, (ii) glucose is added when the dissolved oxygen in the medium is above 0.1%, or (iii) both of the above conditions.
[0017] In step (2) of producing 3-HP, cell proliferation may not occur.
[0018] In another embodiment, the method may be a two-step process, further comprising: "growth / proliferation" of cells after high-concentration culture, prior to the "production step" of seeding cells into a production culture medium and culturing them.
[0019] More specifically, the method may further include:
[0020] Before the (1) vaccination step,
[0021] (a) Cells capable of producing 3-hydroxypropionic acid (3-HP) were cultured at high concentrations in growth medium; and
[0022] (b) Isolating cultured cells from the growth medium.
[0023] Cells isolated from the growth medium can be seeded into the production medium of step (1). The growth medium may not contain glycerol as a carbon source.
[0024] The invention will be described in more detail below.
[0025] The methods for producing 3-HP and / or improving the productivity of 3-HP provided herein include: seeding cells with 3-hydroxypropionic acid (3-HP) production capacity into a culture medium containing glycerol as a carbon source (3-hydroxypropionic acid production medium); and producing 3-HP under conditions that activate the electron transport system (e.g., conditions that maintain dissolved oxygen at a certain level and / or conditions that add glucose).
[0026] The 3-hydroxypropionic acid production medium can be used without restriction, as long as it is within the desired range that enables cells to produce 3-HP without causing proliferation (cell division, growth, or development) of cells that do not produce 3-HP.
[0027] In one embodiment, the carbon source of the production medium may be glycerol, but is not limited thereto. In one embodiment, the culture medium used for production may further contain vitamin B12. In one embodiment, the production medium during cell inoculation may not contain glucose.
[0028] In one embodiment, the culture medium may be a synthetic culture medium or a semi-synthetic culture medium, but is not limited thereto.
[0029] Cells used for inoculation can be prepared by isolating cells capable of producing 3-hydroxypropionic acid (3-HP) after high-concentration culture, but are not limited to this.
[0030] The seed concentration of highly cultured cells (cell concentration at the time of seeding) can be appropriately adjusted or determined by those skilled in the art within the range intended for the production of 3-HP. In one embodiment, the seed concentration (based on stem cell weight (DCW) / culture medium volume (L)) can be 1 to 20 g / L, 1 to 16 g / L, 1 to 12 g / L, 1 to 9 g / L, 2 to 20 g / L, 2 to 16 g / L, 2 to 12 g / L, 2 to 9 g / L, 4 to 20 g / L, 4 to 16 g / L, 4 to 12 g / L, or 4 to 9 g / L, but is not limited thereto.
[0031] The production of 3-hydroxypropionic acid can be carried out without restriction by selecting culture methods known in the art within the scope of the purpose of producing 3-HP, and in one embodiment, it can be carried out by fermentation culture.
[0032] In 3-HP production, proliferation of the inoculated cells may not occur. In one embodiment, the number of cells at the end of production may be less than 150%, less than 130%, less than 100%, less than 90%, or less than 80% of the number of inoculated cells, for example, 50% to 150%, 50% to 130%, 50% to 100%, 50% to 90%, 50% to 80%, 70% to 150%, 70% to 130%, 70% to 100%, 70% to 90%, or 70% to 80%, but is not limited thereto.
[0033] Conditions that activate the electron transport system (e.g., conditions that maintain dissolved oxygen at a certain level and / or conditions that add glucose) can, for example, activate the regeneration of NAD+ coenzymes and / or activate ATP production, but are not limited to these.
[0034] The conditions for activating an electron transport system can be:
[0035] (i) Adding glucose to the culture medium (e.g., culture medium and / or broth for the production of 3-HP);
[0036] (ii) Maintain (regulate) the dissolved oxygen (DO) in the culture medium (e.g., the culture medium and / or broth used for the production of 3-HP) at a certain level; or
[0037] Combinations of (iii), (i), and (ii).
[0038] In one implementation, the conditions for activating the electron transport system can be established by adding glucose to the culture medium (e.g., a medium and / or broth for producing 3-HP). Glucose addition can be performed when the dissolved oxygen (DO) in the medium is at or above a certain level, or regardless of the dissolved oxygen level in the medium (e.g., before the dissolved oxygen in the medium reaches or exceeds a certain level after culturing). Glucose can be added for energy supply rather than for cell growth.
[0039] When 3-HP biosynthesis is performed using glycerol, at a certain time point, NAD+ and energy deficiency occurs, the reaction rate decreases, and 3-HP synthesis ceases. Then, DO rises from 0% at the start of culture (fermentation). 3-HP production can be sustained by adding glucose as an energy source to resupply cells with NAD+ and ATP when DO rises. Glucose can be added to the culture medium before and / or after DO in the medium rises to a certain level or higher.
[0040] The dissolved oxygen used as the basis for glucose addition can be appropriately selected as needed within the scope of the purpose of producing 3-HP. In one embodiment, the time point for adding glucose can be the time point at which the dissolved oxygen in the culture medium begins to increase from the start of culture. The dissolved oxygen in the culture medium used as the basis for glucose addition can be, for example, more than 0.1%, more than 0.5%, more than 1%, more than 3%, more than 5%, more than 10%, more than 15%, more than 20%, more than 25%, or more than 30%, but is not limited thereto (the upper limit can be 100%, 75%, or 50%, but is not limited thereto).
[0041] In one embodiment, the amount (concentration; weight (g) of glucose to be added / volume (L) of culture medium) of glucose to be added can be 0.01 to 3 g / L, 0.05 to 3 g / L, 0.1 to 3 g / L, 0.3 to 3 g / L, 0.01 to 2 g / L, 0.05 to 2 g / L, 0.1 to 2 g / L, 0.3 to 2 g / L, 0.01 to 1 g / L, 0.05 to 1 g / L, 0.1 to 1 g / L, 0.3 to 1 g / L, 0.01 to 0.7 g / L, 0.05 to 0.7 g / L, 0.1 to 0.7 g / L, 0.3 to 0.7 g / L, 0.01 to 0.3 g / L, 0.05 to 0.3 g / L, or 0.1 to 0.3 g / L, but is not limited thereto.
[0042] In one embodiment, compared with a control group without added glucose, the above-described method for producing 3-HP by adding glucose to the culture medium used for production under conditions of activated electron transport system can have an increase of 30% or more, 40% or more, or 50% or more, for example, 30% to 1000%, 30% to 500%, 30% to 300%, 30% to 100%, 40% to 1000%, 40% to 500%, 40% to 300%, 40% to 100%, 50% to 1000%, 50% to 500%, 50% to 300%, or 50% to 100%, but is not limited thereto.
[0043] In another example, the conditions for activating the electron transport system can be achieved by maintaining (regulating) dissolved oxygen (DO) at a certain level.
[0044] The “certain level” of DO can be determined without limitation within the range used for the production of 3-HP. For example, its level can be less than 50%, less than 30%, less than 20%, less than 10%, 1% to 50%, 1% to 30%, 1% to 20%, 1% to 10%, 3% to 50%, 3% to 30%, 3% to 20%, 3% to 10%, 5% to 50%, 5% to 30%, 5% to 20%, or 5% to 10%, but is not limited thereto.
[0045] In one embodiment, dissolved oxygen can be maintained during cultivation by one or more of the following methods selected from, but not limited to, stirring speed regulation, air supply regulation, and pressure regulation. For example, when the dissolved oxygen in the culture medium or culture is (1) below the range, one or more of the stirring speed, air supply, and pressure can be increased, and (2) when it is above the range, one or more of the stirring speed, air supply, and pressure can be decreased, thereby maintaining the dissolved oxygen in the culture medium or culture within a certain range, but not limited to, these methods.
[0046] In one embodiment, compared with a control group that does not include conditions for maintaining dissolved oxygen, a method for producing 3-HP by maintaining (adjusting) dissolved oxygen under conditions for activating the electron transport system can have an increase in 30% or more, 50% or more, 70% or more, 30% to 1000%, 30% to 500%, 30% to 300%, 30% to 100%, 50% to 1000%, 50% to 500%, 50% to 300%, 50% to 100%, 70% to 1000%, 70% to 500%, 70% to 300%, or 70% to 100%, but is not limited thereto.
[0047] In the method for producing 3-HP and / or the method for increasing the productivity of 3-HP provided in this specification, the cells with 3-hydroxypropionic acid production capacity inoculated into the production medium in (1) may be cells isolated from the growth medium after being cultured at a high concentration in the growth medium.
[0048] Therefore, the method may further include: separating 3-hydroxypropionic acid production cells after high-concentration culture of production cells before producing 3-HP, and then inoculating them into the production culture medium.
[0049] More specifically, the method may further include,
[0050] Before (1) vaccination,
[0051] (a) Cells capable of producing 3-hydroxypropionic acid (3-HP) were cultured at high concentrations in growth medium; and
[0052] (b) Isolating cultured cells from the growth medium.
[0053] Cells isolated from the growth medium can then be used as cells capable of producing 3-hydroxypropionic acid, inoculated into the production medium of (1). The growth medium may not contain glycerol as a carbon source.
[0054] In this specification, 3-hydroxypropionic acid producing cells (which may be used interchangeably with "cells capable of producing 3-hydroxypropionic acid") may be selected from microorganisms capable of producing 3-HP from a carbon source (e.g., glycerol) in a production culture medium, such as, but not limited to, microorganisms composed of *Escherichia coli* strains (e.g., *Escherichia coli*), *Pseudomonas*, *Enterobacter*, *Bryophyte*, *Corynebacterium*, *Klebsiella*, *Citrobacter*, *Clostridium*, *Streptomyces*, *Bacillus*, *Lactobacillus*, *Saccharomyces*, and *Aspergillus*. In one specific example, the 3-hydroxypropionic acid producing cell may be *Escherichia coli*.
[0055] In one embodiment, the 3-hydroxypropionic acid producing cell may contain a gene encoding one or more (e.g., one or both) proteins selected from glycerol dehydratases and aldehyde dehydrogenases. In one embodiment, the 3-HP producing cell may also additionally contain a gene (gdrAB) encoding a glycerol dehydratase reactivator enzyme (GdrAB). In one embodiment, the 3-HP producing cell may be a cell capable of additionally biosynthesizing vitamin B12.
[0056] Glyceryl dehydratase can be encoded by the dhaB (GenBank accession number U30903.1) gene, but is not limited thereto. The dhaB gene can be an enzyme derived from Klebsiella pneumoniae, but is not limited thereto. Genes encoding glyceryl dehydratase can include genes encoding dhaB1, dhaB2, and / or dhaB3. The glyceryl dehydratase protein and its encoding gene can contain mutations in the gene and / or amino acid sequence within the range that maintain the enzymatic activity of breaking down glycerol into 3-hydroxypropanal (3-HPA) and water (H2O).
[0057] The gene encoding aldehyde dehydrogenase (ALDH) (aldH) can be, but is not limited to, the aldH gene (GenBank accession number U00096.3; EaldH) derived from *Escherichia coli* or the *E. coli* K12 MG1655 cell line, the puuC gene derived from *Klebsiella pneumoniae*, and / or the KGSADH gene derived from *Azospirillum brasilense*. The aldehyde dehydrogenase protein and its encoding gene can contain mutations in the gene and / or amino acid sequence to maintain the activity of 3-HP production from 3-HPA.
[0058] The 3-HP production cell may contain genes encoding one, two or more, or all three of the following: glycerol dehydratase, aldehyde dehydratase, and glycerol dehydratase reactivator, or a recombinant vector containing said genes.
[0059] The recombinant vector can be used, by means of methods known in the art, to express in cells one, two or more, or all three genes selected from glycerol dehydratase, aldehyde dehydratase, and glycerol dehydratase reactivator, by means of alternative promoters and regulatory sites.
[0060] High-concentration culture can be carried out without limitation by using methods known in the art, within the scope of ensuring the number of cells produced by 3-HP, and in one embodiment, the culture can be carried out by fed-batch culture.
[0061] In one embodiment, fed-batch culture can be carried out using a pH steady-state method, a continuous feeding method, or a combination thereof. In one embodiment, when performing a pH steady-state fed-batch culture, glucose can be added at a concentration of 1 to 5 g / L. In one embodiment, when performing a continuous feeding method fed-batch culture, glucose can be injected at a rate of 10 to 20 g / L / h.
[0062] In one implementation, during high-concentration culture, the pH may be maintained at 5 to 7.5, 5 to 7, 5.5 to 7.5, 5.5 to 7, 6 to 7.5, or 6.5 to 6, but is not limited thereto.
[0063] In one embodiment, the carbon source included in the growth medium during high-concentration cultivation can be selected and used from monosaccharides, disaccharides, and / or polysaccharides within the scope of the purpose of high-concentration cultivation, without limitation. For example, the carbon source can be one or more, two or more, three or more, four or more, five or more, ten or more, or a combination of all 11 selected from glucose, fructose, galactose, mannose, arabinose, xylose, ribose, sucrose, maltose, lactose, and cellobiose. The growth medium may not contain glycerol as a carbon source.
[0064] In one embodiment, the high-concentration cultured cell concentration OD600 (optical density (OD) measured at 600 nm) can be greater than 10, greater than 50, greater than 100, greater than 150, greater than 200, 10 to 500, 10 to 400, 10 to 300, 10 to 250, 50 to 500, 50 to 400, 50 to 300, 50 to 250, 100 to 500, 100 to 400, 100 to 300, 100 to 250, 150 to 500, 150 to 400, 150 to 300, 150 to 250, 200 to 500, 200 to 400, 200 to 300, or 200 to 250, but is not limited thereto.
[0065] The isolation of highly cultured cells may include one, two, or more steps selected from centrifugation to separate cells, removal of supernatant, and resuspending of particles in a buffer. In one embodiment, the buffer may be PBS (phosphate-buffered saline), but is not limited thereto.
[0066] The methods for producing 3-HP and / or for increasing the productivity of 3-HP provided in this specification may have a 3-HP yield of 80% or more, 85% or more, 90% or more, 93% or more, or 95% or more, but are not limited thereto. The 3-HP yield can be calculated as the ratio of the amount of 3-HP produced in the culture medium (culture) to the amount of glycerol used in the culture medium (production medium) during the production of 3-HP, and in one embodiment, it can be calculated according to the following formula 1.
[0067] [Formula 1]
[0068] Yield (%) = [(Final 3-HP (g)) / {(Glycerol before culture (g) - (Glycerol after culture (g))}] * 100
[0069] The 3-HP production capacity of the method for producing 3-HP and / or the method for improving the productivity of 3-HP provided by the present invention may be 2.0 g / L / h or more, 2.5 g / L / h or more, 2.0 to 60 g / L / h, 2.0 to 40 g / L / h, 2.0 to 20 g / L / h, 2.0 to 10 g / L / h, 2.5 to 60 g / L / h, 2.5 to 40 g / L / h, 2.5 to 20 g / L / h or 2.5 to 10 g / L m / h, but is not limited thereto.
[0070] Glycerol can be converted to 3-HPA, and then reduced to 1,3-propanediol (1,3-PDO) or oxidized to 3-HP. The methods for producing 3-HP and / or for increasing the yield of 3-HP provided in this specification can eliminate the production of 1,3-PDO. Therefore, the yield of 3-HP can be increased by eliminating the production of 1,3-PDO.
[0071] Furthermore, the methods for producing 3-HP and / or for increasing the productivity of 3-HP provided in this specification can have significantly less content of byproducts, acetates, lactates, etc., and residual glycerol generated during the production of 3-HP.
[0072] Another example provides a culture of a 3-hydroxypropionic acid producing strain with high 3-hydroxypropionic acid content and low content of byproducts.
[0073] Based on the total culture, the culture may contain 60 g / L or more, 62 g / L or more, 65 g / L or more, 67 g / L or more, 70 g / L or more, 72 g / L or more, 75 g / L or more, 77 g / L or more, 78 g / L or more, 79 g / L or more, 80 g / L or more, 81 g / L or more, 82 g / L or more, 83 g / L or more, 84 g / L or more, 85 g / L or more, 86 g / L or more, 87 g / L or more, 88 g / L or more, 89 g / L or more, or 90 g / L or more (the upper limit may be selected between 85 and 1000 g / L, but is not limited thereto; for example, it may be 1000 g / L, 500 g / L, 200 g / L, 100 g / L or 95 g / L, but is not limited thereto).
[0074] Furthermore, based on the total culture, the culture may have one or more characteristics selected from the following:
[0075] The acetate concentration is below 0.25% (w / v), below 0.2% (w / v), below 0.15% (w / v), or below 0.1% (w / v);
[0076] Lactate concentration is less than 0.15% (w / v), less than 0.1% (w / v), less than 0.05% (w / v), less than 0.03% (w / v), less than 0.01% (w / v), or absent;
[0077] PDO (1,3-propanediol) concentrations of 0.25% (w / v) or less, 0.2% (w / v) or less, 0.15% (w / v) or less, 0.1% (w / v) or less, 0.07% (w / v) or less, or 0.05% (w / v) or less; and
[0078] The glycerol concentration is 0.45% (w / v) or less, 0.4% (w / v) or less, 0.35% (w / v) or less, 0.3% (w / v) or less, 0.25% (w / v) or less, 0.2% (w / v) or less, 0.15% (w / v) or less. The lower limit of each range may include 0 (not present), or 0.000001% (w / v), 0.00001% (w / v), 0.0001% (w / v), 0.001% (w / v), or 0.005% (w / v), but is not limited thereto.
[0079] In one specific example, the culture can be obtained by the above-described method for producing 3-HP and / or by methods for improving the productivity of 3-HP, i.e.
[0080] (1) Cells capable of producing 3-hydroxypropionic acid (3-HP) were seeded into a production culture medium; and
[0081] (2) Culture the inoculated cells to produce 3-HP.
[0082] But it is not limited to this.
[0083] Then, after high-concentration culture in the growth medium, cells capable of producing 3-hydroxypropionic acid (1) can be isolated from the growth medium and inoculated into the production medium. Therefore, in a specific example, the culture can be obtained by culturing an isolated 3-hydroxypropionic acid-producing strain, which is obtained as follows:
[0084] (1') Seedling cells capable of producing 3-hydroxypropionic acid isolated from the growth medium after high-concentration culture in the growth medium; and
[0085] (2') Culture the seeded cells to produce 3-HP.
[0086] The culture can be used for the production of 3-hydroxypropionic acid.
[0087] Therefore, another example provides a composition comprising the culture for the production of 3-hydroxypropionic acid.
[0088] Another example provides a method for producing 3-hydroxypropionic acid, comprising separating, recovering and / or purifying 3-hydroxypropionic acid from the composition used for producing 3-hydroxyacrylic acid.
[0089] Beneficial effects
[0090] The 3-HP production method and / or productivity improvement method provided by this invention can significantly improve the productivity and yield of 3-HP and can be effectively used for the commercialization of 3-HP. Attached Figure Description
[0091] Figure 1 The biosynthetic pathway of 3-HP biosynthesis from glycerol is briefly illustrated.
[0092] Figure 2 The graph shows the results of measuring the yield of 3-HP in the second-step culture under the conditions of the control group (comparative example) and Examples 1 and 2. Detailed Implementation
[0093] The invention will be described in more detail below by way of examples. However, the following embodiments are intended to illustrate the content of the invention only, and the scope of the invention is not limited to the following embodiments.
[0094] Unless otherwise specified in this specification, all temperatures are based on degrees Celsius, and unless otherwise specified, nucleic acid sequences are described from the 5' end to the 3' end.
[0095] Example 1.3 - Preparation of HP-producing strain
[0096] A recombinant vector containing genes encoding glycerol dehydratase and aldehyde dehydrogenase was prepared. Glycerol dehydratase and aldehyde dehydrogenase are known to use glycerol as a substrate to produce 3-hydroxypropionic acid (3-HP). A 3-HP-producing strain was produced by introducing the prepared recombinant vector into Escherichia coli strain W3110.
[0097] Specifically, the genes encoding glycerol dehydratase (dhaB), aldehyde dehydrogenase (aldH), and dehydratase reactivator (gdrAB) were cloned into plasmid pCDF to produce a recombinant vector (pCDF_J23101_dhaB_gdrAB_J23100_aldH) for the production of 3HP.
[0098] The pCDFDuetJ23 vector used to produce the recombinant vector is a vector in which the promoter portion of the pCDFDuet-1 vector (Novagen, USA) has been replaced by the J23101 and J23100 promoters. The dhaB (U30903.1; approximately 2.7 kb; including dhaB1, dhaB2, and dhaB3) and gdrAB genes (approximately 2.2 kb; gdrA and gdrB) inserted into the vector were amplified in the chromosome of *Klebsiella pneumoniae* (ATCC 25955) using the primers listed in Table 1 below. Because the dhaB123 and gdrA genes are located side-by-side on the *Klebsiella pneumoniae* chromosome, they were amplified together, and because gdrB is located in the opposite direction to dhaB123 and gdrA, only gdrB was amplified separately.
[0099] The aldH gene was amplified and isolated from the genome of *Escherichia coli* strain K12 MG1655 using promoter pairs consisting of the nucleic acid sequences of SEQ ID NO:5 and SEQ ID NO:6 as shown in Table 1 below. Table 1 below shows the nucleic acid sequences of the primers used to amplify each gene; in the names, "-F" indicates a forward promoter and "-R" indicates a reverse promoter.
[0100] [Table 1]
[0101] SEQ ID NO name Nucleic acid sequence (5'>3') 1 dhaB-gdrA-F GAATTCATGAAAAGATCAAAACGATTTGCAGTCCT 2 dhaB-gdrA-R AAGCTTGATCTCCCACTGACCAAAGCTGG 3 gdrB-F AAGCTTAGAGGGGGCCGTCATGTCGCTTTCACCGCCAG 4 gdrB-R CTTAAGTCAGTTTCTCTCACTTAACGGC 5 aldH-F ggtaccatgaattttcatcatctggc 6 aldH-R catatgtcaggcctccaggcttat
[0102] After amplification of each gene, the dhaB123, gdrA, and gdrB genes were cloned downstream of the J23101 promoter in the pCDFDuetaJ23 vector using restriction endonucleases EcoRI and HindIII, and HindIII and AflII, respectively. aldH was cloned at the end of the J23108 promoter using restriction endonucleases KpnI and NdeI. The cloning methods for each gene were performed using methods known in the art.
[0103] The plasmid was introduced into Escherichia coli W3110 (KCCM 40219) by electroporation, and the 3HP production strain was prepared.
[0104] Preparation Example 1. Two-step cell culture for 3-HP production
[0105] 1-1. High-concentration cell culture (Step 1 culture)
[0106] For the prepared 3-HP production strain, high-concentration cell culture was carried out in a 5L fermenter (working volume 2L) using a fed-batch culture method.
[0107] Specifically, 20 g / L glucose and 25 mg / L of the selected antibiotic (streptomycin) were added to MR medium (6.67 g KH2PO4, 4 g (NH4)2HPO4, 0.8 g MgSO4·7H2O, 0.8 g citric acid and 5 mL trace metal solution per 1 L; here, the trace metal solution was 5 mL 5M HCl, 10 g FeSO4·7H2O, 2 g CaCl2, 2.2 g ZnSO4·7H2O, 0.5 g MnSO4·4H2O, 1 g CuSO4·5H2O, 0.1 g (NH4)6Mo7O2·4H2O and 0.02 g Na2B4O2·10H2O per 1 L) to use it as a cell culture medium and the temperature was maintained at 35 degrees Celsius. The pH was maintained at 6.95 using ammonia, the dissolved oxygen (DO) was maintained at 20%, the stirring speed was increased to 900 rpm in stages, and the aeration was maintained at 1 vvm.
[0108] For fed-batch culture, a steady-state pH feeding method was used, with glucose added at 3 g / L.
[0109] Cell concentration was measured by optical density (OD) using a UV spectrometer as culture time progressed. At 20 hours after the start of culture, the OD600 was approximately 120 (stem cell weight 30 g / L).
[0110] After high-concentration cell culture, the cell culture medium was centrifuged at 6,000 rpm for 10 minutes at 4 degrees Celsius to recover the cells. The recovered cells were resuspended in PBS (phosphate-buffered saline) and used in the following steps.
[0111] 1-2. Production of 3-HP using high-concentration cell cultures (Step 2 culture)
[0112] A culture medium for the production of 3-HP was prepared by adding 70 g / L glycerol and 50 μM vitamin B12 to glucose-free M9 medium. The cell suspension prepared in Preparation Example 1-1 was inoculated into the culture medium for the production of 3-HP as a 5 g / L (based on stem cell weight) cell seeding solution, and the 3-HP production step was carried out in a 5 L fermenter (working volume 2 L).
[0113] The culture conditions used for 3-HP production were maintained at a temperature of 35°C and a stirring speed of 300 rpm, with aeration maintained at 1 vvm and pH maintained at 7.0 using Ca(OH)2.
[0114] Example 2. Glucose supply conditions for activating the electron transport system (Step 2 culture + glucose addition)
[0115] ATP is known to be consumed to transport 3-HP synthesized in the cell to the extracellular space. This ATP synthesis primarily occurs in the electron transport system, but it can also be achieved through phosphorylation at the glucose substrate level. Therefore, the increased productivity of 3-HP was demonstrated when ATP was continuously supplied by adding small amounts of glucose.
[0116] Specifically, under the same conditions as in step 2 of Preparation Examples 1-2, the strain used for producing 3-HP (the strain prepared in Preparation Example 1) isolated after high-concentration culture in step 1 using the method of Preparation Example 1-1 was inoculated and cultured. However, when the dissolved oxygen (DO) was measured during the culture in step 2 (in the culture medium) and it exceeded 20%, the culture conditions were set to add a glucose solution with a concentration of 700 g / L to 0.3 g / L.
[0117] As a control group (comparative example), only the steps of preparation examples 1-1 to 1-2 were performed, along with cell culture and 3-HP production.
[0118] Example 3. Gas supply control conditions for activating the electron transfer system (step 2 cultivation + DO control)
[0119] Glycerol is converted to 3-HPA by glycerol dehydratase, and then 3-HPA is converted to 3-HP by aldehyde dehydrogenase, thus achieving the biosynthesis of 3-HP using glycerol. Figure 1To convert 3-HPA to 3-HP, the oxidizing coenzyme NAD+ is required, and for continuous 3-HP production, the regeneration of NAD+ into NADH must be achieved. This NAD+ regeneration process mainly occurs in the electron transport system. Therefore, the increased 3-HP productivity was confirmed when oxygen was adequately supplied to activate the electron transport system.
[0120] Specifically, under the same conditions as step 2 of preparation examples 1-2, the strain used for producing 3-HP, isolated after step 1 of the method of preparation examples 1-1, was inoculated and cultured. However, in step 2, 2 hours after inoculation, the culture conditions were set to maintain dissolved oxygen (DO) at 5% by adjusting the stirring speed (rpm). In this example, the initial stirring speed was started at 300 rpm, and after 2 hours, the DO was adjusted to 5% by gradually increasing the stirring speed. In other words, when the DO was below 5%, the stirring speed was increased by 1-2 rpm, and when it was above 5%, the DO was maintained at 5% while decreasing it by 1-2 rpm.
[0121] As a control group (Comparative Example 1), only the steps of Preparation Examples 1-1 to 1-2 were performed, along with cell culture and 3-HP production. In the control group, the initial oxygen consumption (DO) was 0% immediately after inoculation, and at the end of culture in step 2 (40 hours), oxygen consumption ceased, and DO increased to 100%.
[0122] Example 4. Comparison of 3-HP yield under various culture conditions
[0123] When producing 3-HP using the methods of Examples 2 to 3 and Preparation Examples 1-1 to 1-2 (Comparative Example 1), the yield of 3-HP (g / L) was measured according to the elapsed culture time in step 2, and the results are shown in... Figure 2 middle.
[0124] like Figure 2 It was confirmed that 50 hours after inoculation for step 2 culture (3-HP production), only about 56 g / L of 3-HP was produced in the comparative example culture method. As in Example 2, a small amount of glucose was added to maintain ATP balance, resulting in the production of 85 g / L of 3-HP, thus confirming an increase in 3-HP production of more than 1.5 times (approximately 52% increase in 3-HP yield) compared to the comparative example. When dissolved oxygen was maintained at a certain level to activate the electron transport system as in Example 3, 95 g / L of 3-HP was produced by the culture method (approximately 70% increase in 3-HP yield). Therefore, it has been experimentally demonstrated that the production rate of 3-HP can be improved by applying the 3-HP production method provided by this invention.
[0125] Example 5. Comparison of 3-HP yield with glucose addition in step 1 and step 2 cultures.
[0126] The 3-HP yield was compared with that of step 1 culture with added glucose when DO exceeded 20%, as in Example 2, and that of step 1 culture with added glucose (Comparative Example 2).
[0127] Comparative Example 2 was prepared as follows: First, cell growth and 3HP production were carried out simultaneously by adding glucose and glycerol, the substrate required for cell growth, to the culture medium at the same time. The recombinant strain prepared in Example 1 was used, and the same steps as in Preparation Example 1-1 were performed except for the simultaneous addition of glucose and glycerol (glucose was added in batches during culture, and glycerol was added immediately afterward). When all the initially added glucose was consumed, an additional 1 g / L of glucose was added each time the pH reached above 7.0, and glycerol was added twice, at 20 and 48 hours of culture, each time at 70 g / L.
[0128] The culture conditions for Comparative Example 2 were: temperature 35°C, pH maintained at 6.95 using ammonia, stirring speed 500 rpm, and air input of 1 vvm.
[0129] The 3-HP yield (g / L) and productivity (g / L / h) of the step 2 culture (Example 2) or step 1 culture (Comparative Example 2) in Example 2 and Comparative Example 2 were measured and are shown in Table 2 below:
[0130] [Table 2]
[0131] Fermentation methods 3-HP yield (g / L) Productivity (g / L / h) Step 1 + Add glucose 56 1.5 Step 2 + Add glucose 80 2.1
[0132] (The results in Table 2 are the measurement results for step 2 culture (production step) of 38 hours in Example 2 and step 1 culture of 48 hours in Comparative Example 2, respectively.)
[0133] As shown in Table 2, in the case of Example 2, the yield and productivity of 3-HP were improved compared to Comparative Example 2. This result demonstrates that the addition of glucose during the cultivation step 2 had a significantly greater effect on increasing the yield of 3-HP.
[0134] Example 6. Comparison of impurity formation in cultures
[0135] The contents of impurities (acetate, lactate, PDO (1,3-propanediol) and residual glycerol) in the cultures obtained in Example 2 (Step 2 culture + glucose addition) and Example 3 (Step 3 culture + DO control) were measured and compared with the case of producing 3-HP by performing only Preparation Example 1-1 (Step 1 production).
[0136] The results are shown in Table 3 below:
[0137] [Table 3]
[0138]
[0139]
[0140] (The results in Table 3 are the results measured in Example 2 and Example 3 respectively, during 38 hours of cultivation (production step) in step 2 and 48 hours of cultivation in step 1.)
[0141] As shown in Table 3, in the cases of Examples 2 and 3, compared with the yield of Step 1, it can be confirmed that the content of impurities such as acetate, lactate, PDO and residual glycerol is significantly lower or absent.
Claims
1. A method for producing 3-hydroxypropionic acid (3-HP), comprising: (a) Escherichia coli cells with 3-hydroxypropionic acid (3-HP) production capacity were cultured at high concentrations in a growth medium; (b) Isolating cultured cells from the growth medium; (1) Isolated Escherichia coli cells capable of producing 3-hydroxypropionic acid (3-HP) were inoculated into a production medium that did not contain glucose as a carbon source; and (2) Production of 3-HP by culturing inoculated cells, The production culture medium contains glycerol as a carbon source. In step (2) of 3-HP production, the cell number at the end of production is 70% to 150% of the cell number at the time of inoculation, and The culture was carried out under the condition that glucose was added to a concentration of 0.1 g / L to 1.0 g / L when the dissolved oxygen in the culture medium was above 20%.
2. The method according to claim 1, wherein, Dissolved oxygen in condition (i) is maintained by adjusting the stirring speed.
3. The method according to claim 1, wherein, The cells with 3-HP production capacity contain a gene encoding at least one protein selected from glycerol dehydratase and aldehyde dehydrogenase.
4. The method according to claim 1, wherein, The growth medium does not contain glycerol as a carbon source.
5. The method according to claim 1, wherein the cell concentration measured by OD600 value after the high-concentration culture is 50 or higher.
6. A culture of a strain producing 3-hydroxypropionic acid (3-HP) obtained by the method of any one of claims 1 to 2, comprising 3-hydroxypropionic acid at a concentration of 60 g / L or higher, and It has one or more of the following characteristics: Acetate concentration below 0.2% w / v, and The lactate concentration is below 0.1% w / v.
7. The culture according to claim 6, further comprising one or more characteristics selected from the following: 1,3-Propanediol (PDO) concentration below 0.2% w / v, and The glycerol concentration is below 0.3% w / v.
8. A composition for producing 3-hydroxypropionic acid, comprising the culture of claim 6 or claim 7.