Carp herpesvirus type II DNA vaccine and preparation method and application thereof

Abstract

The present application relates to the technical field of biological medicine, and particularly relates to a DNA vaccine for carp herpesvirus type II, a preparation method and application thereof. The present application provides a DNA vaccine for carp herpesvirus type II, which comprises a carrier and a nucleic acid molecule of an ORF66 gene, wherein the nucleic acid sequence of the ORF66 gene is shown as SEQ ID NO:1, and the carrier is pVAX1. The DNA vaccine for carp herpesvirus type II prepared by the present application is safer and more reliable, has good immunoprotective property, can inhibit the infection of carp herpesvirus type II on crucian carp, and reduce the economic loss caused by diseases in the process of crucian carp breeding.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to a carp herpesvirus type II DNA vaccine, its preparation method, and its application. Background Technology

[0002] Crucian carp (Carassiu sauratus) is one of the important freshwater aquaculture species in my country. Crucian carp herpesvirus disease (also known as crucian carp hematopoietic organ necrosis disease), caused by cyprinid herpesvirus 2 (CyHV-2), has become a serious threat to the healthy development of crucian carp aquaculture in my country. Cyprinid herpesvirus 2 can infect crucian carp and its variants, typically causing disease at water temperatures of 15–25℃. It is prevalent in many countries and regions worldwide, with a mortality rate as high as 90%. In recent years, large-scale deaths of hybrid silver crucian carp caused by CyHV-2 infection have occurred successively in Jiangsu, Beijing, Guangzhou, Wuhan, and other places in my country, causing significant economic losses. Immunization is an effective way to prevent the occurrence of aquatic animal diseases and ensure the sustainable development of aquaculture. However, there are currently no effective commercial vaccines or treatments for CyHV-2. Therefore, the development of a safe and effective protective vaccine against cyprinid herpesvirus 2 is of great significance for controlling the outbreak and spread of crucian carp herpesvirus disease.

[0003] DNA vaccines, also known as nucleic acid vaccines or gene vaccines, involve introducing plasmid DNA containing the gene sequence encoding a protective antigen protein and the necessary regulatory elements for its expression into animal tissues. The host cells then take up, express, process, and present this DNA to the immune system, inducing specific humoral and cellular immune responses and providing immune protection against the antigen. DNA vaccines are relatively simple to produce, inexpensive, easy to transport and store, do not exhibit virulence reversion, and offer diverse immunization routes, making them promising for widespread application.

[0004] Expression vectors used to construct DNA vaccines must possess both safety and efficacy; that is, the expression vector must not integrate into the host cell's genome, and the antigen gene it carries must be expressed in adequate amounts within animal cells to elicit an immune response in the host. Commonly used plasmid vectors for fish DNA vaccines include pcDNA3.1(+), pET-32a, and pEGFP-N1. The pVAX1 vector is the only plasmid vector recommended by the U.S. Food and Drug Administration (FDA) for use in human trials. It has the following advantages: First, it retains only the most basic eukaryotic DNA sequence, minimizing the possibility of chromosomal integration. Second, because ampicillin can induce allergic reactions in some organisms, it uses a kanamycin resistance selection gene as an alternative, minimizing the possibility of recombination between the resistance selection gene and the human genome. Based on this, the use of pVAX1 vectors to construct nucleic acid vaccines in mammals is relatively widespread. However, reports on the application of pVAX1 vectors in the development of fish DNA vaccines are currently rare.

[0005] Our laboratory previously expressed the ORF66 protein in prokaryotes and prepared its specific polyclonal antibody, finding that the ORF66 protein exhibited good immunogenicity. This invention is the first to construct the ORF66 protein encoding gene into the pVAX1 eukaryotic expression vector, preparing a carp herpesvirus type II DNA vaccine. This invention provides a method for preparing a carp herpesvirus type II DNA vaccine and has tested its practical application effectiveness. Summary of the Invention

[0006] In view of the above-mentioned deficiencies of the prior art, the technical problem to be solved by the present invention is how to prevent crucian carp from suffering from crucian carp herpesvirus disease.

[0007] To achieve the above objectives, the present invention provides a carp herpesvirus type II DNA vaccine comprising a vector and a nucleic acid molecule containing the ORF66 gene.

[0008] Preferably, the nucleic acid sequence of the ORF66 gene is shown in SEQ ID NO:1.

[0009] Preferably, the carrier is pVAX1.

[0010] In a preferred embodiment of the present invention, a method for preparing a carp herpesvirus type II DNA vaccine is provided, which includes the following steps: using CyHV-2 DNA as a template, performing PCR amplification using pVAX-ORF66-F / pVAX-ORF66-R as primers, ligating the PCR amplification product with pVAX1, and constructing a plasmid vector vaccine.

[0011] The pVAX-ORF66-F is shown in SEQ ID NO:2.

[0012] The pVAX-ORF66-R is shown in SEQ ID NO:3.

[0013] Specifically, a method for preparing a carp herpesvirus type II DNA vaccine includes the following steps:

[0014] (3) Viral DNA was extracted from CyHV-2 infected tissue using a viral DNA extraction kit. Using it as a template, PCR amplification was performed with pVAX-ORF66-F / pVAX-ORF66-R as primers to obtain PCR amplification products.

[0015] (4) The PCR amplification product described in (1) was purified and recovered by gel cutting using a DNA gel recovery kit. Then, the recovered fragments and pVAX1 vector were digested with Hind III and Bam HI restriction endonucleases at 37°C for 3 hours. The digested fragments were purified and recovered. They were ligated overnight at 16°C using T4 DNA ligase. The ligation product was transformed into DH5α Escherichia coli competent cells. Positive clones were screened by bacterial PCR and bidirectional sequencing was performed. The recombinant plasmid with correct sequencing was pVAX-ORF66.

[0016] Preferably, the PCR reaction system is as follows: ddH2O 30.5 μL, 10×LA Buffer II (Mg 2+ 5 μL of dNTP Mixture (2.5 mmol / L), 8 μL of forward and reverse primers (10 μmol / L), 2 μL each of LA Taq Polymerase (5 U / μL), and 2 μL of DNA template, for a total volume of 50 μL.

[0017] Preferably, the PCR reaction conditions are: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 2 min, for a total of 35 cycles; 72℃ extension for 10 min; and 4℃ incubation.

[0018] In another preferred embodiment of the present invention, a pharmaceutical composition comprising a carp herpesvirus type II DNA vaccine is provided.

[0019] In another preferred embodiment of the present invention, the present invention provides the application of a carp herpesvirus type II DNA vaccine in the preparation of a drug for treating crucian carp herpesvirus disease.

[0020] The carp herpesvirus type II DNA vaccine prepared by this invention is safer and more reliable, has good immune protection, can inhibit the infection of crucian carp by carp herpesvirus type II, and reduce economic losses caused by diseases in crucian carp farming.

[0021] The following will further explain the concept, specific structure, and technical effects of the present invention in conjunction with the accompanying drawings, so as to fully understand the purpose, features, and effects of the present invention. Attached Figure Description

[0022] Figure 1 This is a schematic diagram of the amplification results of the coding region of the ORF66 gene of carp herpesvirus type II according to a preferred embodiment of the present invention;

[0023] Figure 2 This is a schematic diagram showing the results of double digestion of the recombinant plasmid pVAX-ORF66 with restriction endonucleases according to a preferred embodiment of the present invention.

[0024] Figure 3 This is a schematic diagram illustrating the results of detecting ORF66 protein overexpression in cells using indirect immunofluorescence assay, according to a preferred embodiment of the present invention.

[0025] Figure 4 This is a schematic diagram illustrating the results of RT-PCR detection of ORF66 transcriptional expression in crucian carp, according to a preferred embodiment of the present invention.

[0026] Figure 5 This is a schematic diagram illustrating the results of detecting ORF66 protein expression in crucian carp using Western blotting, according to a preferred embodiment of the present invention.

[0027] Figure 6 This is a survival rate curve of different experimental groups after challenge with the virus, according to a preferred embodiment of the present invention;

[0028] Figure 7 This is a schematic diagram of the structure of the pVAX1 empty carrier, which is an application of a preferred embodiment of the present invention.

[0029] Figure 8 This is a schematic diagram of the structure of the recombinant plasmid pVAX-ORF66 prepared according to a preferred embodiment of the present invention. Detailed Implementation

[0030] The following describes several preferred embodiments of the present invention to make its technical content clearer and easier to understand. The present invention can be embodied in many different forms, and the scope of protection of the present invention is not limited to the embodiments mentioned herein.

[0031] (1) Amplification of CyHV-2ORF66 gene

[0032] First, using Primer Express 5.0 and BioEdit 7.0 software, primers pVAX-ORF66-F (SEQ ID NO:2) and pVAX-ORF66-R (SEQ ID NO:3) were designed based on the conserved region of the CyHV-2ORF66 gene sequence in GenBank, and restriction endonuclease sites were introduced (marked in italics and underline). The primer sequences are as follows:

[0033] pVAX-ORF66-F: ATTAAGCTTGCCACCATGACCTCCCTCCAGCAAGCTA;

[0034] pVAX-ORF66-R: CCGGGATCCTTAATAAATCATGAGATCGTCTAGGTCGTG.

[0035] Viral DNA was extracted from CyHV-2-infected tissues using a viral DNA extraction kit (purchased from TaKaRa). This DNA was then used as a template for PCR amplification. The PCR reaction mixture consisted of 30.5 μL ddH2O and 10×LA Buffer II (Mg2+). 2+ 5 μL of dNTP Mixture (2.5 mmol / L), 8 μL of forward and reverse primers (10 μmol / L), 2 μL each of LA Taq Polymerase (5 U / μL), and 2 μL of DNA template, for a total volume of 50 μL.

[0036] The PCR reaction conditions were as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 2 min, for a total of 35 cycles; 72℃ extension for 10 min; and incubation at 4℃.

[0037] The PCR amplification products were analyzed by 1% agarose gel electrophoresis, and the amplification results are as follows: Figure 1 As shown.

[0038] (2) Construction of recombinant plasmid pVAX-ORF66

[0039] The PCR product described in (1) was purified and recovered by gel extraction using a DNA gel extraction kit. Then, the recovered fragment and pVAX1 vector (purchased from Invitrogen, chromatogram shown) were extracted separately. Figure 7(As shown) The recombinant plasmid was digested with Hind III and Bam HI restriction endonucleases at 37°C for 3 hours. The digested fragments were purified and recovered, and ligated overnight at 16°C using T4 DNA ligase. The ligation product was transformed into DH5α competent E. coli cells. Positive clones were screened by colony PCR and sent to Sangon Biotech (Shanghai) Co., Ltd. for bidirectional sequencing. The recombinant plasmid with correct sequencing was named pVAX-ORF66 (as shown in the image). Figure 8 (As shown).

[0040] (3) Large-scale preparation of recombinant plasmid pVAX-ORF66 and empty vector pVAX1

[0041] 50 μL of correctly sequenced single-clone bacterial culture was inoculated into 5 mL of LB liquid medium containing 50 μg / mL kanamycin and cultured at 37°C and 220 rpm for 8 h on a shaker. 200 μL of the bacterial culture was then inoculated into 200 mL of LB liquid medium containing 50 μg / mL kanamycin and cultured overnight at 37°C and 220 rpm on a shaker. The recombinant plasmid pVAX-ORF66 and the empty vector plasmid pVAX1 were extracted using a plasmid extraction kit (purchased from GeneBio International Trading (Shanghai) Co., Ltd.). The specific steps are as follows:

[0042] Place the overnight cultured bacterial solution into a 50mL centrifuge tube, centrifuge at 4℃ and 6000×g for 10min to collect the bacterial cells, discard the supernatant, and repeat the above operation until all bacterial solutions have been centrifuged.

[0043] Add 16 mL of RES to the bacterial precipitate and suspend it thoroughly;

[0044] Add 16 mL of Buffer LYS, mix by inverting the container, and let stand at room temperature for 5 min;

[0045] During this process, add 12 mL of Buffer EQU to equilibrate and wet the filter and centrifuge column;

[0046] Add 16 mL of Buffer NEU to the lysate, and immediately invert to mix until colorless;

[0047] Transfer the pyrolysis product to a filter and allow it to be completely filtered out under gravity. Discard the filtrate.

[0048] Add 5 mL of Buffer EQU along the edge of the filter and wash once, then discard the filtrate;

[0049] Remove the filter, add 8 mL of Buffer Wash to the centrifuge column, and discard the filtrate;

[0050] Add 5 mL of Buffer ELU to the centrifuge column and collect the eluent in a 15 mL centrifuge tube;

[0051] Add 3.5 mL of isopropanol, vortex, centrifuge at 4°C and 10000×g for 30 min, and discard the supernatant;

[0052] Add 2 mL of 70% ethanol to wash once, centrifuge at 10000×g for 5 min at 4℃, and discard the supernatant;

[0053] Air dry at room temperature for 10-15 minutes;

[0054] Dissolve the plasmid in 0.8–1 mL of TE buffer and determine the plasmid concentration using a spectrophotometer.

[0055] (4) Double enzyme digestion identification of recombinant plasmid pVAX-ORF66

[0056] The pVAX-ORF66 recombinant plasmid was digested with Hind III and Bam HI restriction endonucleases at 37°C for 3 hours. Gel electrophoresis showed that the recombinant plasmid yielded specific fragments of approximately 3000 bp and 1200 bp in size, respectively, after digestion (results are shown in the figure). Figure 2 As shown in the figure, the size is consistent with the target fragment, further indicating that the constructed recombinant plasmid reading frame is correct.

[0057] (5) GFB cells were transfected with recombinant plasmid pVAX-ORF66 and empty vector pVAX1.

[0058] The specific steps are as follows: One day before transfection, seed 24-well cell culture plates. On the second day, when the cell density reaches approximately 70%-90%, transfect the cells. Prepare the following mixture for each well during transfection:

[0059] Tube A: Dissolve 800 ng of DNA in 50 μL of Opti-MEM medium;

[0060] Tube B: Dissolve 2 μL of Lipofectamine 2000 (purchased from Invitrogen) in 50 μL of Opti-MEM medium, mix well, and let stand at room temperature for 5 min;

[0061] Then mix tubes A and B and incubate at room temperature for 20 minutes. During this time, wash the cells twice with Opti-MEM, add the mixture to the corresponding wells, mix gently, and incubate for 4-6 hours before replacing with complete culture medium containing 10% fetal bovine serum.

[0062] (6) Indirect immunofluorescence

[0063] After transfecting GFB cells with the recombinant plasmid pVAX-ORF66 and the empty vector pVAX1 for 36 h, the cells were washed twice with PBS for 3 min each time, and 400 μL of 4% paraformaldehyde was added to each well for fixation at room temperature for 30 min.

[0064] Remove the fixative, wash the cells three times with PBS, and add 400 μL of PBS containing 0.2% Triton X-100 to each well for permeation for 15 min;

[0065] Remove the permeabilization buffer, wash 3 times with PBS, add 4% bovine serum albumin blocking buffer, and block at 37°C for 2 hours.

[0066] Remove the blocking solution, add the primary antibody diluted with the blocking solution (rabbit anti-CyHV-2ORF66 protein antibody prepared in our laboratory, diluted at a volume ratio of 1:1000), and incubate at 37°C for 2 hours;

[0067] Remove the primary antibody, wash three times with PBS for 3 min each time, add fluorescent secondary antibody (Alexa Fluor 488 labeled donkey anti-rabbit, purchased from Invitrogen, diluted 1:2000 by volume), and incubate at 37°C for 1 h;

[0068] Remove the secondary antibody, wash three times with PBS for 3 min each time, add DAPI nuclear staining solution (purchased from Roche, diluted 1:2000 by volume), stain at room temperature for 10 min, wash three times with PBS for 3 min each time;

[0069] Add 500 μL of PBS to each well, observe and photograph under an inverted fluorescence microscope.

[0070] The results are as follows Figure 3 As shown in A and 3B, cells transfected with pVAX-ORF66 exhibited obvious green fluorescence, while cells transfected with the empty vector pVAX1 showed no obvious fluorescence signal.

[0071] (7) Immunoblotting assay

[0072] After transfecting GFB cells with the recombinant plasmid pVAX-ORF66 and the empty vector pVAX1 for 24 h, the supernatant was discarded, and the cells were washed twice with PBS for 3 min each time. RIPA lysis buffer (purchased from Beyotime Biotechnology Co., Ltd.) was added, and the cells were thoroughly contacted by pipetting. The cells were incubated on ice for 10 min. The cell lysis buffer was then transferred to a 1.5 mL EP tube, centrifuged at 12000×g for 5 min, and 20 μL of the centrifuged supernatant was mixed with 5 μL of 5× protein loading buffer. The mixture was boiled at 95 °C for 5 min and then subjected to SDS-PAGE gel electrophoresis.

[0073] Cut filter paper and PVDF membrane to perfectly match the size of the separating gel, and equilibrate them in transfer buffer for 15 min.

[0074] After gel electrophoresis, remove the gel interlayer and equilibrate the separating gel in an appropriate amount of transfer buffer for 10 minutes.

[0075] Assemble the transfer sandwich layer and transfer the protein at 20V for 40 minutes under constant voltage.

[0076] After the transfer is complete, remove the membrane, place it in a hybridization box, add 10 mL of 5% PBST-bovine serum albumin blocking solution, and incubate at 37°C for 2 hours.

[0077] Discard the blocking solution, add the CyHV-2ORF66 protein antibody prepared in our laboratory (diluted at a volume ratio of 1:1000), and incubate at 37°C for 2 hours;

[0078] Wash 3 times with PBST for 10 min each time, add HRP-labeled goat anti-rabbit IgG antibody (secondary antibody, purchased from Shanghai Yisheng Biotechnology Co., Ltd., diluted 1:5000 by volume), and incubate at 37°C for 1 h;

[0079] Discard the secondary antibody, wash three times with PBST, 10 min each time;

[0080] Add ECL chromogenic substrate (purchased from Tiangen Biotech (Beijing) Co., Ltd.), and the bands will develop color within 5-10 minutes.

[0081] Immunoblotting results as follows Figure 3 As shown in Figure C, the expression level of ORF66 protein was significantly increased in pVAX-ORF66 transfected cells, indicating that the DNA vaccine of the present invention can be expressed at a high level in eukaryotic cells.

[0082] (8) Transcription detection of recombinant plasmid pVAX-ORF66 in crucian carp

[0083] Before the experiment, the experimental crucian carp (about 10g) were temporarily kept in an aquarium with air for two weeks. 20μg of pVAX-ORF66 (dissolved in 100μL PBS) was injected into the base of their dorsal fins. At the same time, crucian carp injected with empty vector pVAX1 and PBS were set up as a control group.

[0084] Three days after immunization, total RNA was extracted from the injection sites of the experimental and control groups using the Trizol method. During the extraction process, DNase I (purchased from Invitrogen) was used to completely remove the interference of pVAX-ORF66.

[0085] Using total RNA that was free of pVAX-ORF66 contamination by PCR as a template, cDNA was synthesized using a reverse transcription kit (purchased from Invitrogen). The specific steps are as follows:

[0086] Add 1 μg of the extracted RNA, 1 μL of random hexamer primer, and RNase-free water to a PCR reaction tube to a total volume of 12 μL. Incubate at 65°C for 5 min, then immediately place on ice. Add 4 μL of 5×ReactionBuffer, 1 μL of RiboLock RNase Inhibitor, 2 μL of 10 mM dNTP Mix, and 1 μL of RevertAid M-MuLVRT. Incubate at 25°C for 5 min, then incubate at 42°C for 45 min to obtain cDNA.

[0087] PCR was used to detect the transcription of pVAX-ORF66 in fish. The amplification conditions were the same as in (1). The results are shown in Figure (4). The amplified fragment is consistent with the size of the ORF66 gene, indicating that pVAX-ORF66 can be transcribed normally in fish.

[0088] (9) Detection of protein expression of recombinant plasmid pVAX-ORF66 in crucian carp

[0089] Experimental crucian carp (approximately 10g) were temporarily kept in an aquarium for two weeks. 20μg of pVAX-ORF66 (dissolved in 100μL PBS) was injected into the base of their dorsal fins. At the same time, empty vector pVAX1 and PBS were injected as control groups.

[0090] Three days after immunization, muscle cells from the injection sites of the experimental and control groups were collected, and cells were lysed using RIPA lysis buffer. The cells were then centrifuged at 4°C, 13000×g for 5 minutes, and 20 μL of the supernatant was collected for immunoblotting, following the same procedure as described in (7). The results showed that a band with a molecular weight of approximately 45 kDa was present in the crucian carp tissue samples of the experimental group, consistent with the size of the ORF66 protein, while no such band was found in the control group. Figure 5 This indicates that pVAX-ORF66 can normally express ORF66 in fish.

[0091] (10) Immunoprotective effect of recombinant plasmid pVAX-ORF66

[0092] Experimental crucian carp (approximately 20g) were temporarily kept in an aquarium with air for two weeks. 20μg / fish of pVAX-ORF66 (dissolved in 100μL PBS) was injected into the base of their dorsal fins. At the same time, empty vector pVAX1 and PBS were injected as control groups.

[0093] Twenty-eight days after immunization, crucian carp in each group were challenged with 10⁶ TCID₅₀ / mL virus solution via intraperitoneal injection. The fish were observed for 42 consecutive days, with daily mortality recorded. Gills, livers, spleens, and kidneys of the dead fish were collected for CyHV-2 PCR detection, and the relative percentage survival (RPS) was calculated. RPS = [1 - (mortality rate in immunized groups / mortality rate in control groups)] × 100%. Results are as follows: Figure 6 As shown, the relative immune protection rate of the pVAX-ORF66 group reached 60%, which was significantly higher than that of the other two groups, indicating that the DNA vaccine prepared in this invention has a good immune protection effect and can be used as a nucleic acid vaccine against CyHV-2.

[0094] In this embodiment, the CyHV-2 nucleocapsid protein ORF66 was cloned into the eukaryotic expression vector pVAX1 using gene cloning technology. A series of experiments verified that the DNA vaccine of this invention has excellent immunoprotective properties, is low in cost, and has high safety, effectively inhibiting infection of crucian carp with carp herpesvirus type II. This DNA vaccine can significantly reduce economic losses caused by viral diseases in crucian carp farming, increase fishermen's income, reduce drug use, improve aquatic product quality, and protect the environment, demonstrating broad application prospects.

[0095] The preferred embodiments of the present invention have been described in detail above. It should be understood that those skilled in the art can make numerous modifications and variations based on the concept of the present invention without creative effort. Therefore, all technical solutions that can be obtained by those skilled in the art based on the concept of the present invention through logical analysis, reasoning, or limited experimentation on the basis of existing technology should be within the scope of protection defined by the claims.

Claims

1. A carp herpesvirus type II DNA vaccine, comprising a vector and a nucleic acid molecule of the ORF66 gene, wherein the nucleic acid sequence of the ORF66 gene is shown in SEQ ID NO:1, the vector is pVAX1, and the preparation method of the vaccine includes the following steps: Using CyHV-2 herpesvirus II DNA as a template, PCR amplification was performed using pVAX-ORF66-F and pVAX-ORF66-R as primers. The PCR amplification product was then ligated with pVAX1 to construct a plasmid vector vaccine. The pVAX-ORF66-F is shown in SEQ ID NO:

2. The pVAX-ORF66-R is shown in SEQ ID NO:

3.

2. The method for preparing the carp herpesvirus type II DNA vaccine according to claim 1, characterized in that, Includes the following steps: Using CyHV-2 herpesvirus II DNA as a template, PCR amplification was performed using pVAX-ORF66-F and pVAX-ORF66-R as primers. The PCR amplification product was then ligated with pVAX1 to construct a plasmid vector vaccine. The pVAX-ORF66-F is shown in SEQ ID NO:

2. The pVAX-ORF66-R is shown in SEQ ID NO:

3.

3. The method for preparing the carp herpesvirus type II DNA vaccine according to claim 2, characterized in that, Includes the following steps: Step 1: Viral DNA was extracted from CyHV-2 infected tissue using a viral DNA extraction kit. Using the extracted DNA as a template, PCR amplification was performed using pVAX-ORF66-F and pVAX-ORF66-R as primers to obtain the PCR amplification product. Step 2: The PCR amplification product described in Step 1 was purified and recovered by gel extraction using a DNA gel extraction kit. Then, the recovered fragments and pVAX1 vector were digested with Hind III and Bam HI restriction endonucleases at 37°C for 3 h, respectively. The digested fragments were purified and recovered, and ligated overnight at 16°C using T4 DNA ligase. The ligation product was transformed into DH5α Escherichia coli competent cells. Positive clones were screened by bacterial PCR and bidirectional sequencing was performed. The recombinant plasmid with correct sequencing was pVAX-ORF66. Step 3: Inoculate 50 μL of correctly sequenced single-clone bacterial culture into 5 mL of LB liquid medium containing 50 μg / mL kanamycin, and culture on a shaker at 37°C and 220 rpm for 8 h. Take 200 μL of bacterial culture and inoculate it into 200 mL of LB liquid medium containing 50 μg / mL kanamycin, and culture on a shaker at 37°C and 220 rpm overnight. Extract the recombinant plasmid pVAX-ORF66 using a plasmid extraction kit.

4. The method for preparing the carp herpesvirus type II DNA vaccine according to claim 3, characterized in that, The PCR reaction system is as follows: ddH2O 30.5 μL, with added Mg 2+ The total volume was 50 μL, consisting of 5 μL of 10 × LA Buffer II, 8 μL of 2.5 mmol / L dNTP mixture, 2 μL each of 10 μmol / L forward and reverse primers, 0.5 μL of 5 U / μL LA Taq polymerase, and 2 μL of DNA template.

5. The method for preparing the carp herpesvirus type II DNA vaccine according to claim 3, characterized in that, The PCR reaction conditions were as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 2 min, for a total of 35 cycles; 72℃ extension for 10 min; and incubation at 4℃.

6. A pharmaceutical composition comprising the carp herpesvirus type II DNA vaccine of claim 1.

7. The use of the carp herpesvirus type II DNA vaccine according to claim 1 in the preparation of drugs for the prevention of crucian carp herpesvirus disease.

Images