Peptides with anti-obesity and anti-diabetic effects and their uses

Abstract

This invention provides peptides with anti-obesity and / or anti-diabetic activity, composed of the amino acid sequence of Sequence 1 or Sequence 2. These peptides inhibit fat accumulation, reduce the size of adipocytes, and increase the expression of phosphorylated hormone-sensitive lipase, adenosine monophosphate-activated protein kinase-α1, and comparative gene recognition-58 (CGM-58), which are lipolysis factors, thereby breaking down accumulated fat. This not only exhibits excellent anti-obesity effects but also effectively reduces blood glucose levels, increasing the expression of adiponectin and adenosine monophosphate-activated protein kinase (CGM-58), which improve insulin resistance; increasing the expression of glucose transporter protein 4 (a glucose transport channel); and increasing the expression of insulin receptor substrate-1 (an insulin receptor signaling protein), thus exhibiting excellent effects against diabetes. The peptides of this invention can be effectively used in the prevention or treatment of obesity and / or diabetes.

Description

[0001] This application is a divisional application of the same invention patent application 201780018993.7, filed on March 17, 2017. [Technical Field]

[0002] The present invention relates to a peptide having anti-obesity and / or anti-diabetic activity composed of an amino acid sequence of sequence 1 or sequence 2, a pharmaceutical composition for the prevention and / or treatment of obesity and / or diabetes comprising one or more of the peptides selected as active ingredients, and the peptides mentioned above. [Background Technology]

[0003] Currently, due to economic development and the Westernization of dietary habits, South Korea is experiencing an increase in fat intake from food, coupled with insufficient physical activity, leading to a rise in metabolic diseases such as obesity, diabetes, hyperlipidemia, hypertension, arteriosclerosis, and fatty liver. Furthermore, obesity not only negatively impacts young people who prefer a lean physique, but also contributes to various health problems due to its persistence.

[0004] Currently, medications for treating obesity can be broadly categorized into those that act on the central nervous system to affect appetite and those that act on the gastrointestinal tract to inhibit absorption. Based on their mechanisms of action, commercially available drugs that act on the central nervous system include those that inhibit the serotonin (5-HT) nervous system such as fluphenazine and dexfenfluramine; those that act on the norepinephrine nervous system such as ephedrine and caffeine; and more recently, drugs that simultaneously act on both the serotonin and norepinephrine nervous systems to inhibit obesity.

[0005] Furthermore, representative drugs that act on the gastrointestinal tract to suppress obesity include orlistat, which is an authorized obesity treatment agent that reduces fat absorption by inhibiting intestinal lipase. However, among previously used drugs, some, such as fluphenazine, have recently been banned due to side effects such as causing primary pulmonary hypertension or valvular heart disease. Other drugs may cause problems such as hypotension or lactic acidosis, thus making them unsuitable for patients with heart failure, kidney disease, etc.

[0006] Diabetes mellitus is a metabolic disease caused by insufficient insulin secretion or its inability to function properly (DeFronzo, 1988). Diabetes is characterized by hyperglycemia, which increases the concentration of glucose in the blood. This hyperglycemia leads to various symptoms and signs, and glucose is excreted in the urine. Recently, due to the increasing rate of obesity, especially abdominal obesity, there has been a sharp increase in the incidence of diabetes mellitus.

[0007] In 2000, there were 170 million people with diabetes worldwide. This number was projected to reach 370 million by 2030. However, recent analysis indicates that the number had already reached 350 million in 2008 (Danaei et al., 2011), suggesting the spread of diabetes is more severe than expected. Reports indicate that over 80% of type 2 diabetes patients are obese, and less than 10% of obese patients have diabetes (Harris et al., 1987). This correlation between diabetes and obesity is due to the irregular secretion of adipokines and free fatty acids. Fatty acids accumulate in β-cells or insulin-sensitive tissues such as the kidneys, liver, and heart, resulting in lipotoxicity. If chronic hyperglycemia is not properly treated, it can lead to various health problems. Effective blood glucose management is essential to prevent representative complications such as retinopathy, kidney failure, neuropathy, and vascular disorders.

[0008] Currently, methods for regulating blood sugar include lifestyle modifications (dietary therapy, exercise therapy) and medication. However, diet therapy and exercise therapy are difficult to strictly manage and implement, and their effectiveness is limited. Therefore, most diabetic patients adjust their lifestyle and rely on the blood sugar regulation effects of medications such as insulin, insulin secretion stimulants, insulin sensitivity improvers, and hypoglycemic agents.

[0009] Insulin produced through recombinant methods is an essential drug for patients with type 1 diabetes and type 2 diabetes who cannot regulate their blood sugar. While these drugs are beneficial for blood sugar regulation, they also have drawbacks such as aversion to needles, difficulty in administration, risk of hypoglycemia, and weight gain.

[0010] Chloranilic acids, as insulin secretagogues, are fast-acting preparations taken before meals. Examples of insulin secretagogues include NovoLog (repaglinide), Fastic (nateglinide), and Glufast (miglitinide). However, when taken alone, insulin sensitivity modifiers are characterized by almost no hypoglycemia. Examples of insulin sensitivity modifiers include metformin (a biguanide) and thiazolidinediones such as Avaneda (rosiglitazone) and Actoc (piglitazone).

[0011] Recently developed drugs include glucagon-like peptide-1 (GLP-1) agonists, which utilize the action of GLP-1, a hormone that promotes insulin secretion. Examples of GLP-1 agonists include exenatide and liraglutide. Furthermore, dipeptidyl peptidase-4 inhibitors, which inhibit the action of dipeptidyl peptidase-4 (DPP-4), an enzyme that inerts GLP-1, are also recently developed drugs, with Januvia (ingredient name: sitagliptin) being a representative example.

[0012] However, the aforementioned drugs have side effects such as hepatotoxicity, gastrointestinal disorders, cardiovascular disease, and carcinogenicity, and the annual treatment cost is extremely high, making it difficult to treat diabetes with these dipeptidyl peptidase-4 inhibitors. In fact, based on 2007 data, the cost of prediabetes and diabetes-related conditions in the United States alone was close to approximately $20 billion (Dallet et al., 2010), and based on 2008 data, the cost of obesity-related conditions in the United States alone was close to $15 billion (Finkelstein et al., 2009). Therefore, there is a need to develop drugs that can treat both diabetes and obesity-related diabetes simultaneously by reducing weight and effectively lowering blood sugar, with fewer side effects.

[0013] Firstly, in order to find further ways to improve the treatment of obesity, recent focus has been on methods to regulate energy metabolism. Under the premise that the compounds in this sequence have higher stability (low toxicity), studies were conducted on signals that lead to fat accumulation and proteins that affect fat accumulation when a person consumes a high-fat diet. The expression of these fat-accumulating proteins was inhibited, and studies were conducted to promote fat breakdown through research on signals and related proteins that break down accumulated fat, leading to the development of peptides. Furthermore, the peptides of this invention exhibit remarkable efficacy against diabetes caused by diabetes and obesity. Fat accumulation caused by a high-fat diet, inhibition of insulin signals resulting from fat accumulation in the liver or muscles, and the resulting insulin resistance are causes of diabetes. The various peptides and complexes of this invention are effective in treating the aforementioned diabetes and obesity-related diabetes. [Summary of the Invention]

[0014] [The problem to be solved]

[0015] The inventors have worked to develop several excellent peptides with biologically effective activity. As a result, it has been found that peptides composed of the amino acid sequences of sequence 1 or sequence 2 inhibit fat accumulation induced by a high-fat diet and break down accumulated fat, thus exhibiting not only an anti-obesity effect but also an excellent blood sugar-lowering effect, thereby completing this invention.

[0016] Therefore, the object of the present invention is to provide a peptide having anti-obesity and / or anti-diabetic activity, consisting of an amino acid sequence of sequence 1 or sequence 2.

[0017] Another object of the present invention is to provide a pharmaceutical composition for the prevention and / or treatment of obesity comprising one or more peptides selected from amino acid sequences of sequence 1 and sequence 2.

[0018] Another object of the present invention is to provide a pharmaceutical composition for the prevention and / or treatment of diabetes comprising one or more peptides selected from amino acid sequences of sequence 1 and sequence 2.

[0019] Solution to the problem

[0020] One embodiment of the present invention relates to a peptide having anti-obesity and / or anti-diabetic activity, consisting of an amino acid sequence of sequence 1 or sequence 2.

[0021] The inventors have worked to develop several excellent peptides with biologically effective activity. As a result, it has been found that peptides composed of amino acid sequences of sequence 1 or sequence 2 inhibit fat accumulation induced by a high-fat diet and break down accumulated fat, thus exhibiting not only an anti-obesity effect, but also an excellent blood sugar-lowering effect.

[0022] The peptides of the present invention may comprise an amino acid sequence of sequence 1 or sequence 2, for example, a peptide composed of an amino acid sequence of sequence 1 or sequence 2.

[0023] The aforementioned peptides exhibit excellent anti-obesity effects by inhibiting fat accumulation, reducing the size of adipocytes, and increasing the expression of phosphorylated hormone-sensitive lipase, adenosine monophosphate-activated protein kinase-α1, and comparative gene recognition-58, which are fat-decomposing factors.

[0024] As used in this manual, the term "obesity" refers to the excessive accumulation of body fat.

[0025] The aforementioned peptides reduce fat accumulation within adipocytes and decrease differentiation into adipocytes.

[0026] The aforementioned peptides increase lipolysis. The lipolytic effect of the peptides of the present invention is achieved by increasing the expression of phosphorylated hormone-sensitive lipase (pHSL), which acts as a lipolytic enzyme, and Comparative Gene Identification-58 (CGI-58), which acts as a lipolytic factor.

[0027] The aforementioned peptides exhibit anti-obesity activity by breaking down stored neutral fats into fatty acids and glycerol through regulating the expression of hormone-sensitive lipase (HSL) genes.

[0028] As illustrated in the following examples, when the above-described peptides are processed, neutral fats stored in adipocytes are hydrolyzed into free fatty acids and glycerol and released. This result demonstrates that the peptides of the present invention hydrolyze neutral fats stored in adipocytes into free fatty acids and glycerol, releasing them extracellularly.

[0029] Furthermore, by processing the aforementioned peptides, the content of neutral fat within adipocytes decreases, while the secretion of glycerol, a neutral fat breakdown product, increases to the outside of adipocytes.

[0030] Furthermore, by processing the aforementioned peptides, the gene markers of hormone-sensitive lipases, enzymes that break down neutral fats into free fatty acids and glycerol in adipose tissue, are increased.

[0031] Therefore, these results demonstrate that the peptides of the present invention exhibit an anti-obesity effect through lipolysis caused by increased expression of hormone-sensitive lipase genes in adipose tissue.

[0032] Peptides composed of amino acid sequences of sequence 1 or sequence 2 effectively reduce blood glucose and increase the expression of adiponectin and adenosine monophosphate activated protein kinase (AMPK), which improve insulin resistance. They also increase the expression of glucose transporter 4 (GLUT4), which acts as a glucose transport channel, and the expression of insulin receptor substrate-1 (IRS-1), which acts as an insulin receptor signaling protein, thus exhibiting excellent anti-diabetic effects.

[0033] As used herein, the term "diabetes" refers to a chronic disease characterized by relative or absolute insufficiency of glucose, leading to glucose inolerance. Preferably, the diabetes of the present invention is type 2 diabetes. Type 2 diabetes, as a non-independent form of diabetes, is caused by insufficient postprandial insulin secretion or by insulin resistance.

[0034] The aforementioned peptides increase adiponectin expression under conditions of insulin resistance. In the presence of insulin resistance, blood adiponectin levels are reduced; however, if insulin resistance is improved by administration of drugs that increase insulin sensitivity, adiponectin levels increase (Diabetes Vol. 31, No. 6, 2007, Characteristics of blood adiponectin in newly diagnosed type 2 diabetes patients). In other words, the peptides of the present invention, which increase adiponectin under conditions of insulin resistance, exhibit an effect of improving insulin resistance, and therefore present preventive or therapeutic effects against diabetes.

[0035] Furthermore, the aforementioned peptides increased the expression of glucose transporter 4 (GULT4) under insulin-resistant conditions. GULT4, as an insulin transport channel, moves towards the plasma membrane upon receiving insulin-based stimulation, facilitating glucose transport. Therefore, GULT4 lowers blood glucose levels by smoothly channeling glucose from the blood into cells. In other words, the greater the activity and expression of GULT4, which participates in glucose transport, the greater the anti-diabetic effect.

[0036] Furthermore, the aforementioned peptides increase the expression of insulin receptor substrate-1 under insulin resistance conditions. Insulin receptor substrates 1 and 2, as insulin matrix proteins, can induce glucose transport via Akt and other mediators when p85 binds to them.

[0037] Furthermore, the aforementioned peptides increased the expression of adenosine monophosphate-activated protein kinase-α1 under insulin-resistant conditions.

[0038] Adenosine-activated protein kinases (AMP-activated / SNF1 protein kinases) act as sensors for maintaining intracellular energy homeostasis. Under metabolic stress or reduced energy in motor cells, they are activated to inhibit the consumption of adenosine triphosphate (AT) (e.g., fatty acid synthesis and cholesterol synthesis) and promote the production of adenosine triphosphate (AT) (e.g., fatty acid oxidation and related processes (Hardie DG: AMP-activated / SNF1 protein kinases: conserved guardians of cellular energy. Nat Rev MolCellBiol 8: 774-785, 2007).

[0039] Effects associated with activation of adenosine monophosphate-activated protein kinase are related to target organs (liver, muscle, fat, pancreas) closely involved in energy metabolism regulation (Zhang BB, Zhou G, Li C: AMPK: an emerging drug target for diabetes and the metabolic syndrome. CellMetab 9: 407-416, 2009).

[0040] In the liver, activation of adenosine monophosphate (AMP) inhibits the synthesis of fatty acids and cholesterol and promotes fatty acid oxidation. In skeletal muscle, activation of AMP promotes fatty acid oxidation and glucose uptake, and inhibits lipolysis and lipogenesis in adipocytes. Furthermore, activation and increased expression of AMP induce a decrease in blood glucose by inhibiting hepatic glucose production (Foretz M, et al., Diabetes 54: 1331-1339, 2005; Lochhead PA, et al., Diabetes 49: 896-903, 2000).

[0041] As used in this specification, the term "peptide" refers to a linear molecule formed by the combination of amino acid residues via peptide bonds.

[0042] In this specification, the term "peptide" refers to a linear molecule formed by the combination of amino acid residues linked together by peptide bonds. The peptides of this invention can be prepared by chemical synthesis methods known in the art, particularly by solid-phase synthesis techniques (Merrifield, J. Amer. Chem. Soc. 85: 2149-54 (1963); Stewart, et al., Solid Phase Peptide Synthesis, 2nd ed., Pierce Chem. Co.: Rockford, 111 (1984)) or liquid-phase synthesis techniques (US Patent No. 5516891).

[0043] As part of the selected amino acid sequence of the peptide of the present invention, in order to increase its activity, the N-terminus and / or C-terminus of the peptide may be induced to deform.

[0044] For example, the above-mentioned C-terminal deformation can be the C-terminus of a peptide deformed into hydroxyl (-OH), amino (-NH2), azide compound (-NHNH2), etc., but is not limited to this.

[0045] Furthermore, the aforementioned N-terminal modification can be that the N-terminus of the peptide is bound with one or more protecting groups selected from acetyl, fluorenylmethoxycarbonyl, formyl, palmitoyl, myristyl, stearoyl, and polyethylene glycol (PEG), but is not limited thereto. These protecting groups serve to protect the peptide of the present invention from attack by protein-cleaving enzymes in vivo.

[0046] The N-terminal and / or C-terminal deformation of the above-mentioned peptides greatly improves the stability of the peptides. Through this deformation, the peptides of the present invention can increase the half-life when administered in vivo, thereby having a high half-life.

[0047] The aforementioned peptide modification significantly improves the stability of the peptides of the present invention. In this specification, the term "stability" refers not only to in vivo stability but also to storage stability (e.g., room temperature storage stability). The aforementioned protecting groups protect the peptides of the present invention from attack by protein-cleaving enzymes in vivo.

[0048] Another embodiment of the present invention relates to a pharmaceutical composition for the prevention and / or treatment of obesity, comprising one or more peptides selected from amino acid sequences of sequence 1 and sequence 2 as an active ingredient.

[0049] The aforementioned peptides inhibit lipogenesis and have excellent lipid-degrading functions, thus they can be used for the prevention and / or treatment of obesity.

[0050] The pharmaceutical composition described above may be (a) a pharmaceutically effective amount of the peptide or peptide complex described above; and (b) a pharmaceutical composition comprising a pharmaceutically acceptable carrier.

[0051] In this specification, the term "pharmaceutical effective amount" means the amount sufficient to achieve the efficacy or activity of the peptide described above.

[0052] The pharmaceutically acceptable carriers contained in the pharmaceutical compositions of the present invention are substances commonly used as formulations, including, but not limited to, lactose, glucose, sucrose, sorbitol, mannitol, starch, gum arabic, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methylparaben, propylparaben, talc, magnesium stearate, and / or mineral oil.

[0053] In addition to the above-mentioned components, the pharmaceutical composition of the present invention may also include lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents and preservatives, but is not limited thereto.

[0054] Remington's Pharmaceutical Sciences (19th ed., 1995) provides detailed information on suitable pharmaceutically acceptable carriers and formulations.

[0055] The pharmaceutical composition of the present invention can be administered orally or non-orally, preferably non-orally, and in the case of non-oral administration, it can be administered by intramuscular injection, intravenous injection, subcutaneous injection, intraperitoneal injection, local injection, transdermal administration, etc.

[0056] The appropriate dosage of the pharmaceutical composition of the present invention can be prescribed differently depending on factors such as formulation method, administration route, patient's age, weight, gender, pathological state, diet, administration time, route of administration, excretion rate, and reactivity. On the other hand, the preferred dosage of the pharmaceutical composition of the present invention is 0.001 μg to 1000 μg per day.

[0057] The pharmaceutical compositions of the present invention can be formulated by means of a method readily practiced by those skilled in the art, using pharmaceutically acceptable carriers and / or excipients, thereby enabling preparation in a unit volume form or incorporation into multi-volume containers.

[0058] At this time, the dosage form is in the form of a solution, suspension and / or emulsion in an oil or aqueous medium, or it may be in the form of an extract, powder, granule, tablet and / or capsule, and may also contain dispersants and / or stabilizers, but is not limited thereto.

[0059] Another embodiment of the present invention relates to a pharmaceutical composition for the prevention and / or treatment of diabetes comprising one or more peptides selected from a peptide group consisting of amino acid sequences selected from Sequence 1 and Sequence 2 as an active ingredient.

[0060] The peptides of this invention effectively reduce increased blood glucose in diabetic animal models and exhibit improved insulin resistance, thus making them effective for the prevention or treatment of diabetes.

[0061] [The effects of the invention]

[0062] This invention relates to a pharmaceutical composition for the prevention and / or treatment of obesity and / or diabetes, comprising an amino acid sequence of sequence 1 or sequence 2, having anti-obesity and / or anti-diabetic activity, and containing one or more peptides selected from the above as active ingredients. The peptides inhibit fat accumulation, reduce the size of adipocytes, and increase the expression of phosphorylated hormone-sensitive lipase, adenosine monophosphate-activated protein kinase-α1, and comparative gene recognition-58, which are lipolysis factors, thereby breaking down accumulated fat. This not only exhibits excellent anti-obesity effects but also effectively reduces blood glucose, increases the expression of adiponectin and adenosine monophosphate-activated protein kinase (which improve insulin resistance), increases the expression of glucose transporter protein 4 (a glucose transport channel), and increases the expression of insulin receptor substrate-1 (an insulin receptor signaling protein), thereby exhibiting excellent effects on diabetes. Therefore, it can be effectively used in the prevention or treatment of obesity and / or diabetes. [Attached Image Description]

[0063] Figure 1a A photograph of accumulated fat when treated with a peptide consisting of the amino acid sequence of Sequence 1 of an embodiment of the present invention, as confirmed by Oil Red O staining.

[0064] Figure 1b A graph showing the accumulation of fat when a peptide consisting of the amino acid sequence of Sequence 1 of an embodiment of the present invention is treated, as confirmed by Oil Red O staining.

[0065] Figure 1c A photograph of accumulated fat when treated with a peptide consisting of the amino acid sequence of sequence 2 of an embodiment of the present invention, as confirmed by Oil Red O staining.

[0066] Figure 1d A graph showing the accumulation of fat when a peptide consisting of the amino acid sequence of sequence 2 of an embodiment of the present invention is treated, as confirmed by Oil Red O staining.

[0067] Figure 2a A graph showing the results of measuring glycerol secretion when a peptide consisting of the amino acid sequence of Sequence 1 of an embodiment of the present invention is treated at a concentration.

[0068] Figure 2b A graph showing the results of measuring glycerol secretion when a peptide consisting of the amino acid sequence of sequence 2 of an embodiment of the present invention is treated at a concentration.

[0069] Figure 3a The results were obtained by measuring the expression level of comparative gene recognition-58, a gene involved in the breakdown of accumulated fat, when a peptide consisting of the amino acid sequence of sequence 1 of an embodiment of the present invention was treated.

[0070] Figure 3b The results were obtained by measuring the expression level of comparative gene recognition-58, a gene involved in the breakdown of accumulated fat, when a peptide consisting of the amino acid sequence of sequence 2 of an embodiment of the present invention was treated.

[0071] Figure 4a A photograph showing the results of measuring the number and area of ​​adipocytes after treating mouse adipose tissue with a peptide consisting of the amino acid sequence of Sequence 1 of an embodiment of the present invention.

[0072] Figure 4b A graph showing the results of measuring the number and area of ​​adipocytes after treating mouse adipose tissue with a peptide consisting of the amino acid sequence of Sequence 1 of an embodiment of the present invention.

[0073] Figure 5a This photograph shows the results of measuring the expression level of phosphorylated hormone-sensitive lipase protein, an important protein in lipid synthesis, when a peptide consisting of the amino acid sequence of Sequence 1 of an embodiment of the present invention is treated.

[0074] Figure 5b This photograph shows the results of measuring the expression level of phosphorylated hormone-sensitive lipase protein, an important protein in lipid synthesis, when a peptide consisting of the amino acid sequence of sequence 2 of an embodiment of the present invention is treated.

[0075] Figure 6a A graph illustrating the results of measuring changes in blood glucose levels in mice after being fed a high-fat diet and a peptide consisting of the amino acid sequence of Sequence 1, according to an embodiment of the present invention.

[0076] Figure 6b A graph illustrating the results of measuring changes in blood glucose levels in mice after being fed a high-fat diet and a peptide consisting of the amino acid sequence of sequence 2, according to an embodiment of the present invention.

[0077] Figure 7a The results of changes in the expression of adiponectin and GLUT5 were measured after treating cells induced with insulin resistance with a peptide consisting of the amino acid sequence of Sequence 1 of an embodiment of the present invention.

[0078] Figure 7b The results of changes in the expression of adiponectin and GLUT5 were measured after treating cells induced with insulin resistance with a peptide consisting of the amino acid sequence of sequence 2 of an embodiment of the present invention.

[0079] Figure 8a The results of measuring changes in the expression of insulin receptor substrate-1 and adenosine monophosphate-activated protein kinase-1 were obtained by treating cells induced with insulin resistance with the amino acid sequence of sequence 1 of an embodiment of the present invention.

[0080] Figure 8b The results of measuring changes in the expression of insulin receptor substrate-1 and adenosine monophosphate-activated protein kinase-1 were obtained by treating cells induced with insulin resistance with the amino acid sequence of sequence 2 of an embodiment of the present invention.

Detailed Implementation Methods

[0081] [Optimal Implementation Method]

[0082] This invention relates to peptides with anti-obesity and / or anti-diabetic activity composed of an amino acid sequence of sequence 1 or sequence 2.

Detailed Implementation Methods

[0084] The present invention will now be described in more detail through embodiments. These embodiments are only for the purpose of further illustrating the invention, and the scope of the invention is not limited to these embodiments, as will be apparent to those skilled in the art.

[0085]

Example

[0086]

Synthesis Example 1: Peptide Synthesis

[0087] 700 mg of chlorotritylchloride resin (CTL resin, Novabiochem Cat No. 01-64-0021) was placed in a reaction vessel, and 10 ml of dichloromethane (MC) was added and stirred for 3 minutes. The solution was removed, and 10 ml of dimethylformamide (DMF) was added and stirred for 3 minutes, after which the solvent was removed again. 10 ml of the dichloromethane solution was placed in a reactor, and 200 mmol of Fmoc-Leu-OH (Bachem, Swiss) and 400 mmol of diisopropylethylamine (DIEA) were added, stirred until homogeneous, and stirred for 1 hour to allow the reaction to proceed. After the reaction, the mixture was washed by dissolving methanol and diisopropylethylamine (2:1) in dichloromethane (DCM), reacting for 10 minutes, and then washing with excess dichloromethane / dimethylformamide (1:1). The solution was removed, and 10 ml of dimethylformamide (DMF) was added and stirred for 3 minutes, after which the solvent was removed again. 10 ml of the deprotection solution (20% piperidine / dimethylformamide) was added to the reaction vessel, and the mixture was stirred at room temperature for 10 minutes, after which the solution was removed. The same amount of deprotection solution was added, and the reaction was maintained for another 10 minutes, after which the solution was removed. The mixture was then washed twice with dimethylformamide, once with dichloromethane, and once with dimethylformamide, each for 3 minutes, to prepare the Ser(tBu)-CTL Resin resin. In a new reactor, 10 ml of dimethylformamide solution was added, along with 200 mmol of Fmoc-Lys(Boc)-OH (Bachem, Swiss), 200 mmol of hydroxybenzotriazole (HoBt), and 200 mmol of benzotriazole-1-yloxytris(dimethylamino)phosphonium hexafluorophosphate (Bop), and the mixture was stirred until homogeneous. In a reactor, 400 mmol of N,N-diisopropylethylamine (DIEA) was added twice via fractional distillation, and the mixture was stirred for at least 5 minutes until all solids dissolved. The dissolved amino acid mixture was then placed in a reaction vessel with a deprotected resin and stirred at room temperature for 1 hour. The reaction solution was removed, and the mixture was stirred with dimethylformamide solution for 5 minutes each time, for a total of 3 times, before removal. A small amount of the reacted resin was taken, and the extent of reaction was checked using the Nihydrin test. Lys(Boc)-Ser(tBu)-CTL Resin resin was prepared by performing two deprotection reactions using the same method as described above. After thorough washing with dimethylformamide and dichloromethane, the Nihydrin test was repeated, followed by the amino acid adhesion experiment performed using the same method as described above.Based on the selected amino acid sequence, a chain reaction was carried out in the order of Fmoc-Arg(Pbf)-OH, Fmoc-Glu(OtBu)-OH, and Fmoc-Lys(Boc)-OH. The Fmoc-protecting group was reacted twice with a deprotection solution at 10-minute intervals, then cleaned and removed. The peptide resin, prepared after acetylation with acetic anhydride and N,N-diisopropylethylamine and hydroxybenzotriazole (HoBt) for 1 hour, was washed three times with dimethylformamide, dichloromethane, and methanol, respectively. After drying with slow nitrogen inflow, it was completely dried under reduced pressure (Phosphorus pentoxide, P2O5) to a vacuum state. Then, it was placed in 30 ml of a leakage solution [95% trifluoroacetic acid (TFA), 2.5% distilled water, and 2.5% thioanisole], and the reaction was maintained at room temperature with slight agitation for 2 hours. The resin was filtered and washed with a small amount of solution before being mixed with the mother liquor. The mixture was then distilled under reduced pressure until approximately half the total volume remained. 50 ml of cool ether was added to induce precipitation, followed by centrifugation to collect the precipitate. The precipitate was washed twice with even cooler ether. The mother liquor was removed, and the mixture was thoroughly dried under nitrogen to synthesize 0.77 g of purified Lys-Glu-Arg-Lys-Ser. The molecular weight was determined to be 646.7 (theoretical value: 646.7). Another peptide, sequence 2, was synthesized using the same method.

[0088] Table 1

[0089]

[0090] [Example 1: Oil Red O Staining]

[0091] To determine the lipid accumulation inhibition effect of the peptides based on this invention, 3T3-L1 cells were subjected to a concentration of 2 × 10⁻⁶ cells / cells. 4 Cells were seeded in 24-well plates using a cell / well ratio and cultured. The medium was then replaced with differentiation medium containing 10 μg / ml insulin, 0.1 μM dexamethasone, and 0.5 μM MIBMX, and peptides were treated according to the specified concentrations. Subsequently, the medium was replaced with insulin every two days. Oil Red O staining was performed on day 9 of differentiation induction.

[0092] After cleaning cells with phosphate-buffered saline (PBS), they were treated and fixed with 4% paraformaldehyde for 10 minutes, washed with distilled water, and then cultured with 60% isopropanol for 5–10 minutes. The fixed cells were stained with Oil Red solution (1% Oil Red diluted in isopropanol at a 6:4 volume / volume ratio in dH2O) for 30 minutes, and then washed again with phosphate-buffered saline. After observing the stained cells under an optical microscope, they were washed with distilled water and mixed with 100% isopropanol in 1 ml increments at 4°C. Quantification was performed the following day at 510 nm.

[0093] As from Figures 1a to 1d It can be confirmed by Oil Red O staining that treatment of peptides in sequences 1 and 2 of the sequence listing reduces intracellular lipid accumulation.

[0094] [Example 2: Glycerol Array (Induction of Lipolysis)]

[0095] Adipocytes store excess energy as triglycerides in lipid droplets. When energy is needed, enzymes such as adipose triglyceride lipase, hormone-sensitive lipase, and monoglyceride lipase break it down into fatty acids and glycerol, thereby producing energy or using it for cell signaling or fat synthesis. Measuring the release of free glycerol is used to evaluate the effectiveness of triglyceride breakdown in adipocytes.

[0096] To determine the lipolytic effect of the peptides based on this invention, mouse adipose tissue was collected in 100 mm plates (DMEM) and cultured for one day. The tissue was then cut into equal portions by weight and transferred to 24-well plates for peptide treatment, followed by culturing for 48 to 72 hours. 100 μl of each peptide was collected at each treatment time for glycerol array analysis. Figure 2a and Figure 2b The results are shown.

[0097] As from Figure 2a It can be confirmed that treatment with the peptide consisting of the amino acid sequence of sequence 1 increases glycerol secretion in tissues.

[0098] Furthermore, as from Figure 2b It was confirmed that treatment with the peptide consisting of the amino acid sequence of sequence 2 resulted in a concentration-dependent increase in glycerol secretion compared to the control group NC, with a 22% increase in glycerol secretion when treated with high concentrations.

[0099] [Example 3: Comparative Reverse Transcription-Polymerase Chain Reaction (RT-PCR) of Gene Recognition-58]

[0100] Total ribonucleic acid (RNA) was extracted using the Qiagen RNeasy kit. To synthesize single-stranded deoxyribonucleic acid (DNA) from the RNA, 3 mg of RNA, 2 mg of random hexamer, and water treated with diethyl pyrocarbonate (DEPC) were added, and the mixture was reacted at 65°C for 5 minutes. Then, 5× firststrand buffer, 0.1 M dithiothreitol (DTT), 10 mM dNTPs, and reverse transcriptase were added to a total volume of 20 ml, and the mixture was reacted at 42°C for 1 hour. After heating again at 95°C for 5 minutes, 20 ml of distilled water was added to prepare the final 40 ml of complementary deoxyribonucleic acid (cDNA). Polymerase chain reaction (PCR) was performed by mixing 3 ml of cDNA, 10 pmol of CGI58 specific primers, 10× Tag buffer, 10 mM dNTPs, and i-Tag DNA synthase. The polymerase chain reaction (PCR) conditions were 94°C for 30 seconds, 55°C to 56°C for 30 seconds, and 72°C for 30 seconds. For genes with cycle numbers, analysis was performed under conditions where the PCR results could be amplified exponentially. 5 ml of the PCR product was obtained, electrophoresed on a 1% agarose gel, and confirmed by ethidium bromide staining. Figures 3a to 3b The results are shown.

[0101] Table 2

[0102] Serial Number Primers Sequence (5'-3') 3 CGI 58_F TGTGCAGGACTCTTACTTGGCAGT 4 CGI 58_R GTTTCTTTGGGCAGACCGGTTTCT

[0103] As from Figures 3a to 3b It was confirmed by reverse transcription-polymerase chain reaction that the expression level of intracellular CGI 58 was increased by peptide treatment consisting of amino acid sequences of sequence 1 or sequence 2, which is a comparative gene recognition-58 as a lipolysis factor.

[0104] [Example 4: Histological Analysis (Induction of Lipid Decomposition)]

[0105] Mouse adipose tissue was collected and cultured in 100 mm plates (DMEM) for one day. Afterward, the tissues were cut into equal portions and transferred to 24-well plates for peptide processing, followed by culturing for 48 to 72 hours. H&E staining was performed on sections of each tissue. Microscopic images were used to create compartments in ImageJ, and analysis was performed using software that allows comparison of the size of each compartment. The total number of cells and the average area divided by the total number of cells were obtained. The results may vary depending on the degree of staining, but this can be corrected by initially adjusting the threshold and comparing the results with the original file to remove cells with relatively small areas before exporting the final results.

[0106] from Figure 4a and Figure 4b It was confirmed that the number of adipocytes increased with the increase of the concentration of the peptide in sequence 1 of the sequence listing, and the fat area decreased.

[0107] An increase in the number of fat cells per unit area can be seen as a decrease in fat cell size, i.e., a reduction in fat accumulation within fat cells.

[0108] [Example 5: Immunohistochemical staining (induction of lipolysis)]

[0109] To observe the mechanism by which the peptides of this invention inhibit fat accumulation in adipocytes by promoting the breakdown of neutral fats, the effect of hormone-sensitive lipase gene expression was investigated. It is well known that hormone-sensitive lipase is a lipase that breaks down neutral fats into free fatty acids and glycerol during fat breakdown in adipose tissue.

[0110] Mouse adipose tissue was collected and cultured in 100 mm plates (DMEM) for one day. Afterward, the tissue sections were cut into equal portions and transferred to 24-well plates for peptide processing, followed by culturing for 48 to 72 hours. Immunohistochemical staining of tissue sections was performed using an anti-phosphorylated hormone-sensitive lipase antibody. The sections were then observed using a fluorescence microscope. Figure 5a and Figure 5b The results are shown.

[0111] As from Figure 5a and Figure 5b It can be confirmed that the expression of phosphorylated hormone-sensitive lipase, a lipolysis factor, is increased by a peptide composed of the amino acid sequence of sequence 1 or sequence 2.

[0112] [Example 6: Evaluation of antidiabetic efficacy (in vivo)]

[0113] Six-week-old C57BL / 6J mice were purchased from the Central Laboratory Animal Center (Central Lab.Animal Inc., Seoul, Korea) and, after a one-week acclimatization period on a normal diet, were used in experiments. For the high-fat diet, Research Diets Inc. (product D12492) was used.

[0114] The experimental animals were divided into four groups of three and fed for 12 weeks. As shown in Table 3, the experimental groups were: the normal diet group (non groups), the high-fat diet experimental group (NC groups), the high-fat diet and the peptide composed of the amino acid sequence of Sequence 1 (orally administered), and the high-fat diet and sitagliptin tablets (orally administered).

[0115] Table 3

[0116]

[0117] Furthermore, the experimental animals were divided into 5 groups, with 3 animals in each group, and were raised for 12 weeks. As shown in Table 4, the experimental groups were: the normal diet group (non groups), the high-fat diet experimental group (NC groups), the peptide composed of high-fat diet and amino acid sequence 2 (intraperitoneal administration), and the high-fat diet and sitagliptin tablets (oral administration).

[0118] Table 4

[0119]

[0120] After a 30-minute pretreatment of the peptides, oral administration of glucose (60 mg / 300 μl distilled water) was administered, and the time-based blood glucose reduction effect was confirmed, thereby achieving the desired effect. Figures 6a to 6b The results are shown in Tables 5 and 6.

[0121] Table 5

[0122]

[0123] Table 6

[0124]

[0125] As from Figure 6a and Figure 6b It was confirmed that, compared with the NC group, the glucose-based increase in blood glucose was reduced in the peptide treatment group consisting of the amino acid sequences of sequence 1 or sequence 2.

[0126] [Example 7: Evaluation of antidiabetic efficacy (adiponectin & glucose transporter 4 reverse transcription-polymerase chain reaction)]

[0127] To create conditions conducive to insulin resistance, peptides were treated for 16 hours after being subjected to tumor necrosis factor-α (TNF-α) conditioning. Changes in individual factors were then confirmed using reverse transcription-polymerase chain reaction (RT-PCR). Figure 7a and Figure 7b The results are shown. The conditions for performing the reverse transcription-polymerase chain reaction are as described in Example 3.

[0128] Table 7

[0129] Serial Number Primers Sequence (5'-3') 5 Adiponectin F GCCAATCTTCATCCAGTTGC 6 Adiponectin R CATCGTGAAGAAGGCATAGG 7 Glucose transporter 4-F AAGATGGCCACGGAGAGAG 8 Glucose transporter 4_R GTGGGTTGTGGCAGTGAGTC

[0130] As from Figure 7a and Figure 7b It was confirmed that when peptides composed of the amino acid sequences of Sequence 1 or Sequence 2 were treated, the adiponectin expression that was reduced when treated with tumor necrosis factor-α was increased again. Furthermore, it was confirmed that glucose transporter 4, which is a glucose transport channel and was reduced by tumor necrosis factor-α, was re-expressed with increased expression after peptide treatment.

[0131] [Example 8: Evaluation of antidiabetic efficacy (IRS-1 & adenosine monophosphate activated protein kinase-α1 reverse transcription-polymerase chain reaction)]

[0132] To create conditions conducive to insulin resistance, peptides were treated for 16 hours after processing tumor necrosis factor-α (TNF-α) and collected. Changes in individual factors were then confirmed using reverse transcription-polymerase chain reaction (RT-PCR). Figure 8a and Figure 8b The results are shown. The conditions for performing the reverse transcription-polymerase chain reaction are as described in Example 3.

[0133] Table 8

[0134] Serial Number Primers Sequence (5'-3') 9 Insulin receptor substrate-1F GCCAATCTTCATCCAGTTGC 10 Insulin receptor substrate-1_R CATCGTGAAGAAGGCATAGG 11 Adenosine monophosphate activated protein kinase-α1F TGACCGGACATAAAGTGGCTGTGA 12 Adenosine monophosphate activated protein kinase-α1_R TGATGATGTGAGGGTGCCTGAACA

[0135] As from Figure 8a and Figure 8b It was confirmed that when the peptide consisting of the amino acid sequence of sequence 1 was treated, the expression of adenosine monophosphate-activated protein kinase-1 (AMP-1) and insulin receptor substrate-1 (IP1), which was reduced when treated with tumor necrosis factor-α, was increased again. Furthermore, it was confirmed that the expression of AMP-1, which was reduced by tumor necrosis factor-α, was increased again after treatment with the peptide consisting of the amino acid sequence of sequence 2.

[0136] [Industry Applicability]

[0137] The present invention relates to a peptide having anti-obesity and / or anti-diabetic activity composed of an amino acid sequence of sequence 1 or sequence 2, a pharmaceutical composition for the prevention and / or treatment of obesity and / or diabetes comprising one or more of the peptides selected as active ingredients, and the peptides mentioned above.

[0138] This instruction manual also includes the following:

[0139] 1. A peptide having anti-obesity or anti-diabetic activity, comprising an amino acid sequence of sequence 1 or sequence 2.

[0140] 2. The peptide according to embodiment 1, wherein the peptide reduces fat accumulation in adipocytes.

[0141] 3. The peptide according to embodiment 1, wherein the peptide increases fat breakdown.

[0142] 4. The peptide according to embodiment 1, wherein the peptide increases the expression of phosphorylated hormone-sensitive lipase or comparative gene recognition-58.

[0143] 5. The peptide according to embodiment 1, wherein the peptide reduces the size of adipocytes.

[0144] 6. The peptide according to embodiment 1, wherein the peptide reduces blood glucose.

[0145] 7. The peptide according to Embodiment 1, wherein the peptide increases the expression of adiponectin, glucose transporter 4, insulin receptor substrate-1, or adenosine monophosphate-activated protein kinase-α1.

[0146] 8. A pharmaceutical composition for the prevention or treatment of obesity, comprising one or more peptides selected from amino acid sequences of sequence 1 or sequence 2 as an active ingredient.

[0147] 9. A pharmaceutical composition for the prevention or treatment of diabetes, comprising one or more peptides selected from amino acid sequences of sequence 1 or sequence 2 as an active ingredient.

[0148] 10. Use of a peptide consisting of the amino acid sequence of sequence 1 or the amino acid sequence of sequence 2 for the manufacture of a pharmaceutical composition for the prevention or treatment of obesity.

[0149] 11. Use of a peptide consisting of the amino acid sequence of sequence 1 or the amino acid sequence of sequence 2 for the manufacture of a pharmaceutical composition for the prevention or treatment of diabetes.

Claims

1. A peptide having anti-obesity or anti-diabetic activity, comprising the amino acid sequence of sequence 2.

2. The peptide of claim 1, wherein the peptide reduces fat accumulation within adipocytes.

3. The peptide according to claim 1, wherein the peptide increases lipolysis.

4. The peptide of claim 1, wherein the peptide increases the expression of phosphorylated hormone-sensitive lipase or comparative gene recognition-58.

5. The peptide of claim 1, wherein the peptide reduces the size of adipocytes.

6. The peptide of claim 1, wherein the peptide reduces blood glucose.

7. The peptide of claim 1, wherein the peptide increases the expression of adiponectin, glucose transporter 4, insulin receptor substrate-1, or adenosine monophosphate-activated protein kinase-1.

8. A pharmaceutical composition for the prevention or treatment of obesity, comprising a peptide consisting of an amino acid sequence of sequence 2 as an active ingredient.

9. A pharmaceutical composition for the prevention or treatment of diabetes, comprising a peptide consisting of an amino acid sequence of sequence 2 as an active ingredient.

10. Use of a peptide consisting of the amino acid sequence of sequence 2 in the manufacture of a pharmaceutical composition for the prevention or treatment of obesity.

11. Use of a peptide consisting of the amino acid sequence of sequence 2 in the manufacture of a pharmaceutical composition for the prevention or treatment of diabetes.

Images