A SNP molecular marker related to growth traits of portunus trituberculatus and application thereof

By providing 17 SNP molecular markers related to the growth traits of the swimming crab and combining them with high-throughput sequencing technology, the problem of low breeding accuracy in existing technologies was solved, and the precise positioning of the growth traits of the swimming crab and the improvement of breeding effects were achieved.

CN116334238BActive Publication Date: 2025-10-17HEBEI UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310117066.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-02-15
Publication Date
2025-10-17
Estimated Expiration
2043-02-15

AI Technical Summary

Technical Problem

In the existing technology, there are few SNP markers related to the growth traits of the swimming crab, resulting in low breeding accuracy, inability to precisely locate growth-related genes, and inability to meet the three-spotted swimming crab industry's demand for excellent economic characteristics.

Method used

Seventeen SNP molecular markers related to the growth traits of the swimming crab (P. trituberculatus) were provided, including SNP26101T>C, SNP366C>A, SNP4103G>A, etc. Genotyping and association analysis were performed using specific primers and high-throughput sequencing technology, and individuals retaining the dominant allele genotype were selected for breeding.

Benefits of technology

This study enriched the molecular marker resources for breeding *Portunus trituberculatus*, improved the accuracy of breeding and the precision of growth trait selection, and significantly increased the growth rate of traits such as carapace width, carapace length, body height, or body weight.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The application discloses a SNP molecular marker related to growth traits of Portunus trituberculatus and application thereof. The SNP molecular marker comprises SNP26101T>C, SNP366C>A, SNP4103G>A, SNP864A>G, SNP4582T>A, SNP2451752A>C, SNP1704A>G, SNP2177G>A, SNP448G>A, SNP93121G>A, SNP85860A>G, SNP457A>T, SNP3936G>T, SNP3148T>A, SNP11943T>C, SNP8952779T>C and SNP15785C>T. The SNP molecular marker is closely related to the growth traits of the Portunus trituberculatus and can be effectively used for growth trait breeding or genetic breeding of the Portunus trituberculatus. Compared with a traditional breeding method, the application has the advantages of high efficiency and accuracy.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biology and genetics breeding of Portunus trituberculatus, and particularly relates to a SNP molecular marker related to growth traits of Portunus trituberculatus and application thereof. BACKGROUND

[0002] Portunus trituberculatus is an important aquaculture species, mainly distributed in coastal waters of China, Japan, South Korea and Southeast Asia. Due to its fast growth, large individual and delicious meat, it is suitable for coastal pond seawater culture and has become an important fishing and seawater culture object in China. With the continuous expansion of Portunus trituberculatus culture scale, how to breed strains with excellent economic characteristics has become a major problem to be solved in Portunus trituberculatus industry.

[0003] Growth traits are the most important factors affecting the economic value of Portunus trituberculatus. Among a series of molecular markers, microsatellite DNA molecular markers have been widely used due to their convenient operation and large amount of information, but they still cannot meet the actual needs of researchers. In recent years, the emergence of molecular marker single nucleotide polymorphism (SNP) has made up for the shortcomings of microsatellite DNA molecular markers.

[0004] SNP, single nucleotide polymorphism, refers to the polymorphism of DNA sequence in genome due to single base insertion, deletion, transition and transversion. As the third generation of molecular markers, SNP molecular genetic markers have the advantages of more sites, high genetic stability, convenient detection, time saving, easy automation analysis, etc. Compared with the first generation of molecular markers (RFLP) and the second generation of molecular markers (AFLP, SSR, etc.), SNP molecular genetic markers are more suitable for large-scale screening of polymorphic sites.

[0005] SNP molecular markers have been applied in many plant and animal breeding and production, but the research on marine animals started late. In the previous study, researchers screened SNP sites by direct sequencing method, and used the method of flying mass spectrometry to genotype SNP sites in trait separation population, and found 3 SNP sites related to growth traits through association analysis, and carried out molecular marker assisted breeding research using these molecular markers (Zhang Dening et al., 2015). However, growth traits are quantitative traits controlled by multiple genes, and the number of SNP markers related to the growth of Portunus trituberculatus found in the previous study is small, and the accuracy is low when using SNP markers to assist the genetic breeding of Portunus trituberculatus, which cannot finely locate the genes related to growth. SUMMARY

[0006] The present application aims to provide a SNP molecular marker related to the growth traits of Portunus trituberculatus and an application thereof, and provide a new molecular marker resource for the genetic breeding of Portunus trituberculatus.

[0007] To achieve the above-mentioned purpose, the present application provides a SNP molecular marker related to the growth traits of Portunus trituberculatus, wherein the Portunus trituberculatus is Portunus trituberculatus in Bohai Sea, and the growth traits are two or more of the full carapace width, the carapace length, the body height or the body weight traits.

[0008] Specifically, the SNP molecular marker provided by the present application comprises 17 SNP molecular markers, which are SNP26101T>C, SNP366C>A, SNP4103G>A, SNP864A>G, SNP4582T>A, SNP2451752A>C, SNP1704A>G, SNP2177G>A, SNP448G>A, SNP93121G>A, SNP85860A>G, SNP457A>T, SNP3936G>T, SNP3148T>A, SNP11943T>C, SNP8952779T>C and SNP15785C>T.

[0009] The SNP26101T>C is located at the 162th position of the nucleotide sequence shown in SEQ ID NO.1, and the site is T / C.

[0010] The SNP366C>A is located at the 131th position of the nucleotide sequence shown in SEQ ID NO.2, and the site is C / A.

[0011] The SNP4103G>A is located at the 142th position of the nucleotide sequence shown in SEQ ID NO.3, and the site is G / A.

[0012] The SNP864A>G is located at the 48th position of the nucleotide sequence shown in SEQ ID NO.4, and the site is A / G.

[0013] The SNP4582T>A is located at the 77th position of the nucleotide sequence shown in SEQ ID NO.5, and the site is T / A.

[0014] The SNP2451752A>C is located at the 104th position of the nucleotide sequence shown in SEQ ID NO.6, and the site is A / C.

[0015] The SNP1704A>G is located at the 98th position of the nucleotide sequence shown in SEQ ID NO.7, and the site is A / G.

[0016] The SNP2177G>A is located at position 63 of the nucleotide sequence shown as SEQ ID NO. 8, and the site is G / A;

[0017] The SNP448G>A is located at position 107 of the nucleotide sequence shown as SEQ ID NO. 9, and the site is G / A;

[0018] The SNP93121G>A is located at position 50 of the nucleotide sequence shown as SEQ ID NO. 10, and the site is G / A;

[0019] The SNP85860A>G is located at position 155 of the nucleotide sequence shown as SEQ ID NO. 11, and the site is A / G;

[0020] The SNP457A>T is located at position 135 of the nucleotide sequence shown as SEQ ID NO. 12, and the site is A / T;

[0021] The SNP3936G>T is located at position 171 of the nucleotide sequence shown as SEQ ID NO. 13, and the site is G / T;

[0022] The SNP3148T>A is located at position 137 of the nucleotide sequence shown as SEQ ID NO. 14, and the site is T / A;

[0023] The SNP11943T>C is located at position 132 of the nucleotide sequence shown as SEQ ID NO. 15, and the site is T / C;

[0024] The SNP8952779T>C is located at position 100 of the nucleotide sequence shown as SEQ ID NO. 16, and the site is T / C;

[0025] The SNP15785C>T is located at position 131 of the nucleotide sequence shown as SEQ ID NO. 17, and the site is C / T.

[0026] The SNP molecular markers SNP26101T>C, SNP366C>A, SNP4103G>A, SNP864A>G, SNP4582T>A are all associated with the whole carapace width, carapace length, body height and body weight traits of Portunus trituberculatus, SNP2451752A>C, SNP1704A>G, SNP2177G>A, SNP448G>A, SNP93121G>A, SNP85860A>G, SNP457A>T, SNP3936G>T, SNP3148T>A, SNP11943T>C are all associated with the whole carapace width, carapace length and body weight traits of Portunus trituberculatus, SNP8952779T>C is associated with the body height and body weight traits of Portunus trituberculatus, and SNP15785C>T is associated with the carapace length and body weight traits of Portunus trituberculatus.

[0027] The application also provides a primer for detecting the SNP molecular markers of the application, which are as follows:

[0028] SNP26101T>C-F: the sequence is shown as SEQ ID NO. 18, and SNP26101T>C-R: the sequence is shown as SEQ ID NO. 19;

[0029] SNP366C>A-F: the sequence is shown as SEQ ID NO. 20, and SNP366C>A-R: the sequence is shown as SEQ ID NO. 21;

[0030] SNP4103G>A-F: the sequence is shown as SEQ ID NO. 22, and SNP4103G>A-R: the sequence is shown as SEQ ID NO. 23;

[0031] SNP864A>G-F: the sequence is shown as SEQ ID NO. 24, and SNP864A>G-R: the sequence is shown as SEQ ID NO. 25;

[0032] SNP4582T>A-F: the sequence is shown as SEQ ID NO. 26, and SNP4582T>A-R: the sequence is shown as SEQ ID NO. 27;

[0033] SNP2451752A>C-F: the sequence is shown as SEQ ID NO. 28, and SNP2451752A>C-R: the sequence is shown as SEQ ID NO. 29;

[0034] SNP1704A>G-F: the sequence is shown as SEQ ID NO. 30, and SNP1704A>G-R: the sequence is shown as SEQ ID NO. 31;

[0035] SNP2177G>A-F: the sequence is shown as SEQ ID NO. 32, SNP2177G>A-R: the sequence is shown as SEQ ID NO. 33;

[0036] SNP448G>A-F: the sequence is shown as SEQ ID NO. 34, SNP448G>A-R: the sequence is shown as SEQ ID NO. 35;

[0037] SNP93121G>A-F: the sequence is shown as SEQ ID NO. 36, SNP93121G>A-R: the sequence is shown as SEQ ID NO. 37;

[0038] SNP85860A>G-F: the sequence is shown as SEQ ID NO. 38, SNP85860A>G-R: the sequence is shown as SEQ ID NO. 39;

[0039] SNP457A>T-F: the sequence is shown as SEQ ID NO. 40, SNP457A>T-R: the sequence is shown as SEQ ID NO. 41;

[0040] SNP3936G>T-F: the sequence is shown as SEQ ID NO. 42, SNP3936G>T-R: the sequence is shown as SEQ ID NO. 43;

[0041] SNP3148T>A-F: the sequence is shown as SEQ ID NO. 44, SNP3148T>A-R: the sequence is shown as SEQ ID NO. 45;

[0042] SNP11943T>C-F: the sequence is shown as SEQ ID NO. 46, SNP11943T>C-R: the sequence is shown as SEQ ID NO. 47;

[0043] SNP8952779T>C-F: the sequence is shown as SEQ ID NO. 48, SNP8952779T>C-R: the sequence is shown as SEQ ID NO. 49;

[0044] SNP15785C>T-F: the sequence is shown as SEQ ID NO. 50, SNP15785C>T-R: the sequence is shown as SEQ ID NO. 51.

[0045] Specifically, the primer sequences of the SNP molecular markers are shown in the following table:

[0046] Table 1 Sequence information of SNP markers of Portunus trituberculatus

[0047]

[0048]

[0049] The application relates to a SNP molecular marker related to the growth traits of Portunus trituberculatus or a primer of the SNP molecular marker in the breeding or genetic breeding of the growth traits of Portunus trituberculatus. That is, one or more of the above-mentioned growth-related SNP molecular markers are selected for genotyping of breeding individuals, and individuals with dominant allele genotypes or individuals with more dominant allele genotypes are selected for breeding, so as to improve the growth speed of the full carapace width, carapace length, body height or body weight traits of the breeding individuals.

[0050] The specific steps include the following: (1) extracting genomic DNA of a sample to be analyzed; (2) using the SNP marker primer to perform multiplex PCR amplification and high-throughput sequencing with the genomic DNA as a template; and (3) performing correlation analysis of SNP genotype data and growth trait phenotype data.

[0051] When the SNP26101T>C marker primer is used to amplify the sample to be tested, if CC, TC and TT genotypes can be amplified, it is indicated that the sample to be tested is a Portunus trituberculatus strain with better full carapace width, carapace length, body height and body weight traits associated with the genotypes CC, TC and TT;

[0052] If the SNP366C>A marker primer can amplify AA, AC and CC genotypes, it is indicated that the sample to be tested is a Portunus trituberculatus strain with better full carapace width, carapace length, body height and body weight traits associated with the genotypes AA, AC and CC;

[0053] If the SNP4103G>A marker primer can amplify AA, AG and GG genotypes, it is indicated that the sample to be tested is a Portunus trituberculatus strain with better full carapace width, carapace length, body height and body weight traits associated with the genotypes AA, AG and GG;

[0054] If the SNP864A>G marker primer can amplify AA, AG and GG genotypes, it is indicated that the sample to be tested is a Portunus trituberculatus strain with better full carapace width, carapace length, body height and body weight traits associated with the genotypes AA, AG and GG;

[0055] If the SNP4582T>A marker primer can amplify CC, TC and TT genotypes, it is indicated that the sample to be tested is a Portunus trituberculatus strain with better full carapace width, carapace length, body height and body weight traits associated with the genotypes CC, TC and TT;

[0056] If the SNP2451752A>C marker primer can amplify AA, AC and CC genotypes, it indicates that the sample to be tested is a Portunus trituberculatus strain with better whole carapace width, back carapace length and body weight traits associated with genotypes AA, AC and CC;

[0057] If the SNP1704A>G marker primer can amplify AA, AG and GG genotypes, it indicates that the sample to be tested is a Portunus trituberculatus strain with better whole carapace width, back carapace length and body weight traits associated with genotypes AA, AG and GG;

[0058] If the SNP2177G>A marker primer can amplify AA, AG and GG genotypes, it indicates that the sample to be tested has significant association of whole carapace width, back carapace length and body weight traits with genotypes AA, AG and GG;

[0059] If the SNP448G>A marker primer can amplify AA, AG and GG genotypes, it indicates that the sample to be tested is a Portunus trituberculatus strain with better whole carapace width, back carapace length and body weight traits associated with genotypes AA, AG and GG;

[0060] If the SNP93121G>A marker primer can amplify AA, AG and GG genotypes, it indicates that the sample to be tested is a Portunus trituberculatus strain with better whole carapace width, back carapace length and body weight traits associated with genotypes AA, AG and GG;

[0061] If the SNP85860A>G marker primer can amplify AA, AG and GG genotypes, it indicates that the sample to be tested is a Portunus trituberculatus strain with better whole carapace width, back carapace length and body weight traits associated with genotypes AA, AG and GG;

[0062] If the SNP457A>T marker primer can amplify AA, AT and TT genotypes, it indicates that the sample to be tested is a Portunus trituberculatus strain with better whole carapace width, back carapace length and body weight traits associated with genotypes AA, AT and TT;

[0063] If the SNP3936G>T marker primer can amplify GG, TG and TT genotypes, it indicates that the sample to be tested is a Portunus trituberculatus strain with better whole carapace width, back carapace length and body weight traits associated with genotypes GG, TG and TT;

[0064] If the SNP3148T>A marker primer can amplify AA, AT and TT genotypes, it indicates that the sample to be tested is a Portunus trituberculatus strain with better whole carapace width, back carapace length and body weight traits associated with genotypes AA, AT and TT;

[0065] If the SNP11943T>C marker primer can amplify CC, TC and TT genotypes, it indicates that the sample to be tested is a Portunus trituberculatus strain with better whole carapace width, back carapace length and body weight traits associated with genotypes CC, TC and TT;

[0066] If the SNP8952779T>C marker primer can amplify TC and TT genotypes, it indicates that the sample to be tested is a Portunus trituberculatus strain with better body height and body weight traits associated with genotypes TC and TT.

[0067] If the SNP15785C>T marker primer can amplify CC, TC and TT genotypes, it indicates that the sample to be tested is a Portunus trituberculatus strain with better back carapace length and body weight traits associated with genotypes CC, TC and TT.

[0068] Compared with the prior art, the present application has the following beneficial effects:

[0069] (1) The present application provides a group of SNP molecular markers related to the growth traits of Portunus trituberculatus, which enriches the molecular marker genetic resource library of Portunus trituberculatus breeding by screening molecular marker sites related to the growth traits of Portunus trituberculatus.

[0070] (2) The 17 SNP molecular markers provided by the present application are associated with the growth traits of Portunus trituberculatus, and are more in number, stable in PCR amplification, and can be effectively used for the growth trait breeding or genetic breeding of Portunus trituberculatus.

[0071] (3) The present application provides a group of SNP molecular markers related to the growth traits of Portunus trituberculatus, which enriches the molecular marker genetic resource library of Portunus trituberculatus breeding by screening molecular marker sites related to the growth traits of Portunus trituberculatus. DETAILED DESCRIPTION

[0072] The present application will be described in detail below with reference to the examples, so as to facilitate the understanding of the present application by those skilled in the art. It is necessary to point out here that the examples are only used to further illustrate the present application and cannot be understood as limiting the protection scope of the present application. The skilled person in the art can make non-essential improvements and adjustments to the present application according to the above description, which should still fall within the protection scope of the present application. Meanwhile, the raw materials mentioned below are not described in detail, which are all commercially available products; the process steps or preparation methods not mentioned in detail are all known to those skilled in the art.

[0073] Obtaining of SNP molecular markers related to growth traits of Portunus trituberculatus

[0074] (1) Sample source of Portunus trituberculatus and measurement of growth trait phenotype values

[0075] The samples of Portunus trituberculatus were derived from three full-sibling families. The materials were collected in August 2022 at the National Portunus trituberculatus Seed Field in Huanghua City, Hebei Province, and a total of 150 Portunus trituberculatus were collected. After collection, the growth traits of each Portunus trituberculatus sample were measured, including four important growth traits: total carapace width, carapace length, body height, and body weight. The average values were total carapace width: 144.57 ± 14.22 mm, carapace length: 66.38 ± 7.97 mm, body height: 34.52 ± 3.4 mm, and body weight: 166.14 ± 56.24 g.

[0076] Total carapace width: the straight-line distance between the outermost lateral teeth;

[0077] Carapace length: the straight-line distance from the middle of the interocular distance to the lowermost end of the abdomen;

[0078] Body height: the straight-line distance from the middle of the abdomen to the middle of the carapace;

[0079] Body weight: the wet weight of the whole body, and the surface water was absorbed with filter paper before weighing.

[0080] (2) Extraction and detection of genomic DNA of Portunus trituberculatus samples

[0081] The muscle tissue DNA of the above-mentioned 150 Portunus trituberculatus individuals was extracted using the Marine Animal Genomic Extraction Kit (Tiangen, Beijing), and the specific operation steps are described in the kit instructions. The concentration of DNA from each individual was determined using the NanoDrop 2000 nucleic acid concentration detector, and the quality and integrity of the DNA were detected by 1% agarose gel electrophoresis. All individual DNAs were diluted to 50 ng / μl for standby.

[0082] (3) Development and genotyping of SNP markers

[0083] The DNA samples of 270 individuals were sent to Hangzhou Lianchuan Biotechnology Co., Ltd. The method of GBS was used to perform whole-genome simplified sequencing on all individuals, and the reference genome of Portunus trituberculatus (ASM1759143v1 version) was used for analysis and comparison to discover SNPs. According to the minimum allele frequency (MAF) > 0.05 and the call rate > 70%, the data was filtered, and a total of 49 candidate SNP markers were screened.

[0084] DNA samples of 150 Portunus trituberculatus and information of 49 candidate SNP markers were sent to Shanghai Wing Applied Biotechnology Co., Ltd. for specific primer design, high-throughput sequencing and genotyping. The specific steps included: taking the DNA of the sample to be tested as a template, adding the corresponding PCR amplification primer pair and single base extension primer for PCR amplification reaction, after three rounds of PCR amplification, the amplicon was subjected to high-throughput sequencing. After multiple PCR agarose electrophoresis, fluorescence quantitative PCR quality control and sequencing quality control, the sequencing results were distinguished to obtain the mutation information of each site in each sample.

[0085] (4) Association analysis of SNP markers and growth traits

[0086] The general linear model (GLM) in TASSEL2.1 software was used to analyze the correlation between different SNP molecular markers and the growth traits (total carapace width, carapace length, body height and body weight) of Portunus trituberculatus. First, the Q value of 150 Portunus trituberculatus samples was calculated by using the STRUCTURE software and CLUMPP software. Then the Q value of each sample was used as a covariate, and the P value less than 0.05 was used as a significant marker.

[0087] Through the above correlation analysis, 17 SNP markers significantly associated with the growth traits of Portunus trituberculatus were finally screened out. As shown in Table 2, SNP molecular markers SNP26101T>C, SNP366C>A, SNP4103G>A, SNP864A>G and SNP4582T>A were significantly related to the total carapace width, carapace length, body height and body weight traits of Portunus trituberculatus; SNP molecular markers SNP2451752A>C, SNP1704A>G, SNP2177G>A, SNP448G>A, SNP93121G>A, SNP85860A>G, SNP457A>T, SNP3936G>T, SNP3148T>A and SNP11943T>C were significantly related to the total carapace width, carapace length and body weight traits of Portunus trituberculatus; SNP molecular marker SNP8952779T>C was related to the body height and body weight traits of Portunus trituberculatus, and SNP molecular marker SNP15785C>T was related to the carapace length and body weight traits of Portunus trituberculatus.

[0088] Table 2 Correlation of SNP molecular markers and growth traits of Portunus trituberculatus

[0089]

[0090] Note: * indicates significant difference (P<0.05).

[0091] (5) Multiple comparison of growth traits between different genotypes of SNP sites

[0092] The SPSS software was used for multiple comparison (LSD) of the four growth trait phenotypic values among different genotypes of the above 17 SNP markers significantly associated with growth traits, and the multiple comparison results are shown in Table 3.

[0093] Table 3 Multiple comparison of growth traits among different genotypes of SNP markers

[0094]

[0095]

[0096]

[0097] Note: The values in the table are mean ± standard error, and the same row with different letters represent significant difference (P<0.05).

[0098] From the above data, it can be seen that the growth traits among different genotypes of SNP molecular markers SNP26101T>C, SNP4582T>A and SNP457A>T have significant differences. Specifically as follows:

[0099] The CC genotype individuals, TC genotype individuals and TT genotype individuals of the SNP molecular marker SNP26101T>C have significant differences in the four growth traits, and the average of the full carapace width, carapace length, body height and body weight of the CC and TC genotype individuals are significantly higher than that of the TT genotype individuals; as for the carapace length and body height, the CC genotype individuals and the TC genotype individuals have significant differences, and the average of the carapace length and body height of the CC genotype individuals is significantly higher than that of the TC genotype individuals. It is shown that the CC genotype is the dominant genotype, and the allele C has an important positive effect on the four growth traits of the full carapace width, carapace length, body height and body weight of the Portunus trituberculatus, while the allele T has a negative effect on the four growth traits of the full carapace width, carapace length, body height and body weight.

[0100] The TC genotype individuals and the TT genotype individuals of the SNP molecular marker SNP4582T>A have significant differences in the four growth traits, and the average of the full carapace width, carapace length, body height and body weight of the TC genotype individuals is significantly higher than that of the TT genotype individuals, indicating that the TC genotype is the dominant genotype, and the allele C is superior to the allele T, and has a positive effect on the four growth traits of the full carapace width, carapace length, body height and body weight of the Portunus trituberculatus.

[0101] The AT genotype individuals and the TT genotype individuals of the SNP molecular marker SNP457A>T have significant differences in the carapace length, and the average of the carapace length of the AT genotype individuals is greater than that of the TT genotype individuals, which indicates that the positive effect of the allele A on the carapace length trait of the Portunus trituberculatus is superior to that of the allele T.

[0102] Therefore, the 17 SNP molecular markers provided by the application have different degrees of relevance with the full carapace width, carapace length, body height and body weight traits of Portunus trituberculatus: the SNP molecular markers SNP26101T>C, SNP366C>A, SNP4103G>A, SNP864A>G and SNP4582T>A can be used as ideal markers for the breeding of Portunus trituberculatus in which the full carapace width, carapace length, body height and body weight are breeding objectives; the SNP molecular markers SNP2451752A>C, SNP1704A>G, SNP2177G>A, SNP448G>A, SNP93121G>A, SNP85860A>G, SNP457A>T, SNP3936G>T, SNP3148T>A and SNP11943T>C can be used as ideal markers for the breeding of Portunus trituberculatus in which the full carapace width, carapace length and body weight are breeding objectives; the SNP molecular marker SNP8952779T>C can be used as an ideal marker for the breeding of Portunus trituberculatus in which the body height and body weight are breeding objectives; and the SNP molecular marker SNP15785C>T can be used as an ideal marker for the breeding of Portunus trituberculatus in which the carapace length and body weight are breeding objectives.

[0103] The CC genotype individual in the SNP molecular marker SNP26101T>C and the TC genotype individual in the marker SNP4582T>A can be used as ideal parents for the breeding of Portunus trituberculatus and applied to practice for breeding.

[0104] Example 2: Application of the SNP molecular marker SNP26101T>C in genetic breeding

[0105] (1) Breeding material source

[0106] The population (Portunus trituberculatus in Bohai) used for analysis was collected from a national Portunus trituberculatus original seed field in Huanghua City, Hebei Province, and the population was mixed from multiple families and had the same breeding environment; 200 individuals were randomly selected after being bred for 4 months as breeding sources.

[0107] (2) Sample DNA extraction

[0108] The muscle tissue DNA of the above 200 individuals was extracted using a marine animal genome extraction kit (Tiangen, Beijing), and the specific operation steps refer to the kit instruction manual; the DNA concentration of each individual was determined by using a nucleic acid concentration detector Nano Drop 2000, and the quality and integrity of the DNA were detected by 1% agarose gel electrophoresis; and the DNA of all individuals was diluted to 50 ng / μl for standby.

[0109] (3) Marking typing of SNP26101T>C

[0110] The target sequence is amplified using the extension primer SNP26101T>C-F: CACAATAACATCGTTTTTCGCAG and SNP26101T>C-R: CTATTCAATTGACCCGGACTTGAC, the sequencing primer SNP26101T>C-F is used for high-throughput sequencing of the amplified product, the SNP genotyping result of SNP26101T>C is obtained, and the genotype of the target SNP site is determined according to the sequencing peak map. If there is only one T base peak at this position, the typing result is TT type, if there is only one C base peak, the typing result is CC type, and if there are both T base peak and C base peak at this position, the typing result is TC type.

[0111] (4) SNP26101T>C marker selection result

[0112] According to the genotypes of 200 individuals, the individuals are selected, and the individuals with CC genotype amplified by the SNP26101T>C marker primer are selected for seed saving.

[0113] The TT genotype, CC genotype and TC genotype individuals of the SNP26101T>C site of the determination individual are measured for full nail width, nail length, body height and body weight, respectively, and the measurement results are shown in Table 4. The average values of full nail width, nail length, body height and body weight of the CC genotype individuals are significantly higher than the average values of the corresponding traits of the other two genotypes. The selection of the CC genotype of the site can significantly improve the breeding effect of growth traits.

[0114] Table 4 Average values of three genotypes of SNP26101T>C site in mixed population

[0115]

[0116] This embodiment uses SNP site SNP26101T>C as an example to illustrate the use of the growth-related marker of the patent, and the use method of other sites is similar to the marker.

[0117] Although the present application has been described in detail through specific embodiments and experiments, some modifications or improvements can be made on the basis of the present application, which is obvious to those skilled in the art. Therefore, these modifications or improvements made on the basis of not deviating from the spirit of the present application, all belong to the scope of the present application.

Claims

1. A group of SNP molecular markers related to growth traits of Portunus trituberculatus, characterized in that: The swimming crab is a Bohai swimming crab, and the SNP molecular markers include 17 SNP molecular markers, namely SNP26101T>C, SNP366C>A, SNP4103G>A, SNP864A>G, SNP4582T>A, SNP2451752A>C, SNP1704A>G, SNP2177G>A, SNP448G>A, SNP93121G>A, SNP85860A>G, SNP457A>T, SNP3936G>T, SNP3148T>A, SNP11943T>C, SNP8952779T>C and SNP15785C>T; The nucleotide sequence of SNP26101T>C is shown in SEQ ID NO.1, wherein the 162nd position is T / C; The nucleotide sequence of SNP366C>A is shown in SEQ ID NO.2, wherein position 131 is C / A; The nucleotide sequence of SNP4103G>A is shown in SEQ ID NO.3, wherein the 142nd position is G / A; The nucleotide sequence of SNP864A>G is shown in SEQ ID NO.4, wherein the 48th position is A / G; The nucleotide sequence of SNP4582T>A is shown in SEQ ID NO.5, wherein the 77th position is T / A; The nucleotide sequence of SNP2451752A>C is shown in SEQ ID NO.6, wherein the 104th position is A / C; The nucleotide sequence of SNP1704A>G is shown in SEQ ID NO.7, wherein the 98th position is A / G; The nucleotide sequence of SNP2177G>A is shown in SEQ ID NO.8, wherein the 63rd position is G / A; The nucleotide sequence of SNP448G>A is shown in SEQ ID NO.9, wherein the 107th position is G / A; The nucleotide sequence of SNP93121G>A is shown in SEQ ID NO.10, wherein the 50th position is G / A; The nucleotide sequence of SNP85860A>G is shown in SEQ ID NO.11, wherein the 155th position is A / G; The nucleotide sequence of SNP457A>T is shown in SEQ ID NO.12, wherein the 135th position is A / T; The nucleotide sequence of SNP3936G>T is shown in SEQ ID NO.13, wherein the 171st position is G / T; The nucleotide sequence of SNP3148T>A is shown in SEQ ID NO.14, wherein position 137 is T / A; The nucleotide sequence of SNP11943T>C is shown in SEQ ID NO.15, wherein position 132 is T / C; The nucleotide sequence of SNP8952779T>C is shown in SEQ ID NO.16, wherein the 100th position is T / C; The nucleotide sequence of SNP15785C>T is shown in SEQ ID NO.17, wherein the 131st position is C / T.

2. A set of SNP molecular markers related to growth traits of Portunus trituberculatus according to claim 1, characterized in that: SNP26101T>C, SNP366C>A, SNP4103G>A, SNP864A>G, and SNP4582T>A are all associated with the total carapace width, carapace length, body height and weight traits of swimming crab, SNP2451752A>C, SNP1704A>G, SNP2177G>A, SNP448G>A, SNP93121G>A, SNP85860A>G, SNP457A>T, SNP3936G>T, SNP3148T>A, and SNP11943T>C are all associated with the total carapace width, carapace length and weight traits of swimming crab, SNP8952779T>C is associated with the body height and weight traits of swimming crab, and SNP15785C>T is associated with the carapace length and weight traits of swimming crab.

3. A set of primers for detecting SNP molecular markers related to the growth traits of the swimming crab (Portunus trituberculatus) according to claim 1, characterized in that: Includes 17 pairs of SNP primers, namely: SNP26101T>CF: sequence as shown in SEQ ID NO.18, SNP26101T>CR: sequence as shown in SEQ ID NO.19; SNP366C>AF: sequence as shown in SEQ ID NO.20, SNP366C>AR: sequence as shown in SEQ ID NO.21; SNP4103G>AF: sequence as shown in SEQ ID NO.22, SNP4103G>AR: sequence as shown in SEQ ID NO.23; SNP864A>GF: the sequence is shown in SEQ ID NO.24, SNP864A>GR: the sequence is shown in SEQ ID NO.25; SNP4582T>AF: sequence as shown in SEQ ID NO.26, SNP4582T>AR: sequence as shown in SEQ ID NO.27; SNP2451752A>CF: sequence as shown in SEQ ID NO.28, SNP2451752A>CR: sequence as shown in SEQ ID NO.29; SNP1704A>GF: sequence shown in SEQ ID NO.30, SNP1704A>GR: sequence shown in SEQ ID NO.31; SNP2177G>AF: sequence as shown in SEQ ID NO.32, SNP2177G>AR: sequence as shown in SEQ ID NO.33; SNP448G>AF: sequence as shown in SEQ ID NO.34, SNP448G>AR: sequence as shown in SEQ ID NO.35; SNP93121G>AF: sequence as shown in SEQ ID NO.36, SNP93121G>AR: sequence as shown in SEQ ID NO.37; SNP85860A>GF: sequence as shown in SEQ ID NO.38, SNP85860A>GR: sequence as shown in SEQ ID NO.39; SNP457A>TF: sequence shown in SEQ ID NO.40, SNP457A>TR: sequence shown in SEQ ID NO.41; SNP3936G>TF: sequence shown in SEQ ID NO.42, SNP3936G>TR: sequence shown in SEQ ID NO.43; SNP3148T>AF: sequence as shown in SEQ ID NO.44, SNP3148T>AR: sequence as shown in SEQ ID NO.45; SNP11943T>CF: sequence as shown in SEQ ID NO.46, SNP11943T>CR: sequence as shown in SEQ ID NO.47; SNP8952779T>CF: sequence as shown in SEQ ID NO.48, SNP8952779T>CR: sequence as shown in SEQ ID NO.49; SNP15785C>TF: the sequence is shown as SEQ ID NO.50, SNP15785C>TR: the sequence is shown as SEQ ID NO.

51.

4. Use of the SNP molecular marker according to claim 1 in growth trait breeding and genetic breeding of Portunus trituberculatus.

5. Use of the primers for the SNP molecular markers according to claim 3 in growth trait breeding and genetic breeding of Portunus trituberculatus.