TaNAC71-4b gene, dCAPS molecular marker and application thereof in identifying potassium absorption and utilization capacity of wheat

Abstract

The present application relates to the field of biomolecular markers, in particular to a TaNAC71-4B gene, a dCAPS molecular marker and application of the TaNAC71-4B gene and the dCAPS molecular marker in identifying potassium absorption and utilization capacity of wheat, and provides application of the TaNAC71-4B gene in identifying haplotypes of wheat, wherein the haplotypes include Hap1 and Hap2, and the gene can accurately distinguish haplotypes of wheat and accurately identify potassium absorption and utilization capacity of wheat.

Description

Technical Field

[0001] This invention relates to the field of biomolecular markers, and in particular to the TaNAC71-4B gene, the dCAPS molecular marker, and their application in identifying the potassium uptake and utilization capacity of wheat. Background Technology

[0002] Wheat (Triticum aestivum L.) is an important food crop, providing approximately 20% of the calories consumed by humans. As a major global food crop, wheat has long faced challenges due to adverse conditions such as drought and extreme temperatures. With global warming, frequent extreme weather events like droughts and heat waves, and a continuously growing population, food security is facing severe challenges. In addressing these adverse stresses, besides improving cultivation conditions, using modern molecular biology techniques to breed stress-resistant, high-yielding, and stable-yielding wheat varieties is an economical and effective approach.

[0003] Currently, there is no research on improving the efficient absorption and utilization of potassium in wheat. Developing functional markers based on TaNAC71, conducting haplotype analysis, and performing correlation analysis with efficient potassium absorption and utilization to find superior haplotypes is of great significance for improving the stress resistance of wheat and obtaining new high-yielding wheat varieties.

[0004] There are currently no reports of using the TaNAC71-4B gene to determine wheat haplotypes. Summary of the Invention

[0005] To address the aforementioned issues, this invention provides the TaNAC71-4B gene, the dCAPS molecular marker, and their application in identifying the potassium uptake and utilization capacity of wheat. This gene can accurately distinguish between Hap1 and Hap2 wheat varieties.

[0006] To achieve the above objectives, the present invention provides the following technical solution:

[0007] This invention provides the application of the TaNAC71-4B gene in identifying wheat haplotypes, including Hap1 and Hap2.

[0008] This invention provides SNP sites related to efficient potassium absorption in wheat, wherein the SNP sites include one or more of a first SNP site, a second SNP site, a third SNP site, a fourth SNP site, and a fifth SNP site;

[0009] The first SNP site is located at -1029 bp in the promoter region of the TaNAC71-4B gene, and the polymorphism is T / C.

[0010] The second SNP site is located at -792 bp in the promoter region of the TaNAC71-4B gene, and the polymorphism is G / C.

[0011] The third SNP site is located at 651 bp in the coding region of the TaNAC71-4B gene, and its polymorphism is C / A.

[0012] The fourth SNP site is located at 895 bp in the coding region of the TaNAC71-4B gene, and its polymorphism is G / A.

[0013] The fifth SNP site is located at 1421 bp in the coding region of the TaNAC71-4B gene, and its polymorphism is C / T.

[0014] This invention provides the application of the SNP sites described in the above technical solution in identifying wheat haplotypes and / or wheat potassium uptake and utilization capacity.

[0015] This invention provides a dCAPS molecular marker for identifying wheat haplotypes and / or wheat potassium uptake and utilization capacity, the sequence of which is shown in SEQ ID NO:1.

[0016] This invention provides a dCAPS molecular marker primer pair for identifying wheat haplotypes and / or wheat potassium uptake and utilization capacity, the primer pair comprising an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO:2; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:3.

[0017] The present invention provides a kit for identifying wheat haplotypes and / or wheat potassium uptake and utilization capacity, comprising the primer pair as described in claim 5.

[0018] Preferably, the kit further includes reagents for PCR amplification and reagents for enzyme digestion.

[0019] This invention provides the application of the dCAPS molecular marker, primer pair, or kit described in the above-mentioned technical solutions in wheat breeding and / or identification of wheat haplotypes and / or wheat potassium uptake and utilization capacity.

[0020] This invention provides a method for identifying the potassium absorption and utilization capacity of wheat, comprising the following steps:

[0021] Using the DNA of the sample to be tested as template DNA, the template DNA is amplified by PCR using the primer pairs described in the above technical solution or the primer pairs in the kit described in the above technical solution to obtain PCR products;

[0022] The PCR amplification product was double-digested with restriction endonucleases XhoI and XbaI to obtain the digested product.

[0023] When the enzyme digestion product is a single 3086bp band, the sample to be tested is a wheat variety that does not have high potassium absorption and utilization efficiency.

[0024] When the enzyme digestion product includes two short fragments at 2718bp and 368bp, the material to be tested is a wheat variety with high potassium absorption and utilization efficiency.

[0025] This invention provides a method for identifying wheat haplotypes, comprising the following steps:

[0026] Using the DNA of the sample to be tested as template DNA, the template DNA is amplified by PCR using the primer pairs described in the above technical solution or the primer pairs in the kit described in the above technical solution to obtain PCR products;

[0027] The PCR amplification product was double-digested with restriction endonucleases XhoI and XbaI to obtain the digested product.

[0028] When the enzyme digestion product is a single 3086bp band, the haplotype of the sample to be tested is Hap1;

[0029] When the enzyme digestion product includes two short fragments at 2718 bp and 368 bp, the haplotype of the material to be tested is Hap2.

[0030] Beneficial effects:

[0031] This invention provides the application of the TaNAC71-4B gene in identifying wheat genotypes. The TaNAC71-4B gene described in this invention can accurately distinguish between Hap1 and Hap2 wheat varieties.

[0032] The promoter region (-1162bp to -1bp) of the TaNAC71-4B haplotype described in this invention contains two SNPs (-1029T / G, -792G / C) with polymorphic variations, and the coding region (1bp to 1509bp) contains three SNPs (651C / A, 895G / A, 1421C / T) with polymorphic variations. These five SNPs are closely linked to form two haplotypes, named Hap1 and Hap2, respectively. Using the Hap1 sequence as a control, the Hap2 sequence was found to contain five SNPs.

[0033] Furthermore, the SNPs provided by this invention can be used to quickly and accurately identify haplotypes in wheat; and can also be used to quickly and accurately screen for potassium-efficient wheat varieties.

[0034] This invention provides a dCAPS molecular marker primer pair for identifying wheat haplotypes and / or wheat potassium uptake and utilization capacity. This primer pair can accurately distinguish wheat haplotypes and accurately identify wheat potassium uptake and utilization capacity.

[0035] Moreover, the identification method provided by this invention is relatively simple and easy to use in practical applications. Attached Figure Description

[0036] Figure 1 Results of amplification of different fragments of the TaNAC71-4B gene;

[0037] Figure 2-1 The SNP sites present in the promoter region (-1162bp to -1bp) of TaNAC71-4B;

[0038] Figure 2-2 These are SNP sites present in the coding region (1bp~1509bp) of TaNAC71-4B;

[0039] Figure 2-3 The SNP sites present in the TaNAC71-4B coding region (1bp~1509bp) were associated with the five SNP sites in the TaNAC71-4B promoter and coding region;

[0040] Figures 2-1 to 2-3 Numbers 1 to 30 correspond to the 30 wheat varieties in Table 1;

[0041] Figure 3-1 Phenotypes of different haplotype wheat varieties of TaNAC71-4B under potassium stress;

[0042] Figure 3-2 Growth parameters of different haplotype wheat varieties of TaNAC71-4B under potassium stress;

[0043] Figure 4 The changes in potassium content in different tissues of different haplotype wheat varieties of TaNAC71-4B under potassium stress;

[0044] Figure 5 To distinguish different haplotype restriction sites of TaNAC71-4B;

[0045] Figure 6 Electrophoresis diagrams of different haplotype amplifications of TaNAC71-4B and their corresponding sequences after double digestion with XhoI and XbaI enzymes. Detailed Implementation

[0046] This invention provides the application of the TaNAC71-4B gene in identifying wheat haplotypes, including Hap1 and Hap2. The gene described in this invention can accurately determine wheat haplotypes; in a specific embodiment of this invention, this gene was used to determine the haplotypes of 30 wheat varieties.

[0047] This invention provides SNP sites associated with efficient potassium absorption in wheat. The SNP sites include one or more of a first SNP site, a second SNP site, a third SNP site, a fourth SNP site, and a fifth SNP site. The first SNP site is located at -1029 bp in the promoter region of the TaNAC71-4B gene and has a polymorphism of T / C. The second SNP site is located at -792 bp in the promoter region of the TaNAC71-4B gene and has a polymorphism of G / C. The third SNP site... The first SNP site is located at 651 bp in the coding region of the TaNAC71-4B gene, and its polymorphism is C / A; the second SNP site is located at -792 bp in the promoter region of the TaNAC71-4B gene, and its polymorphism is G / A; the third SNP site is located at 1421 bp in the coding region of the TaNAC71-4B gene, and its polymorphism is C / T. More preferably, the second SNP site is located at -792 bp in the promoter region of the TaNAC71-4B gene, and its polymorphism is G / C. The SNP sites described in this invention can accurately distinguish between wheat haplotypes Hap1 and Hap2 and can accurately identify whether wheat is a potassium-efficient wheat variety.

[0048] Based on the advantages of the aforementioned SNP sites, this invention provides the application of the SNP sites described in the above technical solution in identifying wheat haplotypes and / or wheat potassium-efficient absorption resources.

[0049] This invention provides a dCAPS molecular marker for identifying wheat haplotypes and / or wheat potassium uptake and utilization capacity. The nucleotide sequence of the dCAPS molecular marker is shown in SEQ ID NO:1.

[0050] The underlined portion represents the upstream primer of the dCAPS molecular marker, and the boxed portion represents the restriction enzyme site. The dCAPS molecular marker described in this invention is a molecularly specific detection marker for the TaNAC71-4B gene. The dCAPS molecular marker of this invention is preferably obtained based on the second SNP site in the SNP sites described in the above technical solution. This invention names the dCAPS molecular marker dCAPS-792. The dCAPS molecular marker described in this invention can identify wheat varieties with high potassium absorption and utilization efficiency, and also has the advantages of accuracy, speed, and efficiency.

[0051] This invention also provides a primer pair for the dCAPS molecular marker described in the above-mentioned technical solution. The primer pair includes an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO:2, specifically GAGGCATGTTGCGCGGGGCCCT; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:3, specifically GTGAAAATACATTTTTTTTATTATGCT. The primer pair of this invention is designed upstream and downstream of the SNP recognized by the dCAPS molecular marker described in the above-mentioned technical solution. The primer set of this invention has high specificity and high sensitivity.

[0052] The primer pairs described in this invention are preferably designed based on the second SNP site in the SNP site described in the above technical solution. In addition, before designing the primer pairs, this invention also preferably mutates the base T to A at the -790bp position of the promoter region of the TaNAC71-4B gene.

[0053]

[0054]

[0055] This invention provides a kit for identifying wheat haplotypes and / or wheat potassium uptake and utilization capacity, comprising the primer pairs described in the above-described technical solution. The kit preferably further comprises PCR amplification reagents and enzyme digestion reagents; the enzyme digestion reagents preferably include restriction endonucleases XhoI and XbaI. This invention does not have any particular limitation on the source of the PCR amplification reagents and enzyme digestion reagents, which can be obtained conventionally by those skilled in the art. The primer set described in this invention has the advantages of high specificity and high sensitivity; therefore, this kit can identify wheat haplotypes and whether a wheat variety has efficient potassium uptake and utilization.

[0056] Based on the advantages of the above-mentioned dCAPS molecular marker primer pairs, this invention provides the application of the primer pairs or kits described in the above-mentioned technical solutions in wheat breeding, and also provides the application of the primer pairs or kits described in the above-mentioned technical solutions in identifying wheat haplotypes and / or wheat potassium uptake and utilization capacity.

[0057] This invention provides a method for identifying wheat with high potassium absorption and utilization efficiency, comprising the following steps:

[0058] Using the DNA of the sample to be tested as template DNA, PCR amplification is performed on the template DNA with the primer pairs described in the above technical solution or the primer pairs in the kit described in the above technical solution to obtain PCR products;

[0059] The PCR amplification product was double-digested with restriction endonucleases XhoI and XbaI to obtain the digested product.

[0060] When the enzyme digestion product is a single 3086bp band, the sample to be tested is a wheat variety that does not have high potassium absorption and utilization efficiency.

[0061] When the enzyme digestion product includes two short fragments at 2718bp and 368bp, the material to be tested is a wheat variety with high potassium absorption and utilization efficiency.

[0062] The sample to be tested in this invention preferably includes wheat leaves. The volume of PCR amplification in this invention is preferably 50 μL, comprising 25 μL of 2×KOD One™ PCR Master Mix, 0.3 μL of upstream primer, 0.3 μL of downstream primer, 200 ng of template DNA, and the remainder ddH2O; the working concentration of the upstream primer is preferably 0.3 μM, the working concentration of the downstream primer is preferably 0.3 μM, and the concentration of the template DNA is preferably 150 ng. The preferred PCR amplification reaction program of this invention is 94℃ pre-denaturation for 3 min; 98℃ denaturation for 10 s, 55℃ annealing for 30 s, 68℃ extension for 3 min, repeated 32 times; and 68℃ extension for 5 min.

[0063] This invention does not limit the methods for extracting, amplifying, or digesting the template DNA; any method well-known to those skilled in the art can be used. Therefore, this invention can accurately determine whether wheat is a variety with high potassium absorption and utilization efficiency using conventional methods, and the method is simple.

[0064] This invention provides a method for identifying wheat haplotypes, comprising the following steps:

[0065] Using the DNA of the sample to be tested as template DNA, the template DNA is amplified by PCR using the dCAPS molecular marker primer pair described in the above technical solution or the primer pair in the kit described in the above technical solution to obtain PCR products;

[0066] The PCR amplification product was double-digested with restriction endonucleases XhoI and XbaI to obtain the digested product.

[0067] When the enzyme digestion product is a single 3086bp band, the haplotype of the sample to be tested is Hap1;

[0068] When the enzyme digestion product includes two short fragments at 2718 bp and 368 bp, the haplotype of the material to be tested is Hap2.

[0069] The sample to be tested in this invention preferably includes wheat leaves. The volume of PCR amplification in this invention is preferably 50 μL, comprising 25 μL of 2×KOD One™ PCR Master Mix, 0.3 μL of upstream primer, 0.3 μL of downstream primer, 200 ng of template DNA, and the remainder ddDH2O; the working concentration of the upstream primer is preferably 0.3 μM, the working concentration of the downstream primer is preferably 0.3 μM, and the concentration of the template DNA is preferably 150 ng. The preferred PCR amplification reaction program of this invention is 94℃ pre-denaturation for 3 min; 98℃ denaturation for 10 s, 56℃ annealing for 30 s, 68℃ extension for 3 min, repeated 32 times; and 68℃ extension for 5 min.

[0070] To further illustrate the present invention, the TaNAC71-4B gene, dCAPS molecular marker, and their application in identifying the potassium uptake and utilization capacity of wheat are described in detail below with reference to the accompanying drawings and embodiments. However, these descriptions should not be construed as limiting the scope of protection of the present invention.

[0071] Example 1: Screening for superior haplotypes of the TaNAC71 gene in potassium uptake

[0072] 1. Materials and Methods

[0073] 1.1 Test Materials

[0074] This invention uses 30 samples of common wheat varieties (commercially available modern cultivars) preserved in our laboratory (Laboratory 317, South Building, First Experimental Building, College of Agriculture, Henan Agricultural University). Detailed information is shown in Table 1.

[0075] Table 1. Hexaploid wheat varieties used in this invention

[0076]

[0077]

[0078] 1.2 Experimental Methods

[0079] The high-fidelity PCR enzyme KOD One™ PCR Master Mix used for PCR amplification was purchased from Toyobo Biotechnology Co., Ltd., the blunt-end cloning vector PMD 19-TVector was purchased from TransGen Biotech Co., Ltd., the XhoI and XbaI restriction endonucleases were purchased from NEB, and other reagents were domestically produced analytical grade.

[0080] 1.3 Primer Design

[0081] To investigate the genetic diversity of the TaNAC71 gene, this study used resequencing results to sequence and align the triple-copy 4A, 4B, and 4D gene sequences of 30 common wheat varieties TaNAC71 from multiple regions. The triple-copy 4A, 4B, and 4D gene sequences of TaNAC71 include the promoter, 5'UTR, exons, introns, and 3'UTR. Haplotypes were then identified using Haploview software. SNP sequencing revealed that TaNAC71-4B has a relatively large number of SNP sites; therefore, the TaNAC71-4B sequence was selected as the research object. Detailed information on the 30 common wheat varieties is shown in Table 1.

[0082] First, based on the sequence differences of the three copies of the TaNAC71 gene, 4A, 4B, and 4D, in the wheat genome database, primers were designed for the 4B copy segment (Table 2). Primer synthesis and sequencing were completed by Henan Shangya Biotechnology Co., Ltd.

[0083] Table 2 Primers for 4B copy fragmentation design

[0084]

[0085]

[0086] 1.4 Extraction of total DNA from wheat

[0087] Total DNA was extracted from wheat using the CTAB method, following a well-established laboratory procedure (Li et al., 2021; JPineal Res. 70(4):e12727). First, wheat leaves were rapidly frozen and ground in liquid nitrogen, then 1 mL of preheated CTAB extraction buffer was added, and the mixture was incubated at 65°C for 1 hour. Next, the mixture was centrifuged at 12000g for 5 minutes, and the supernatant was collected and mixed with an equal volume of a chloroform and isoamyl alcohol solution (24:1 volume ratio). The mixture was then centrifuged again at 12000g for 10 minutes, and the supernatant was transferred to a new tube. Two volumes of anhydrous ethanol were added and the mixture was incubated at -20°C for 30 minutes. The mixture was centrifuged again, the supernatant was discarded, and the contents were washed twice with 75% ethanol solution. The mixture was then air-dried, and 100 μL of sterile water was added to dissolve the DNA.

[0088] 1.5 Determination of physiological indicators of different haplotypes under low potassium treatment

[0089] Six wheat varieties with different haplotypes of Hap1 and Hap2 from Table 1 were selected, with Hap1 being He1 to He6 and Hap2 being He11 to He16. These were hydroponically cultured (Li et al., 2021; J Pineal Res. 70(4):e12727). When the wheat reached the two-leaf stage, seedlings with consistent growth among the varieties were selected. To eliminate differences caused by autotrophic growth, the endosperm was removed before potassium treatment. Subsequently, seedlings with consistent growth from different varieties were subjected to potassium stress treatment. The specific conditions were: normal potassium treatment (+K, or CK) with a potassium ion concentration of 2 mmol / L; and low potassium treatment (LK) with a potassium ion concentration of 0.1 mmol / L. Phenotypes were observed between different treatments after 35 days. The phenotypes of different haplotype wheat varieties were photographed, and relevant indicators were measured. The formulas for calculating potassium accumulation are: Potassium accumulation = Plant dry weight * Plant potassium concentration (mg / plant); Potassium utilization index = Plant dry weight / Plant potassium concentration (mg / plant).

[0090] 2. Main Experimental Results

[0091] 2.1 Amplification and sequencing of the TaNAC71-4B gene promoter

[0092] Using TaNAC71-4B-1~3-F / R primers (Table 2), the promoter sequence of TaNAC71-4B was amplified using 30 hexaploid wheat DNAs as templates and high-fidelity PCR enzyme (KOD One™ PCRMaster Mix).

[0093] The PCR system contains: 25 μL KOD One™ PCR Master Mix (2×), 0.3 μL each of forward and reverse primers (10 μM), 200 ng DNA template, and ddH2O added to a total volume of 50 μL;

[0094] The PCR reaction program was as follows: 94℃ pre-denaturation for 3 min; 98℃ denaturation for 10 s, 56℃ annealing for 30 s, 68℃ extension for 3 min, 32 cycles; 68℃ extension for 5 min.

[0095] The results are as follows Figure 1 As shown, A represents the primers designed for segmenting the promoter and coding domain of the TaNAC71-4B gene: TaNAC71-4B-F1 and TaNAC71-4B-R1, TaNAC71-4B-F2 and TaNAC71-4B-R2, and TaNAC71-4B-F3 and TaNAC71-4B-R3. B represents the amplification results of segmenting the promoter and coding domain of the TaNAC71-4B gene using different primers. The first row uses primers TaNAC71-4B-F1 and TaNAC71-4B-R1, the second row uses primers TaNAC71-4B-F2 and TaNAC71-4B-F2, and the third row uses primers TaNAC71-4B-F3 and TaNAC71-4B-R3, respectively. The TaNAC71-4B gene was amplified using primers TaNAC71-4B-F1, TaNAC71-4B-R1, TaNAC71-4B-F2, TaNAC71-4B-R2, TaNAC71-4B-F3, and TaNAC71-4B-R3, yielding promoters and coding domains of 1162bp, 1509bp, and 1091bp, respectively. M was Mark2000. Lanes 1-5 used Luohan 13, Yunong 516, Luomai 26, Yunong 908, and Jinmai 88 as amplification templates, respectively. Lanes 6-15 used Emai 12, Lunxuan 987, Shan 229, Yangmai 23, Xinong 529, Yangfumai 4, Huamai 2566, Ningmai 13, Shiyou 20, and Heng 136 as amplification templates, respectively.

[0096] Based on this, the target fragments amplified by PCR were recovered respectively, and the three fragments were ligated into the PMD 19-TVector cloning vector and transformed into E. coli. Then, more than three positive clones were selected and sequenced using universal primers M13-F and M13-R (Table 2).

[0097] 2.2 Sequence alignment and haplotype analysis of the TaNAC71-4B gene promoter

[0098] The sequencing results were assembled and sequence alignment was performed using DNAMAN software (http: / / www.lynnon.com).

[0099] The results are as follows Figures 2-1 to 2-3 As shown, where Figure 2-1 In the diagram, A represents one SNP site in the promoter region of TaNAC71-4B, with a value of -1029 bp (T / G). B represents another SNP site in the promoter region of TaNAC71-4B, with a value of -792 bp (G / C). Two SNP sites were found in the promoter region (-1162 bp to -1 bp) of 30 wheat varieties TaNAC71-4B, located at -1029 bp (T / G) and -792 bp (G / C), respectively. Figure 2-2 In the diagram, C represents one of the SNP sites in the coding region of TaNAC71-4B, with a length of 651 bp (C / A). D represents the second SNP site in the coding region of TaNAC71-4B, with a length of 895 bp (G / A). Figure 2-3 E in the figure represents the third SNP site in the coding region of TaNAC71-4B, which is 1421 bp (C / T). There are three SNP sites in the coding region (1 bp to 1509 bp), located at 651 bp (C / A), 895 bp (G / A), and 1421 bp (C / T).

[0100] Haplotype identification of the TaNAC71-4B promoter and coding region was performed using DnaSP 5.10 software (http: / / www.ub.edu / DnaSP), and the results are as follows: Figure 2-3 The F in the diagram represents the association between the TaNAC71-4B promoter and five SNP sites in the coding region, forming two haplotypes, TaNAC71-4B-Hap1 and TaNAC71-4B-Hap2. These five SNPs are found to be tightly linked, forming two haplotypes, named TaNAC71-4B-Hap1 and TaNAC71-4B-Hap2 respectively, and referred to as Hap1 and Hap2 below. Using the sequence of Hap1 as a control, it was found that the sequence of Hap2 contains five SNPs.

[0101] 2.3 Comparison of tolerance to low potassium stress among wheat varieties with different haplotypes of the TaNAC71-4B gene

[0102] Six wheat varieties with different TaNAC71-4B haplotypes were selected. Hap1 consisted of Luohan 13, Yunong 516, Luomai 26, Yunong 908, Jinmai 88, and Zhengmai 7698. Hap2 consisted of Emai 12, Lunxuan 987, Shan 229, Yangmai 23, Xinong 529, and Yangfumai 4. Hap1 is also referred to as Hap-4B-1 or TaNAC71-4B-Hap1, and Hap2 is also referred to as Hap-4B-2 or TaNAC71-4B-Hap2. Wheat seedlings of these varieties were cultured to the two-leaf-one-heart stage and then subjected to low-potassium treatment for 35 days. Specific steps are detailed in section 1.5, "Determination of Biometric Indicators of Different Haplotypes under Low-Potassium Treatment." Phenotypic results are shown below. Figure 3-1 As shown: Under low potassium conditions, the Hap2 haplotype wheat variety TaNAC71-4B showed better plant growth than the Hap1 haplotype wheat variety, and did not exhibit obvious symptoms such as shortened roots and wilting leaves.

[0103] The plant height, root length, fresh weight, and dry weight were measured using a ruler and electronic balance to determine their growth parameters. The calculation formulas used in the measurements were as follows: Relative root elongation = root length of treated plants - root elongation of control plants; Relative increase in root dry weight = root dry weight of treated plants - root dry weight of control plants; Relative increase in aboveground plant height = aboveground height of treated plants - aboveground height of control plants; Relative increase in aboveground plant dry weight = aboveground dry weight of treated plants - aboveground dry weight of control plants.

[0104] The measurement results are as follows Figure 3-2 The study found that the relative elongation of the underground roots in haplotype Hap2 was significantly higher than that in haplotype Hap1, and a similar trend was observed in root dry weight. Furthermore, the relative growth of the aboveground parts followed the same trend as the underground parts; the plant height and dry matter gain of haplotype Hap2 were significantly higher than those of the control treatment compared to haplotype Hap1. This indicates that under low potassium stress, haplotype Hap2 wheat varieties exhibit stronger potassium tolerance compared to haplotype Hap1 wheat varieties.

[0105] To further analyze the potassium fertilizer utilization efficiency of different varieties, this embodiment dried the wheat plants of the different types mentioned above and digested them according to the method used in the previous experiment (Li et al., 2021; JPineal Res. 70(4):e12727). The potassium concentration in different tissues of the aboveground and underground parts was measured, and the potassium content and utilization index of the plants were calculated. The results are as follows: Figure 4As shown, A represents the potassium concentration in the aboveground parts, B represents the potassium content in the aboveground parts, C represents the potassium utilization index in the aboveground parts, D represents the potassium concentration in the underground parts, E represents the potassium content in the underground parts, and F represents the potassium utilization index in the underground parts. Under low potassium conditions, the potassium content and utilization index in wheat varieties containing the Hap2 haplotype TaNAC71-4B are significantly increased in both the aboveground and underground parts. This indicates that under potassium stress, the Hap2 haplotype wheat varieties have enhanced potassium absorption capacity, absorbing a large amount of potassium and further transporting it to the aboveground parts to adapt to normal growth and development of wheat under potassium stress. This further demonstrates that the TaNAC71-4B gene containing the Hap2 haplotype is an excellent haplotype for wheat under potassium stress conditions.

[0106] Example 2

[0107] Development of dCAPS molecular markers for TaNAC71-4B gene and screening of potassium-efficient wheat varieties.

[0108] 1. Experimental Materials and Methods

[0109] Same as 1. Materials and methods in Example 1.

[0110] 2. Main Experimental Results

[0111] 2.1 Determination of the dCAPS-792 molecular marker

[0112] Since the difference between the two haplotype promoters of TaNAC71-4B is a single-base difference (SNP), enzyme digestion amplification polymorphism (CAPS) molecular markers can be developed based on these differences. Using dCAPS Finder 2.0 (http: / / helix.wustl.edu / dcaps / dcaps.html), the sequence differences between the superior Hap2 haplotype promoter and the Hap1 haplotype promoter were analyzed, revealing that the -792 position sequence exists in both G and C forms. Figure 5 In the diagram, A represents the sequence difference analysis between the Hap2 haplotype promoter and the Hap1 haplotype promoter, where Hap1 contains the variety sequence AAGCCACCT. G GtGGGCC, SEQ ID NO:14, the sequence for Hap2 type wheat varieties is AAGCCACCT C In GtGGGCC, SEQ ID NO:15, SEQ ID NO:14, and SEQ ID NO:15, the underlined portion is position -792, and the lowercase portion is position -790. To distinguish the above differences, a dCAPS primer containing the restriction endonuclease XhoI cleavage site was designed by mutating T to A at position -790 of the above sequence. The XhoI cleavage site includes CTCGAG, SEQ ID NO:16, which distinguishes Hap-4B-1 and Hap-4B-2. Figure 5 In the diagram, B represents the recognition of the Hap2 and Hap1 haplotypes by the restriction endonuclease XhoI after a single nucleotide mutation. Hap2 contains the CTCGAG sequence, which can be recognized and cleaved by XhoI, while Hap1 contains the CTGGAG sequence and therefore cannot be cleaved by XhoI. Therefore, based on this sequence difference, a dCAPS molecular marker can be developed to distinguish between the Hap2 and Hap1 haplotypes, and this marker is named dCAPS-792.

[0113] Primers dCAPS-F (SEQ ID NO:2: GAGGCATGTTGCGCGGGGCCCT) and dCAPS-R (SEQ ID NO:3: GTGAAAATACATTTTTTTTATTATGCT) were designed upstream and downstream of the SNP identified by the dCAPS-792 marker to distinguish different haplotypes, providing a basis for subsequent screening of different varieties with high potassium utilization efficiency.

[0114] 2.2 Application of dCAPS-792 molecular marker

[0115] To further test the usability of the developed molecular marker, this embodiment selected wheat varieties of different haplotypes mentioned above. The wheat varieties for Hap1 were: Luohan 13, Yunong 516, Luomai 26, Yunong 908, Jinmai 88, and Zhengmai 7698; the wheat varieties for Hap2 were: Emai 12, Lunxuan 987, Shan 229, Yangmai 23, Xinong 529, and Yangfumai 4. Genomic DNA was extracted from these varieties. Using the developed dCAPS-792 marker upstream and downstream primers, and with the above DNA as a template, the dCAPS-792 molecular marker was amplified by PCR in different wheat varieties. The reaction system was configured as follows: 25 μL 2×KOD One™ PCR. MasterMix, 0.3 μM each of forward and reverse primers, 200 ng DNA template, add ddDH2O to a total volume of 50 μL, the PCR amplification reaction program is as follows: 94℃ pre-denaturation for 3 min; 98℃ denaturation for 10 s, 55℃ annealing for 30 s, 68℃ extension for 3 min, cycle 32 times; 68℃ extension for 5 min.

[0116] To obtain relatively pure and high-concentration SNP fragments, following conventional gene fragment transformation methods (Li et al., 2021; J Pineal Res. 70(4):e12727), the PCR products of TaNAC71 from different varieties amplified above were recovered, ligated into the 19T vector, and transformed into DH5α strain. After overnight culture for 16 h, plasmids containing the target SNP fragments were extracted from different varieties; and double digestion was performed using XhoI enzyme (New England Biolabs) and the XbaI enzyme inherent in the 19T vector. Electrophoresis was then performed for detection.

[0117] The results are as follows Figure 6 As shown, A is the TaNAC71 promoter fragment in different haplotype wheat, B is the electrophoresis diagram of TaNAC71 XhoI and XbaI double digestion in different haplotype wheat, M2000 is Marker 2000, lanes 1-6 represent Luohan 13, Yunong 516, Luomai 26, Yunong 908, Jinmai 88, and Zhengmai 7698, respectively, the 3086bp band is the uncut band after XhoI and XbaI double digestion, including the vector 2692bp and the fragment 394bp, lanes 7-12 represent Emai 12, Lunxuan 987, Shan 229, Yangmai 23, Xinong 529, and Yangfumai 4, the 2718bp and 368bp bands are the cut bands after XhoI and XbaI double digestion, representing the vector 2692bp, the primer to the enzyme site 26bp fragment, and the double digestion fragment 368bp, respectively.

[0118] Depend on Figure 6 As shown in A, the TaNAC71 promoter fragments in different haplotype wheat, between -1162bp and -792bp, can all obtain a single amplified band at 394bp.

[0119] Depend on Figure 6 As shown in B, the transformation product of the Hap1 haplotype wheat variety, after double enzyme digestion, still consists of a single band of 3086bp (vector 2692bp + fragment 394bp), while the amplification product of the Hap2 haplotype wheat variety, after double enzyme digestion, becomes two fragments, namely 2718bp (vector 2692bp + primer to enzyme site 26bp fragment) and 368bp (fragment).

[0120] As described above, the molecular marker dCAPS-792 can distinguish between the Hap2 and Hap1 haplotypes and can be applied to the molecular design breeding of new potassium-efficient wheat varieties.

[0121] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. TaNAC71-4B Application of genes in identifying wheat haplotypes, wherein the haplotypes include Hap1 and Hap2 The TaNAC71-4B The nucleotide sequence of the coding region of the gene is shown in SEQ ID NO:

4.

2. Molecular markers associated with efficient potassium absorption in wheat, characterized in that, The nucleotide sequences of the molecular marker are shown in SEQ ID NO:4 and SEQ ID NO:5; the molecular marker contains SNP sites, and the SNP sites include one or more of the following: first SNP site, second SNP site, third SNP site, fourth SNP site, and fifth SNP site; The first SNP site is located at TaNAC71-4B The gene is located at -1029 bp in the promoter region, and the polymorphism is T / C. The second SNP site is located at TaNAC71-4B The gene is located at -792 bp in the promoter region, and the polymorphism is G / C. The third SNP site is located at TaNAC71-4B The polymorphism is located at 651 bp in the coding region of the gene, and the polymorphism is C / A. The fourth SNP site is located at TaNAC71-4B The polymorphism is located at 895 bp in the coding region of the gene, and the polymorphism is G / A. The fifth SNP site is located at TaNAC71-4B The polymorphism is located at 1421 bp in the coding region of the gene and is C / T. The TaNAC71-4B The nucleotide sequence of the coding region of the gene is shown in SEQ ID NO:4; TaNAC71-4B The nucleotide sequence of the promoter region of the gene is shown in SEQ ID NO:

5.

3. The application of the molecular marker according to claim 2 in identifying wheat haplotypes and / or wheat potassium absorption and utilization capacity.

4. A dCAPS molecular marker for identifying wheat haplotypes and / or wheat potassium uptake and utilization capacity, characterized in that, The sequence of the dCAPS molecular marker is shown in SEQ ID NO:

1.

5. A dCAPS molecular marker primer pair for identifying wheat haplotypes and / or wheat potassium uptake and utilization capacity, the primer pair comprising an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO:2; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:

3.

6. A kit for identifying wheat haplotypes and / or wheat potassium uptake and utilization capacity, comprising the primer pair as described in claim 5.

7. The reagent kit according to claim 6, characterized in that, The kit also includes reagents for PCR amplification and reagents for enzyme digestion.

8. The use of the dCAPS molecular marker of claim 4, the primer pair of claim 5, or the kit of claim 6 or 7 in identifying wheat haplotypes and / or wheat potassium uptake and utilization capacity.

9. A method for identifying the potassium absorption and utilization capacity of wheat, characterized in that, Includes the following steps: Using the DNA of the sample to be tested as template DNA, the template DNA is amplified by PCR using the primer pair described in claim 5 to obtain PCR products; Using restriction endonucleases Xho I and Xba I. The PCR amplification product was double-digested with enzymes to obtain the digested product; When the enzyme digestion product is a single 3086bp band, the sample to be tested is a wheat variety that does not have high potassium absorption and utilization efficiency. When the enzyme digestion product includes two short fragments at 2718bp and 368bp, the material to be tested is a wheat variety with high potassium absorption and utilization efficiency.

10. A method for identifying wheat haplotypes, characterized in that, Includes the following steps: Using the DNA of the sample to be tested as template DNA, the template DNA is amplified by PCR using the primer pair described in claim 5 to obtain PCR products; Using restriction endonucleases Xho I and Xba I. The PCR amplification product was double-digested with enzymes to obtain the digested product; When the enzyme digestion product is a single 3086bp band, the haplotype of the sample to be tested is: Hap1 ; When the enzyme digestion product includes two short fragments at 2718 bp and 368 bp, the haplotype of the test material is: Hap2 .

Images