Method for directionally breeding mutant hybrid rice parents

Abstract

The invention relates to the field of hybrid rice breeding, and discloses a method for directionally breeding mutant hybrid rice parents. According to the method, mutation tillering is accurately positioned in the M1 tillering stage through the KASP technology, and a directional pollination / harvesting strategy is combined, so that the genetic bottleneck caused by chimeras and low fertility (especially sterile lines) is effectively overcome, the mutation transmission efficiency is maximized, and the M1 generation mutation transmission efficiency is remarkably improved. Through early accurate identification and efficient propagation of the M1 generation, homozygotes can be obtained and screened from the M2 generation, and compared with a traditional process, the method has the advantages that the obtaining process of low-cadmium homozygous parents is obviously accelerated, and the breeding period is greatly shortened. Heavy ion mutagenesis, targeted sequencing, high-throughput KASP typing and directional propagation technologies are integrated, and the whole process from mutagenesis to obtaining of the homozygous low-cadmium parent is rapid, accurate and efficient.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of hybrid rice breeding, and particularly relates to a method for rapidly and efficiently creating and screening a rice Cd (cadmium) low-accumulation mutant parent and using the same to breed a new hybrid rice variety with high yield, high quality and low cadmium. BACKGROUND

[0002] Breeding and promoting the planting of rice varieties with low cadmium accumulation is the most economical, effective and sustainable fundamental approach to cope with soil cadmium pollution and ensure the quality and safety of rice. Modern molecular biology research has revealed that the absorption and transport of cadmium by rice are precisely regulated by a series of genes. Among them, the OsNramp5 gene (Natural resistance-associated macrophage protein 5, commonly used gene identification number such as Os07g0257200, LOC_Os07g15370) located on chromosome 7 of rice has been confirmed to be the main transporter gene for absorbing divalent cations (including Cd²⁺ and essential element Mn²⁺) from soil by rice roots, mainly expressed in root epidermis and outer cortex cells. A large number of studies have shown that mutations that induce or edit loss-of-function or significantly weaken the function of the OsNramp5 gene can significantly reduce the absorption efficiency of cadmium by rice roots, and in turn significantly reduce the cadmium content in the aboveground parts and grains of rice (the reduction usually can reach more than 90%). This makes the OsNramp5 gene one of the most important and most widely used functional target genes in molecular breeding of low-cadmium rice.

[0003] To create functional mutants of OsNramp5 gene, researchers have adopted various technical means. Gene editing technology (such as CRISPR / Cas9) can achieve site-specific and efficient editing of OsNramp5 gene, quickly obtaining the target mutant. However, the commercial application of genetically edited crops still faces complex regulations of genetically modified organisms safety in many countries and regions. In order to avoid the restrictions of transgenic regulations, researchers turn to traditional mutagenesis breeding technology, using physical (such as gamma rays, heavy ion beams, proton beams, etc.) or chemical (such as EMS, etc.) mutagen to treat rice seeds or tissues, and randomly induce genome mutations. The first generation (M1) population produced by mutagenesis contains all the mutation information generated by this mutagenesis, and theoretically contains the most abundant mutation types and the smallest required population size. In recent years, with the development of high-throughput sequencing technology, especially the significant reduction in cost of targeted capture sequencing technology (Targeted Capture Sequencing), it has become a technically feasible strategy to directly sequence the target gene (such as OsNramp5) of large-scale M1 population to quickly identify mutants. And there are several research reports or patent applications that have disclosed successful cases of obtaining low-cadmium rice (including OsNramp5 mutants) by targeted sequencing of M1 generation.

[0004] However, although targeted sequencing in M1 generation can directly detect newly generated mutation information, this strategy still has key bottlenecks and defects in actual breeding applications, and has not completely solved the problem of breeding efficiency. First, M1 plants after mutagenesis treatment usually exhibit chimeric characteristics, that is, the target mutation only occurs in part of the plant's tissues or cell lineages of tillers, and not all reproductive cells carry the mutation, which brings uncertainty to the stable inheritance of the mutation. Second, mutagenesis treatment itself (especially physical mutagenesis) often causes physiological damage to M1 plants, resulting in reduced fertility, significantly reduced seed setting rate, or even complete sterility. These factors superimpose each other, so that even if the plants carrying the target mutation are identified in the M1 generation by sequencing, it may be difficult to obtain a sufficient number of M2 generation seeds that actually carry the mutation due to chimeric traits or low fertility. This problem is particularly severe for two-line sterile line materials (key parent of hybrid rice) that require cross-pollination for seed setting. The low efficiency of mutation transmission may lead to the loss of valuable mutant resources. Conventional methods such as cutting the base of M1 plants (leaving stubble) to promote regenerative tillering to increase seed setting not only complicate management and time-consuming, but also have low success rate, which still severely restricts the breeding process.

[0005] It is particularly important to note that ensuring food production is always the primary goal of rice breeding. In recent years, hybrid rice combinations represented by "Liangliangyou 8022" have repeatedly broken yield records due to their outstanding yield potential. The core parents of these combinations, the sterile line "Liang 68S" and the restorer line "R8022", are extremely valuable breeding resources. How to efficiently introduce the low-cadmium accumulation trait into these excellent parents (for example, by creating a new OsNramp5 loss-of-function mutation) while maintaining or further improving their high-yield and high-quality characteristics, and achieving the synergy of "high yield" and "food safety", poses higher requirements for breeding methods.

[0006] In summary, there is an urgent need in the art for a new breeding method that not only can take advantage of modern sequencing technology to discover low-cadmium mutations produced by mutagenesis in early generations (M1), but also can effectively overcome the genetic bottleneck caused by M1 chimerism and low fertility, and achieve efficient and stable transmission of target mutations and rapid acquisition of homozygous offspring through innovative breeding strategies, thereby accelerating the selection of low-cadmium rice parents with excellent comprehensive traits, and ultimately serving the rapid creation of new hybrid rice varieties with high yield, high quality, and safety. SUMMARY

[0007] The present application mainly solves the technical problems of low mutation transmission efficiency, difficulty in obtaining offspring, long breeding cycle, and loss of valuable mutant resources caused by the chimerism of M1 generation and low fertility caused by mutagenesis (especially for sterile line materials) when improving excellent rice parents (such as the parents of "Liangliangyou 8022", Liang 68S and R8022) using mutagenesis technology. The present application provides a method combining early molecular identification and innovative directional breeding strategies to significantly improve the genetic efficiency of M1 generation mutations to M2 generation, thereby rapidly obtaining homozygous low-cadmium mutant parents and accelerating the breeding process of high-yield and safe hybrid rice new varieties.

[0008] To solve the above technical problems, the technical scheme provided by the present application is as follows: A method for directional breeding of mutant hybrid rice parents, comprising the following steps: (1) Selecting hybrid rice parent combination seeds, the parent combination seeds including a two-line sterile line and a restorer line, each material being at least 1000 or more, and performing heavy ion irradiation mutagenesis treatment to obtain M1 generation seeds, and planting to obtain an M1 generation plant population; (2) At the tillering stage of the M1 generation plants, an equal amount of mixed DNA is prepared to construct a pool sample for targeted capture sequencing of target genes, and candidate mutant pools carrying target gene mutations are identified; (3) For each target mutation site identified in step (2), a KASP molecular marker primer combination capable of distinguishing between wild-type and mutant alleles is designed and verified; (4) In the candidate mutation pool in step (2), the M1 plants carrying the mutation of the target gene are identified by using the KASP molecular marker primer combination in (3), and each tiller is sampled at the tillering peak to the jointing stage. Then the tiller samples are treated by using the DNA extraction method, and genotyped by using the KASP molecular marker primer combination in step (3), so as to identify and mark the specific tiller carrying the mutation of the target gene. At the heading and flowering stage, directional propagation operation is carried out according to the parent type, and the M2 generation seeds of the specific tiller carrying the mutation of the target gene which has undergone directional propagation operation are harvested. (5) The M2 generation seeds obtained in step (4) are planted, and the DNA is extracted at the seedling stage of the M2 generation, and genotyped by using the KASP molecular marker primer combination in step (3), so as to screen out the homozygous plants and / or heterozygous plants of the target gene mutation. (6) The improved hybrid rice combination F1 generation seeds are obtained by hybridizing the identified mutation homozygous sterile line and the mutation homozygous restorer line. If the mutation sterile line and the mutation restorer line identified in step (5) are both heterozygous or one of them is heterozygous, the mutation sterile line and the mutation restorer line are hybridized to obtain the improved hybrid rice combination F1 generation seeds in the F1 population by using the KASP molecular marker primer combination to screen the double allelic mutation.

[0009] Although the mutation induced by heavy ion irradiation is random, a large enough sample (M1 generation heavy ion mutagenesis population of more than 1000 plants) is constructed, that is, a saturated mutation population is obtained, and each type of random mutation in the target gene region can be identified by detecting the mutation in the target gene region, combined with the phenotype controlled by the target gene, and then the mutant hybrid rice parent can be cultivated and screened. Therefore, the technical scheme of the present application has reproducibility.

[0010] The above-mentioned method for directional breeding of mutant hybrid rice parents further comprises that, in step (1), the parent combination seeds include a low-cadmium two-line sterile line 68S and a low-cadmium restorer line R8022.

[0011] Further, in step (1), the heavy ion irradiation mutagenesis treatment adopts ¹²C 6 ⁺ heavy ion irradiation, and the dose is 80-180 Gy.

[0012] Further, in step (2), when the equal amount of mixed DNA is constructed into a pool sample, a single pool contains 100-1000 plants.

[0013] Further, in step (2), the target gene is an OsNramp5 gene.

[0014] Further, in step (4), the DNA extraction method is an alkali lysis method.

[0015] Further, in steps (3), (4), the KASP reaction system for genotyping: 5 muL 2x KASP Master Mix, 0.14 muL KASP Assay Mix, 1-3 muL template DNA 10-50 ng, and nuclease-free water to 10 muL.

[0016] Further, in step (4), the directional propagation operation specifically includes the following steps: when the pistil stigma is extended, manually pollinate with freshly collected wild type pollen (pollen from a low temperature treated wild type for a two-line sterile line), pollinate 2-3 times per ear, and immediately cover with a paper bag.

[0017] Compared with the prior art, the beneficial effects of the present application are: 1. The core innovation of the present application is to accurately locate the mutant tillering at the M1 tillering stage through KASP technology, and combine with the directional pollination / harvesting strategy, effectively overcome the genetic bottleneck caused by chimeras and low fertility (especially sterile lines), maximize the mutation transmission efficiency, and significantly improve the M1 generation mutation transmission efficiency.

[0018] 2. The present application can obtain and screen homozygotes through early accurate identification and efficient propagation of M1 generation, which significantly accelerates the process of obtaining low-cadmium homozygous parents compared with the traditional process, and greatly shortens the breeding cycle.

[0019] 3. The present application integrates heavy ion mutagenesis, targeted sequencing, high-throughput KASP typing and directional propagation technology, does not limit the mutation site, realizes the whole process of rapid, accurate and efficient from mutagenesis to obtain homozygous low-cadmium parents, and has reproducible operation.

[0020] 4. The present application can quickly realize the directional improvement of low-cadmium traits of excellent parents of top hybrid rice combinations such as "Liangliangyou 8022", which is helpful for cultivating new generation hybrid rice varieties with "high yield + safety". BRIEF DESCRIPTION OF DRAWINGS

[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiment or prior art description. Obviously, the drawings in the following description are some embodiments of the present application, and those skilled in the art can also obtain other drawings according to these drawings without creative labor.

[0022] Figure 1 It is the technical roadmap of embodiment 1.

[0023] Figure 2Cd content of CdCl2-treated grain two 8022-lcd and original hybrid rice variety "grain two 8022"; wherein A is the stem and leaf Cd content, and B is the root Cd content.

[0024] Figure 3 Cd content of grain of grain two 8022-lcd and original hybrid rice variety "grain two 8022". DETAILED DESCRIPTION

[0025] For the convenience of understanding the present application, the present application will be described more fully below with reference to the accompanying drawings and preferred embodiments of the application, but the scope of protection of the present application is not limited to the following specific embodiments.

[0026] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. The professional terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the scope of protection of the present application.

[0027] Unless otherwise specifically indicated, various materials, reagents, instruments and equipment used in the present application can be purchased on the market or can be prepared by existing methods.

[0028] A method for directional breeding of low-cadmium hybrid rice parents, the technical roadmap is shown in Figure 1 , comprising the following steps: 1. Mutagenic treatment and M1 population construction: select high-yield and high-quality hybrid rice parent seeds, the parent includes a two-line sterile line (for example, "grain 68S") and a restoration line (for example, "R8022"), and the parent is subjected to heavy ion irradiation mutagenic treatment to obtain M1 generation seeds; plant M1 generation seeds to obtain M1 generation plant population.

[0029] 2. Early mutation detection of M1 generation: at the tillering stage of M1 generation plants, 500 M1 plants are mixed to construct a DNA pool sample for targeted capture sequencing of target genes (preferably OsNramp5 gene), and candidate mutant pools carrying target gene mutations are identified. 3. KASP marker development and verification: for each target mutation site identified in step 2, a KASP molecular marker primer combination capable of distinguishing between wild type and mutant alleles is designed and verified. 4. M1 generation mutation tiller accurate identification and directional efficient propagation: (a) For the M1 candidate plants carrying target mutations in the candidate mutant pools in step 2, use the KASP molecular marker primer combination in step 3 to identify the M1 candidate plants carrying target mutations, and sample each tiller (for example, collect a small amount of young leaves or tissues at the base of the tiller) at the tillering stage to the jointing stage. (b) The tiller samples are treated with a rapid DNA extraction method, and the corresponding KASP markers developed in step 3 are used for genotyping to accurately identify and mark the specific tiller carrying the target mutation (mutant tiller); (c) The marked mutant tiller is given special management, and during its heading and flowering stage, the following directional breeding operation is performed according to the parent type to maximize the mutation transmission efficiency; (c1) For sterile line M1 mutant plants (such as Li68S mutant): the pistil of the marked mutant tiller is artificially pollinated with pollen of wild-type sterile line (such as wild-type Li68S) with basically consistent flowering period, and is protected by bagging. After maturation, the M2 generation seeds on the mutant tiller artificially pollinated are harvested; (c2) For restorer line M1 mutant plants (such as R8022 mutant): the pistil of the marked mutant tiller is artificially pollinated with pollen of wild-type restorer line (such as wild-type R8022) with basically consistent flowering period, and is protected by bagging. After maturation, the M2 generation seeds on the mutant tiller artificially pollinated are harvested.

[0030] 5. M2 generation screening and homozygous / heterozygous line identification: (a) The M2 generation population seeds obtained in step 4(c) are planted.

[0031] (b) DNA is extracted from the M2 generation seedling stage samples, and the corresponding KASP markers are used for genotyping to screen homozygous plants (M1 mutant self-pollination) and / or heterozygous plants (M1 mutant cross-pollination with wild type) of the target low-cadmium mutation.

[0032] 6. Low-cadmium hybrid combination preparation and evaluation: (a) Preferably, the mutant homozygous sterile line (such as Li68S-lcd) and the mutant homozygous restorer line (such as R8022-lcd) identified in steps 4 and 5 are used for hybrid seed production to obtain improved hybrid rice combination F1 generation seeds (such as "Li two excellent 8022-lcd"); compared with the original hybrid rice combination (such as "Li two excellent 8022"), the mutant phenotype, yield and comprehensive agronomic traits are evaluated.

[0033] (b) If neither is heterozygous nor one is heterozygous in steps 4 and 5, the mutant sterile line (such as Li68S-lcd) and the mutant restorer line (such as R8022-lcd) are used for hybrid seed production, and in the F1 population, KASP markers are used to screen double alleles to obtain improved hybrid rice combination F1 generation seeds (such as "Li two excellent 8022-lcd"); compared with the original hybrid rice combination (such as "Li two excellent 8022"), the improved phenotype, yield and comprehensive agronomic traits are evaluated.

[0034] Example 1: Rapidly obtaining a low-cadmium sterile line Li68S-lcd and a restoration line R8022-lcd 1. Mutagenic treatment: 500 g of dry seeds of rice sterile line "Li68S" and restoration line "R8022" were sent to the Space Environment Simulation Research Institute (SESRI) of Harbin Institute of Technology for 12C 6 ⁺ heavy ion irradiation at a dose of 150 Gy. M1 seeds were obtained.

[0035] 2. M1 planting and targeted sequencing: M1 seeds were transplanted to the field after routine seedling raising in the Hainan Lingshui Breeding Base, and the M1 population was obtained. Young leaves were collected at the tillering stage, and DNA was extracted using the CTAB method. DNA sample pools (one mixed pool for every 500 plants) were constructed. Targeted capture sequencing of the OsNramp5 gene was performed, with an average sequencing depth of >50,000X. The CleanData obtained by sequencing was compared with the Nipponbare reference genome (IRGSP-1.0), and SNP and Indel variation detection was performed using bioinformatics software such as GATK, Samtools, and Freebayes. Bioinformatics analysis found that: (1) In the 27th mixed pool of Li68S M1, a 1bp (T) deletion was identified downstream of 8875112, i.e. Chr07:g.8875112delT; (2) In the 52nd mixed pool of R8022 M1, a 4bp (CCAG) deletion was identified downstream of 8875181, i.e. Chr07:g.8875181delCCAG.

[0036] The protein sequence of the mutated sterile line "Li68S" (as shown in SEQ No. 1): MEIERESSERGSISWRASAAHDQDAKKLDADDQLLMKEPAWKRFLAHVGPGFMVSLAYLDPGNLETDLQAGANHRYELLWVILIGLIFALIIQSLAANLGVVTGRHLAEICKSEYPKFVKIFLWLLAELAVIAADIPEVIGTAFAFNILFHIPVWVGVLITGTSTLLLLGLQKYGVRKLEFLISMLVFVMAACFFGELSIVKPPAKEVMKGLFIPRLNGDGATADAIALLGALVMPHNLFLHSALVLSRKTPASVRGIKDGCRFFLYESGFALFVALLINIAVVSVSGTACSSANLSQEDADKCANLSLDTSSFLLKNVLGKSSAIVYGVALLASGQSSTITGHTLDSTSCRVSWTSG*.

[0037]

[0038] Protein sequence of the restored "R8022" mutant (as shown in SEQ No. 3): MEIERESSERGSISWRASAAHDQDAKKLDADDQLLMKEPAWKRFLAHVGPGFMVSLAYLDPGNLETDLQAGANHRYELLWVILIGLIFALIIQSLAANLGVVTGRHLAEICKSEYPKFVKIFLWLLAELAVIAADIPEVIGTAFAFNILFHIPVWVGVLITGTSTLLLLGLQKYGVRKLEFLISMLVFVMAACFFGELSIVKPPAKEVMKGLFIPRLNGDGATADAIALLGALVMPHNLFLHSALVLSRKTPASVRGIKDGCRFFLYESGFALFVALLINIAVVSVSGTACSSANLSQEDADKCANLSLDTSSFLLKNVASRVRSCTAWHCWHLGRAPLLPAHTLDSTSCRVSWTSG*.

[0039]

[0040] 3. KASP marker development: (1) For the mutation in the 68S background, a KASP primer (labeled as lcd8875112, as shown in SEQ NOS. 5-7) was designed: lcd8875112-FAM (WT): GAAGGTGACCAAGTTCATGCTCAGAGCTCCACTATTACCGGCA; lcd8875112-HEX (Mut): GAAGGTCGGAGTCAACGGATTCAGAGCTCCACTATTACCGGCC; lcd8875112-COMMON: GCATGATGTACTGTCCAGCGTA.

[0041] (2) For the mutation in the R8022 background, a KASP primer (labeled as lcd8875181, as shown in SEQ NOS. 8-10) was designed: lcd8875181-FAM (WT): GAAGGTGACCAAGTTCATGCTATGTGGTTCAGAACGTGCTG; lcd8875181-HEX (Mut): GAAGGTCGGAGTCAACGGATTATGTGGTTCAGAACGTGGCA; lcd8875181-COMMON: CGTACACGATCGCACTCGAC.

[0042] (3) The primers were synthesized by Beijing Geneseeq Biotech Co., Ltd. Using the KASP marker, 500 M1 generation single plants in the 52th mixed pool were genotyped. The KASP reaction system (10 µL): 5 µL 2x KASP Master Mix, 0.14 µL KASP Assay Mix, 1-3 µL template DNA (10-50 ng), and nuclease-free water to 10 µL. The reaction and signal reading were performed on a fluorescence quantitative PCR instrument: 94°C for 3-15 min; 10 cycles of [94°C for 20 s, 65°C→57.8°C (-0.8°C / cycle) for 60 s]; ≥28 cycles of [94°C for 20 s, 57°C for 60 s]; 37°C for 1 min (fluorescence collection); 4-12°C storage. The results showed that the 9th plant in line 192 of the 68S M1 generation 27th population carried the mutation. The 5th plant in line 220 of the R8022 M1 generation 52th mixed pool carried the mutation.

[0043] 4. M1 generation mutation tiller identification and directional efficient propagation: (1) Number each main tiller of Li68s-192-9 and R8022-220-5, and collect 1-2 young leaves at the base of each tiller with a puncher and place them in a 96-well plate.

[0044] (2) Extract DNA from each tiller using the rapid alkaline lysis method.

[0045] (3) Use lcd8875112 and lcd8875181 markers to KASP genotype the DNA of each tiller of plant Li68s-192-9 and plant R8022-220-5, respectively.

[0046] (4) Results: 3 tillers carrying mutations were identified in Li68s-192-9; 2 tillers carrying mutations were identified in R8022-220-5. Mark these mutant tillers with colored labels.

[0047] (5) For all mutant tillers marked on plant Li68s-192-9, when the pistil stigma protrudes, perform artificial assisted pollination with freshly collected cold pool wild type grain 68s pollen, pollinate 2-3 times per ear, and immediately cover with a paper bag.

[0048] (6) For all mutant tillers marked on plant R8022-220-5, when the pistil stigma protrudes, perform artificial assisted pollination with freshly collected wild type grain R8022 pollen, pollinate 2-3 times per ear, and immediately cover with a paper bag.

[0049] (7) Seed harvesting: when mature, separately harvest the seeds of the mutant tillers on plant Li68s-192-9 that have been artificially pollinated; separately harvest the seeds of the mutant tillers on plant R8022-220-5 that have been selfed / pollinated.

[0050] 5. Obtain the following parent homozygous mutation, double allele mutation combinations: (1) Sow Li68s-192-9-M2 and R8022-220-5-M2 seeds separately. Take samples to extract DNA at the seedling stage.

[0051] (2) Use lcd8875112 to genotype the Li68s-192-9-M2 population, and use lcd8875181 to genotype the R8022-220-5-M2 population.

[0052] (3) From the Li68s-192-9-M2 population, select 23 single plants with KASP results of mutant heterozygous type, named Li68S-lcd-M2; from the R8022-220-5-M2 population, select 4 single plants with KASP results of mutant homozygous type, and 32 single plants with heterozygous mutations. Named R8022-lcd-M2.

[0053] (4) Cross R8022-220-5-M2 (homozygous) with Li68S-lcd-M2 (heterozygous) to obtain F1.

[0054] (5) Self-cross Li68s-192-9-M2 and R8022-220-5-M2 to obtain M3 population, identify homozygous mutation using lcd8875112 and lcd8875181 to obtain Li68S-lcd-M3 and R8022-lcd-M3. Identify double allele mutation in F1 population in step (4) using lcd8875112 and lcd8875181 to obtain Liangliangyou 8022-lcd.

[0055] 6. Phenotype identification of Liangliangyou 8022-lcd: (1) Seedling stage hydroponic identification: Select seeds of genetically stable double allele mutant Liangliangyou 8022-lcd and original hybrid rice variety "Liangliangyou 8022" (WT, wild type control) after disinfection, and germinate on wet filter paper. When the seedlings grow to about two leaves one heart, select seedlings with consistent growth and carefully transplant them into Yoshida rice nutrient solution. Set up two treatment groups: control group (CK, no Cd added in the nutrient solution) and cadmium treatment group (add 0.5 µM CdCl2). In each treatment group, each genotype (Liangliangyou 8022-lcd and Liangliangyou 8022) is set up 5 biological replicates, and each replicate contains 3 seedlings. Cultivate in a light incubation room for 14 days. After the incubation, carefully take out the plants, rinse them with deionized water, and especially clean the roots to remove the surface adsorbed Cd. Separate the roots and aboveground parts, kill them at 105°C for 30 minutes, and then dry them at 70°C to constant weight. Weigh the dry weight. After crushing the dry samples, use nitric acid-perchloric acid digestion method for digestion, and then use ICP-MS (inductively coupled plasma mass spectrometry) to measure the cadmium content in the samples. The results are shown in Figure 2 : Under the condition of 0.5 µM CdCl2 treatment, the average cadmium content of wild type Liangliangyou 8022 in the aboveground part is 7.97 mg / kg, and the average cadmium content in the root is 403.67 mg / kg; while the average cadmium content of double homozygous mutant Liangliangyou 8022-lcd in the aboveground part is significantly reduced to 1.53 mg / kg, and the average cadmium content in the root is also significantly reduced to 19.20 mg / kg.

[0056] (2) Maturity grain identification: The double homozygous mutant grain Liangliangyou 8022-lcd verified by seedling stage and KASP was planted in a potting condition (soil total cadmium content 1.5 mg / kg, PH value 5.6) at the same time as the original hybrid rice variety "Liangliangyou 8022". Five repetitions were set for each genotype (each pot was taken as a repetition for potting, and three plants were planted for each wild type and mutant). The field management was carried out according to the conventional rice cultivation management mode until the rice was completely mature. After maturation, the aboveground part of each repetition was harvested separately, and the rice was obtained after threshing. The brown rice sample was dried at 70°C to constant weight and then crushed. A certain amount of brown rice powder was weighed, and the sample pretreatment and digestion were carried out according to the national standard "GB5009.15 Food safety national standard Determination of cadmium in food". The cadmium content in the brown rice sample was determined by ICP-MS. The results are shown in Table 2. Figure 3 It is shown that under the condition of soil available cadmium content of 1.5 mg / kg, the average cadmium content of brown rice of wild type Liangliangyou 8022 is 0.63 mg / kg, which significantly exceeds the national food safety standard (GB2762-2017) rice cadmium limit value (0.2 mg / kg); while the cadmium content of brown rice of double homozygous mutant Liangliangyou 8022-lcd is only 0.0667 mg / kg, which is far below the national limit standard, and the difference compared with the wild type reaches a very significant level (P<0.01). At the same time, the main agronomic traits were investigated, and the results showed that the double mutant Liangliangyou 8022-lcd had no significant adverse difference in main agronomic traits compared with the wild type Liangliangyou 8022.

[0057] Comprehensive seedling stage water culture and maturity grain determination results, it is proved that the double mutant genotype Liangliangyou 8022-lcd created by the method of the application has a stable and significant low accumulation effect of cadmium, and has no effect on agronomic traits, which has important breeding application value.

Claims

1. A method for directional breeding of a mutant hybrid rice parent, characterized in that, The method comprises the following steps: (1) selecting hybrid rice parent combination seeds, the parent combination seeds comprising a two-line sterile line and a restoration line, each material being at least 1000 or more, and performing heavy ion irradiation mutagenesis treatment on the parent combination seeds to obtain M1 generation seeds, and obtaining M1 generation plant populations after planting; (2) at the tillering stage of the M1 generation plants, constructing a mixed pool sample by equally mixing and extracting DNA to perform targeted capture sequencing of a target gene, and identifying a candidate mutant mixed pool carrying a target gene mutation; (3) for each target mutation site identified in step (2), designing and verifying a KASP molecular marker primer combination capable of distinguishing between wild type and mutant alleles; (4) in the candidate mutant mixed pool in step (2), using the KASP molecular marker primer combination in (3) to identify M1 plants carrying a target gene mutation, sampling each tiller at the tillering stage to the jointing stage, then treating the tiller samples by using a DNA extraction method, and using the KASP molecular marker primer combination in step (3) for genotyping to identify and mark specific tillers carrying a target gene mutation, and performing directional propagation according to the parent type at the heading and flowering stage of the specific tillers, and harvesting M2 generation seeds of the specific tillers carrying a target gene mutation after the directional propagation operation; (5) planting the M2 generation seeds obtained in step (4), sampling and extracting DNA at the M2 generation seedling stage, using the KASP molecular marker primer combination in step (3) for genotyping, and screening homozygous plants and / or heterozygous plants of the target gene mutation; (6) using the identified mutant homozygous sterile line and the mutant homozygous restoration line to cross to obtain improved hybrid rice combination F1 generation seeds; if the mutant sterile line and the mutant restoration line identified in step (5) are both heterozygous or one of them is heterozygous, then the mutant sterile line and the mutant restoration line are used to cross to obtain improved hybrid rice combination F1 generation seeds in the F1 population by using the KASP molecular marker primer combination to screen double allelic mutations.

2. The method of claim 1, wherein, In step (1), the parent combination seeds comprise a low-cadmium two-line sterile line 68S and a low-cadmium restoration line R8022.

3. The method of claim 1, wherein, In step (1), the heavy ion irradiation mutagenesis treatment uses ¹²C 6 + heavy ion irradiation at a dose of 80-180 Gy.

4. The method of claim 1, wherein, In step (2), when the DNA is equally mixed and extracted to construct a mixed pool sample, a single mixed pool contains 100-1000 samples.

5. The method of claim 1, wherein, In step (2), the target gene is an OsNramp5 gene.

6. The method of claim 1, wherein, In step (4), the DNA extraction method is an alkaline lysis method.

7. The method of claim 1, wherein, In steps (4) and (5), the KASP reaction system for genotyping comprises 5 µL of 2x KASP Master Mix, 0.14 µL of KASP Assay Mix, 1-3 µL of template DNA 10-50 ng, and nuclease-free water to make up to 10 µL.

8. The method according to any one of claims 1-7, characterized in that, In step (4), the directional propagation operation specifically comprises the following steps: when the pistil stigma is extended, performing artificial assisted pollination with freshly collected wild type pollen, 2-3 times of pollination per ear, and immediately covering the ear with a paper bag.

Images