A method for improving the enzyme activity of glutamate decarboxylase by co-expressing the stoA gene and its application

Abstract

The present invention belongs to the fields of genetic engineering and enzyme engineering, and discloses a method for improving the enzyme activity of glutamate decarboxylase by co-expression stoA and its application. The applicant co-expresses the coding gene of glutamate decarboxylase (GAD) with the endogenous gene of Bacillus licheniformis DW2 stoA to successfully construct a recombinant plasmid capable of highly expressing glutamate decarboxylase. It is transferred into the food-grade host bacterium Bacillus licheniformis DW2 for high-efficiency expression, and the GAD enzyme activity reaches 23.2 U·mL ‑1 , which is increased by 71.9% compared with the control strain, and the yield of γ-aminobutyric acid obtained by whole-cell catalysis is 103 g·L ‑1 . The recombinant plasmid constructed in the present invention has a significant effect on enhancing the GAD enzyme activity, providing a new idea for the high-efficiency production of GABA. The engineered bacterium constructed in the present invention lays a foundation for realizing the production of food-grade GABA.

Description

Technical Field

[0001] The present invention belongs to the fields of genetic engineering and enzyme engineering, and particularly relates to a method for improving the enzyme activity of glutamate decarboxylase by co-expressing the stoA gene and its application. Background Art

[0002] γ-aminobutyric acid (GABA) is an inhibitory neurotransmitter and has a wide range of applications in the food, pharmaceutical, and livestock industries, and is commonly used in food additives, physiological drugs, and feed additives, etc. (Sarasa et al., Curr. Microbiol, 2020, 77(4): 534-544). There are mainly 4 common synthesis methods of GABA, namely chemical synthesis method, plant enrichment method, microbial fermentation method, and whole-cell catalysis method (Baritugo, K.A., Microb Cell Fact, 2018, 17(1): 129). However, limited by harsh reaction conditions and expensive natural raw materials, the production of GABA by chemical synthesis method has poor safety and chemical residues; although the plant enrichment method has good safety, the concentration of GABA obtained is too low to be used as a pharmaceutical or food additive. Currently, the preparation of GABA mainly uses Escherichia coli to highly express glutamate decarboxylase (Glutamate decarboxylase, GAD), and then through the whole-cell catalysis method, the α-carboxyl group of L-glutamate is irreversibly removed to obtain high-concentration and high-purity GABA (Tang et al., Int J Biol Macromol, 2020, 160: 372-379). However, Escherichia coli does not belong to a food safety strain, and it is easy to be infected by phages during the fermentation process, causing huge losses to industrial production.

[0003] Whole-cell catalysis can enable GAD to catalyze the synthesis of GABA under the optimal pH conditions, getting rid of the limitation of acidity and alkalinity on the production of GABA, and thus achieving efficient catalysis. Since GAD is a hexamer and each monomer contains four pairs of disulfide bonds, the effective enzyme activity of this enzyme is limited in the cell. And what is necessary in whole-cell catalysis is a microbial cell that can express glutamate decarboxylase with high enzyme activity. Therefore, effectively improving the enzyme activity of GAD has become a key breakthrough in research. In previous studies, most of the methods for improving glutamate enzyme activity were site-directed mutagenesis (Zhang et al., Molecules, 2020, 25: 690; Hua et al., Appl Biochem Biotechnol, 2020, 191(4): 1456-1469).

[0004] Bacillus licheniformis is an important industrial production strain with high protein expression ability and is recognized as a biosafety strain by the US FDA, which can be used as an excellent host for target proteins. StoA is a disulfide bond isomerase in Bacillus licheniformis, but whether this enzyme is applicable to all enzymes containing disulfide bonds is not clear due to the conformational differences of each enzyme. Therefore, it is unpredictable whether its expression level can promote the enzyme activity of GAD. Summary of the Invention

[0005] The object of the present invention is to provide a method for improving the enzyme activity of glutamate decarboxylase by co-expressing the stoA gene.

[0006] Another object of the present invention is to provide the application of the method for improving the enzyme activity of glutamate decarboxylase by co-expressing the stoA gene.

[0007] In order to achieve the above object, the present invention takes the following technical measures:

[0008] A method for improving the enzyme activity of glutamate decarboxylase by co-expressing the stoA gene, including constructing the glutamate decarboxylase GAD gene in Escherichia coli and the disulfide bond isomerase stoA gene in Bacillus licheniformis into the same expression vector, and then transferring it into Bacillus licheniformis for expression.

[0009] In the above method, preferably, the Bacillus licheniformis is Bacillus licheniformis DW2;

[0010] In the above method, preferably, the glutamate decarboxylase GAD gene is as shown in SEQ ID NO.1.

[0011] In the above method, preferably, the disulfide bond isomerase stoA gene is as shown in SEQ ID NO.2;

[0012] The application of the method for improving the enzyme activity of glutamate decarboxylase by co-expressing the stoA gene includes using the recombinant strain constructed above to prepare and produce GABA.

[0013] Compared with the prior art, the present invention has the following advantages:

[0014] (1) The present invention discovers the construction method of the recombinant plasmid and strain by co-expressing glutamate decarboxylase and the endogenous disulfide bond isomerase (StoA) gene of Bacillus licheniformis DW2. The applicant constructs the recombinant plasmid by co-expressing glutamate decarboxylase and the stoA gene for the first time, and successfully obtains the heterologous expression glutamate decarboxylase host strain of Bacillus licheniformis DW2. After co-expression with stoA, the GAD enzyme activity reaches 23.2 U·mL -1 , which is increased by 71.2% compared with the control strain, laying a foundation for the heterologous high-efficiency expression of disulfide bond-related enzymes in Bacillus licheniformis and improving the enzyme activity level.

[0015] (2) The present invention has successfully constructed a recombinant Bacillus licheniformis capable of highly expressing glutamate decarboxylase with Bacillus licheniformis DW2 as the host; using this recombinant Bacillus licheniformis, food-grade glutamate decarboxylase and food-grade γ-aminobutyric acid can be produced, laying a foundation for the application of glutamate decarboxylase and γ-aminobutyric acid in the food and pharmaceutical fields.

[0016] (3) The present invention provides a method for producing food-grade glutamate decarboxylase. This method uses the recombinant Bacillus licheniformis of the present invention for whole-cell catalysis, with a wet cell addition amount of 4 - 5 mg, added to a 20 mL reaction system containing a 1 mol·L -1 L-glutamate substrate concentration for reaction to produce food-grade γ-aminobutyric acid; using this method for 2 h of reaction, the yield of γ-aminobutyric acid in the reaction solution can reach as high as 103 g·L -1 and the conversion rate is as high as 100%. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Schematic diagram of the enzyme activities of recombinant Bacillus licheniformis DW2 / pHY-GAD-stoA and control strain DW2 / pHY-GAD.

[0018] Figure 2 Schematic diagram of the enzyme activities of recombinant Bacillus licheniformis DW2 / pHY-GAD-stoA and control strain DW2 / pHY-GH75. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0019] The technical solutions described in the present invention are all conventional solutions in the art unless otherwise specified; the reagents or materials are all from commercial channels unless otherwise specified.

[0020] The media involved in the following examples are as follows:

[0021] LB liquid medium: Yeast extract 5 g·L -1 , Peptone 10 g·L -1 , NaCl 10 g·L -1 .

[0022] LB solid medium: Yeast extract 5 g·L -1 , Peptone 10 g·L -1 , NaCl 10 g·L -1 , Agar powder 15 g·L -1 .

[0023] TB liquid medium: Yeast extract 24 g·L -1 , Peptone 12 g·L -1 , Glycerol 5 g·L -1 , K2 HPO 4 ·3H 2 O16.43g·L -1 、KH 2 PO 4 2.31g·L -1 。

[0024] Whole-cell catalysis buffer system: Pyridoxal phosphate (PLP) 0.2 mmol·L -1 、Na 2 HPO 4 71.63g·L -1 、L-glutamic acid 1mol·L -1 。

[0025] The detection methods involved in the following examples are as follows:

[0026] Determination of the enzyme activity of recombinant glutamate decarboxylase (GAD):

[0027] Obtaining the crude enzyme solution of recombinant GAD:

[0028] Take 1 mL of the fermentation broth, centrifuge to collect the cells, and resuspend the cells with 50 mmol·L -1 PLP-containing -1 pH 5.0 Na 2 HPO 4 -citrate buffer and add lysozyme with a final concentration of 0.6 mg·mL -1 After reacting at 37°C for 30 min, place it in ice water and ultrasonically disrupt (ultrasonic power 25%, time 10 min), and centrifuge at 12000 r·min -1 for 5 min, and the supernatant after cell wall disruption is the crude enzyme solution of GAD.

[0029] Determination of the enzyme activity of the crude enzyme solution of recombinant GAD:

[0030] Preparation of the substrate solution: 0.1 mol·L -1 L-glutamic acid and 0.15 mmol·L -1 PLP are dissolved in 50 mmol·L -1 pH 4.5 Na 2 HPO 4 -citrate buffer, and store it in the dark at 4°C; Reaction system: Preheat a 1.5 mL Eppendorf tube containing 360 μL of the substrate solution in a 37°C water bath for 10 min, then add 40 μL of the crude enzyme solution of GAD, react at 37°C for 4 min, and add 600 μL of 0.2 mol·L -1The reaction was terminated with pH 10 boric acid buffer and inactivated in boiling water for 10 min; Determination of GABA content: The amount of GABA produced was detected by HPLC-OPA pre-column derivatization method for amino acids.

[0031] Definition of enzyme activity: The amount of enzyme required to catalyze the conversion of substrate to produce 1 μmol GABA in 1 min is defined as one activity unit (U).

[0032] Calculation formula for enzyme activity: Enzyme activity (U·mL -1 ) = Amount of γ-aminobutyric acid converted (μmol·mL -1 ) / Conversion time (min).

[0033] Detection method for γ-aminobutyric acid (GABA) content and conversion rate:

[0034] Before determining the GABA content in the sample by HPLC, the sample was first derivatized under the following derivatization conditions. Mix 100 μL of the sample dilution, 200 μL of 0.5 mol·L -1 Na 2 CO 3 -NaHCO 3 buffer solution, and 100 μL of 80 g·L -1 dansyl chloride solution, and place it in the dark at 80 °C for 40 minutes for derivatization. Filter the derivatized sample through a 0.22 μm microporous filter membrane.

[0035] HPLC operating conditions are as follows: The chromatographic separation column is Hypersil ODS2 C18 (250 mm × 4.6 mm), the ultraviolet detection wavelength is 254 nm, the injection volume is 10 μL, mobile phase A is methanol, and mobile phase B is tetrahydrofuran: methanol: 0.05 mol·L -1 sodium acetate (pH 6.2) (5:75:420, V / V).

[0036] Calculate the amount of GABA produced according to the absorption peak area and the peak area of the GABA standard.

[0037] GABA conversion rate (%) = Moles of GABA actually produced / Theoretical moles of glutamate converted to GABA × 100.

[0038] Example 1:

[0039] Construction of recombinant plasmid

[0040] 1. Using plasmid pHY300PLK as a template and 300-GF and 300-GR as primers, the linear backbone of pHY300PLK was amplified by PCR. The PCR reaction conditions were: 95°C for 5 min, 30×(95°C for 30 sec, 55°C for 30 sec, 72°C for 2.5 min), 72°C for 5 min, 12°C for 5 min.

[0041] Among them, the sequences of 300-GF and 300-GR are:

[0042] 300-GF: tatatattcctcctttctaatatacatt;

[0043] 300-GR: aagagcagagaggacggatttcctg.

[0044] 2. Primers were designed according to the sequence of the GAD gene (glutamate decarboxylase gene) in the Escherichia coli genomic DNA sequence. Using Escherichia coli genomic DNA (Escherichia coli str.K-12substr.MG1655NC_000913.3) as a template and GAD-F and GAD-R as primers, the GAD gene was amplified by PCR. The amplified product was detected by 0.1% agarose gel electrophoresis, and the length was 1401 bp, which was the same as the theoretical value.

[0045] Among them, the sequences of GAD-F and GAD-R are:

[0046] GAD-F: agaaaggaggaatatataatggataagaagcaagta;

[0047] GAD-R: tccgtcctctctgctctttcaggtatgtttaaagct.

[0048] 3. The target gene fragment in step 2 and the backbone in step 1 were digested and ligated with ExnaseⅡ T5 exonuclease to obtain a ligation product; the ligation product was transferred into Escherichia coli DH5α by the calcium chloride transformation method and screened on a medium containing tetracycline hydrochloride resistance at 37°C. The transformants were obtained, and the plasmids of the transformants were picked for colony PCR verification. The primers used were: PHY-F, PHY-R;

[0049] pHY-F: gtttattatccatacccttac;

[0050] pHY-R: cagatttcgtgatgcttgtc.

[0051] If the PCR verification result of the transformant shows that an electrophoretic band appears at 2457 bp, it indicates that the construction of the GAD free expression vector is successful. The above transformant is a positive transformant, named: GAD free expression vector pHY-GAD.

[0052] 4. Using the recombinant plasmid pHY-GAD as a template and Amp-T5-TF and Amp-T5-TR as primers, PCR amplification was performed to obtain the pHY-GAD-ΔAmp backbone.

[0053] Among them, the sequences of Amp-T5-TF and Amp-T5-TR are:

[0054] Amp-T5-TF: ctgtcagaccaagtttactcata;

[0055] Amp-T5-TR: tgtacattcctcctttctaatgtacgggttattgtctcatgagcg.

[0056] 5. Primers were designed based on the stoA gene sequence in the Bacillus licheniformis DW2 genome (Bacillus licheniformis DW2 CCTCC NO: M2011344, CN111321099A) DNA sequence. Using the Bacillus licheniformis DW2 genomic DNA as a template and StoA-F and StoA-R as primers, PCR amplification was performed to obtain the stoA gene. The amplification product was detected by 0.1% agarose gel electrophoresis, and the length was 492 bp, which was the same as the theoretical value.

[0057] Among them, the sequences of StoA-F and StoA-R are:

[0058] StoA-F: gtacattagaaaggaggaatgtacaatgcgaagaatcagtctt;

[0059] StoA-R: gtaaacttggtctgacagtcagcttttccctgccca.

[0060] 6. The target gene fragment in step 5 and the backbone in step 4 were digested and ligated using ExnaseⅡ T5 exonuclease to obtain a ligation product. The ligation product was transferred into Escherichia coli DH5α by the calcium chloride transformation method and screened on a medium containing tetracycline hydrochloride resistance at 37°C. The obtained transformants were subjected to colony PCR verification by picking plasmids, and the primers used were: Amp-YF, Amp-YR;

[0061] Amp-YF: tggtttcttagacgtcaggtg;

[0062] Amp-YR: tatgagtaaacttggtctgacag。

[0063] If the PCR verification result of the transformant shows an electrophoresis band at 661 bp, it indicates that the co-expression vector of GAD and stoA is successfully constructed. The above transformant is a positive transformant, named: the co-expression vector pHY-GAD-stoA of GAD and stoA.

[0064] Example 2:

[0065] Construction of recombinant Bacillus licheniformis DW2

[0066] The recombinant plasmid pHY-GAD-stoA obtained in Example 1 was electrotransformed into Bacillus licheniformis DW2. The transformed Bacillus licheniformis DW2 was spread on LB solid medium containing 20 μg·mL -1 tetracycline and cultured inverted at 37 °C for 12 - 15 h; transformants were picked for colony PCR screening, using pHY-F and pHY-R as verification primers, and positive transformants were obtained by PCR verification to obtain the co-expression recombinant strain Bacillus licheniformis DW2 / pHY-GAD-stoA of GAD and stoA.

[0067] The sequences of pHY-F and pHY-R are as follows:

[0068] pHY-F: GTTTATTATCCATACCCTTAC;

[0069] pHY-R: CAGATTTCGTGATGCTTGTC.

[0070] Example 3:

[0071] Production of glutamate decarboxylase and determination of enzyme activity

[0072] The recombinant Bacillus licheniformis DW2 / pHY-GAD-stoA obtained in Example 2 was fermented, using the recombinant strain DW2 / pHY-GAD that did not express the stoA gene as a control.

[0073] The recombinant strain DW2 / pHY-GAD was obtained by electrotransforming pHY-GAD into Bacillus licheniformis DW2.

[0074] The specific steps of seed fermentation are as follows: First, the recombinant Bacillus licheniformis DW2 / pHY-GAD-stoA and DW2 / pHY-GAD were taken from the glycerol tube in the presence of 20 μg·mL -1Streak activation was carried out on LB solid medium containing tetracycline, and it was incubated in an inverted position at 37 °C for 20 - 24 h. Colonies were picked and inoculated into 5 mL of LB medium containing 20 μg·mL -1 tetracycline, and cultured at 230 r·min -1 , temperature 37 °C, for 10 - 12 h. Then, the activated bacterial liquid of the strain was inoculated into 50 mL of LB liquid medium containing 20 μg·mL -1 tetracycline at an inoculation amount of 1% (v / v), and cultured at 37 °C, 230 r·min -1 for 10 - 12 h to obtain the seed solutions (OD600 4.0 - 5.0) of the control group and the experimental group.

[0075] The specific steps of production fermentation were as follows: 50 mL of TB fermentation medium was filled into a 250 mL Erlenmeyer flask, and the seed solution was transferred to the TB liquid medium at an inoculation amount of 3% (v / v), and cultured at 37 °C, 230 r·min -1 for 24 h to obtain the fermentation broths of the control group and the experimental group, with 3 replicates in each group.

[0076] The fermentation broths of the experimental group and the control group were centrifuged to obtain the fermentation supernatants and precipitates of the experimental group and the control group; equal amounts of the precipitates of the experimental group and the control group were collected, sonicated, and then centrifuged to obtain the cell lysate supernatants of the experimental group and the control group. The cell lysate supernatants of the control group and the experimental group were subjected to enzyme activity detection. The results of enzyme activity detection are shown in Figure 1 , and it can be seen from Figure 1 that: the enzyme activity of recombinant Bacillus licheniformis DW2 / pHY - GAD - stoA was 23.2 U / mL, while the enzyme activity of the control strain DW2 / pHY - GAD was 13.5 U / mL. After co - expressing stoA, the enzyme activity was increased by 71.9% compared with the control strain. By detecting the protein expression of the experimental group and the control group through SDS - polyacrylamide gel electrophoresis, it was found that co - expressing stoA had no effect on the expression level of GAD.

[0077] Example 4:

[0078] Whole - cell catalysis for the synthesis of γ - aminobutyric acid from glutamate

[0079] The fermentation broth obtained in Example 3 was centrifuged at 7500 r·min -1 for 5 min, the supernatant was removed to collect the bacterial cells, and they were washed twice with an appropriate amount of ddH 2 2O. 20 mL of whole - cell catalysis buffer and 4 - 5 mg of wet bacterial cells were added to a 50 mL conical flask; the substrate glutamate concentration was 1 mol·L -1 , and the pH during the reaction process was controlled at 4.5; the reaction conditions were 37 °C, 150 r·min-1 , after reacting for 2 h at 12,000 r·min -1 Centrifuge at 5 min to obtain the supernatant. After derivatizing the sample, the content and conversion rate of γ-aminobutyric acid in the sample were determined by HPLC. The experimental conditions of the control group (using the recombinant strain DW2 / pHY-GAD without expressing the stoA gene as a control) were the same as those of the experimental group.

[0080] The whole-cell catalytic buffer described above is: pyridoxal phosphate (PLP) 0.2 mM·L -1 , Na 2 HPO 4 71.63 g·L -1 , L-glutamic acid 1 mol·L -1 .

[0081] The detection results were as follows: the molar conversion rate of the experimental group DW2 / pHY-GAD-stoA was 100%, and the GABA yield was 103 g·L -1 . The molar conversion rate of the control group DW2 / pHY-GAD was 83%, and the GABA yield was 85.5 g·L -1 .

[0082] Example 5:

[0083] Compare with the endochitinase containing disulfide bonds:

[0084] After co-expressing stoA with the endochitinase GH75 (SEQ ID NO.3) containing disulfide bonds from Bacillus licheniformis WX-02 (CCTCC NO: M208065, which has been disclosed in CN101603015A), it was found that there was no promoting effect on the enzyme activity of GH75, as Figure 2 shown: the enzyme activity of the control strain DW2 / pHY-GH75 was 8.9 U / mL, while the enzyme activity of DW 2 / pHY-GH75-stoA was 8.2 U / mL. Whether StoA is applicable to all enzymes containing disulfide bonds is unclear due to the conformational differences of each enzyme.

Claims

1. A method for improving the activity of glutamate decarboxylase by co-expressing the stoA gene, which includes constructing the glutamate decarboxylase GAD gene in Escherichia coli and the disulfide bond isomerase stoA gene in Bacillus licheniformis into the same expression vector, and then transferring it into Bacillus licheniformis for expression; The glutamate decarboxylase GAD gene is as shown in SEQ ID NO.2, and the disulfide bond isomerase stoA gene is as shown in SEQ ID NO.1; The Bacillus licheniformis is Bacillus licheniformis DW2.

2. Use of the method according to claim 1 in the preparation of GABA.

Images