Molecular marker combination, primer pair, kit and method for identifying watermelon peel color
By developing molecular marker combinations and primer pairs, combined with PCR amplification and electrophoresis detection, the time-consuming and labor-intensive problem of watermelon peel color identification in the seedling stage was solved, and rapid and accurate peel color identification and screening was achieved.
Patent Information
- Application Number
- CN202211315006.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-10-25
- Publication Date
- 2025-09-23
- Estimated Expiration
- 2042-10-25
AI Technical Summary
In the existing technology, watermelon peel color identification must wait until the fruit is ripe, which is time-consuming and labor-intensive, and there is a lack of a fast and accurate identification method during the seedling stage.
A molecular marker combination was developed, and PCR amplification of SEQ ID NO.1 and SEQ ID NO.2 was performed using primers, combined with polyacrylamide gel electrophoresis detection, to quickly identify the watermelon peel color.
It realizes the rapid and accurate identification of peel color during the watermelon seedling stage, improving the efficiency and accuracy of screening.
Smart Images

Figure CN116334272B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of identifying watermelon peel color, and particularly relates to a molecular marker combination, a primer pair, a kit and a method for identifying watermelon peel color. Background Art
[0002] Watermelon (Citrullus lanatus) is an important economic crop of the Cucurbitaceae family and is widely cultivated in my country and around the world. The skin color of watermelon is an important commercial trait with a very rich variation, mainly including: dark green, green, light green, yellow, etc. The applicant's preliminary research found that under the light green and green genetic backgrounds, the light green skin trait of watermelon is a single recessive inheritance. On this basis, the applicant used genome resequencing and BSA-seq technology to obtain chromosome segments that are closely linked to the light green skin trait of watermelon, developed molecular markers within the segments, verified them in natural populations, and developed molecular markers that are closely linked to the light green skin trait of watermelon. They were applied to molecular breeding and seedling screening of watermelon skin color. At present, screening the color of watermelon skin requires waiting until the fruit is mature before identification can be carried out, which is time-consuming and labor-intensive. There is an urgent need for a scientific method for identifying skin color in the watermelon seedling stage. Summary of the Invention
[0003] The invention aims to identify the skin color of watermelons more quickly and accurately during the watermelon seedling stage.
[0004] The present invention provides a molecular marker combination for identifying the light green rind trait of watermelon. The molecular markers are shown as SEQ ID NO.1 and SEQ ID NO.2.
[0005] The present invention provides application of the molecular marker combination in identifying the color of watermelon peel.
[0006] It is further defined that the color of the peel is light green or green.
[0007] It is further defined that if the watermelon to be tested contains the sequence of SEQ ID NO.1, the watermelon has a light green rind trait; if the watermelon to be tested contains the sequence of SEQ ID NO.2, the watermelon has a green rind trait.
[0008] The invention provides a kit for identifying the color of watermelon peel. The kit contains a primer pair shown by SEQ ID NO.3 and SEQ ID NO.4.
[0009] The present invention provides use of the primer pair shown in SEQ ID NO. 3 and SEQ ID NO. 4 or the kit according to claim 5 in identifying the color of watermelon peel.
[0010] It is further defined that the color of the peel is light green or green.
[0011] The present invention provides a method for identifying the color of watermelon peel, and the method comprises the following steps:
[0012] (1) extracting genomic DNA of the watermelon to be tested;
[0013] (2) Using the genomic DNA obtained in step (1) as a template, PCR amplification is performed using a primer pair to obtain a PCR product; the primer pair includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.4.
[0014] (3) The color of the watermelon peel was determined by detecting the enzyme-digested products through polyacrylamide gel electrophoresis.
[0015] It is further defined that the PCR product in step (3) is detected by using polyacrylamide gel electrophoresis to detect the size of the PCR product fragment. If only a 164 bp fragment is present, the fruit peel trait is light green; if a 179 bp fragment is present or both 179 bp and 164 bp fragments are present, the fruit peel trait is green.
[0016] The present invention provides the use of the above-mentioned molecular marker combination, the primer pair shown in SEQ ID NO.3 and SEQ ID NO.4, the above-mentioned kit or the above-mentioned method in auxiliary identification of watermelon peel color, auxiliary breeding and watermelon peel color screening.
[0017] Beneficial effects: In the early stage, the present invention carried out research on the positioning of key genes for the light green peel of watermelon through high-throughput sequencing and BSA-seq analysis. Based on the positioning results, the InDel molecular markers closely linked to the genes were developed. Through the molecular marker-assisted selection method, molecular marker-assisted selection of peel color can be performed at the watermelon seedling stage, which improves the accuracy and efficiency of screening and has important theoretical and practical significance. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 This is a diagram showing the preliminary positioning results of the key gene for the light green rind trait of watermelon in Example 1.
[0019] Figure 2 This is the electrophoresis result diagram of light green peel and green peel watermelon materials in the natural population in Example 1. DETAILED DESCRIPTION
[0020] Example 1: Method for obtaining primers for identifying watermelon peel color
[0021] A. Selection of test materials: The test materials include female parents (green peel), male parents (light green peel) and natural populations;
[0022] The maternal material is COS, with green peel; the maternal material is ZXG1555, with light green peel. (Source of the two parents: Pei Shuang, Liu Zheng, Wang Xuezheng, Luan Feishi, Dai Zuyun, Yang Zhongzhou, Zhang Qian, Liu Shi*. Quantitative trait loci and candidate genes responsible for pale green flesh color in watermelon (Citrullus lanantus). 2021, 140, 2: 349-359, Plant Breeding.)
[0023] The F1 generation is obtained by hybridizing the two materials mentioned above as parents;
[0024] The F2 generation population is: the F2 generation population obtained by self-pollination of the above-mentioned F1 generation.
[0025] B. Determination of the peel color of the test materials: Investigate the peel color of the mature fruits of each individual plant during the harvest period;
[0026] According to the survey results in step B, the F1 generation has green peel. Among the F2 generation plants, the number of plants with green peel and light green peel meets the segregation ratio of 3:1, indicating that the light green peel trait of watermelon is regulated by a single recessive gene.
[0027] C. Using BSA-seq and genetic linkage analysis, we identified chromosome segments tightly linked to the light green peel trait in watermelon. Twenty individual plants with both light green and green peel traits were selected from the F2 generation. DNA was extracted from each plant, adjusted to a consistent DNA concentration, and then mixed in equal amounts to construct gene pools for light green and green peel genes. BSA-seq analysis was then performed. Based on the BSA-seq analysis results and combined with genome resequencing data from both parents, InDel molecular markers were developed within the chromosome segments identified by the BSA-seq analysis. Genetic linkage analysis was then performed in the F2 generation, shortening the localization interval and localizing the key gene for the light green peel trait in watermelon to approximately 112 kb on chromosome 9. Figure 1 For preliminary mapping results, the sequence between markers Chr09_13260729 and Chr09_13372942 was obtained to design primers.
[0028] D. Development of candidate InDel markers. Based on the resequencing data from both parents, InDel molecular markers were developed. Genotyping of individual plants in the F2 generation segregating population was performed, and the consistency between genotype and phenotype was assessed in combination with phenotypic data. The results showed that a change in an InDel site within this region (a 16-base insertion from A to ATCATGCCACTAAATCA) was closely linked to the light green rind trait of watermelon.
[0029] Primers were designed based on the sequence between markers Chr09_13260729 and Chr09_13372942. The primer pair was as follows: light green rind-F (upstream primer sequence, SEQ ID NO. 3): 5'-TGAGACTTGTTAAGCCTATTG-3'; light green rind-R (upstream primer sequence, SEQ ID NO. 4): 5'-GACATGACAATTTGTGATCG-3';.
[0030] Example 2: Method for detecting watermelon peel color
[0031] 1. Extraction of genomic DNA:
[0032] Genomic DNA was extracted from the paternal parent, maternal parent, F1 generation, F2 generation, and each individual plant in the natural population. The DNA extraction method was modified based on the method of Murray et al. (1980) (Murray M., Thompson WF, Rapid isolation of high molecular weight plant DNA [J]. Nucl. Acid. Res., 1980, 8: 668-673.).
[0033] i. Wash and dry the collected young true leaves with sterile water, take 0.2 g and place them in a 1.5 mL centrifuge tube, add liquid nitrogen and grind thoroughly to a white powder, add 800 μL of 2% CTAB solution preheated at 65°C (2% CTAB, 100 mmol / L Tris-HCl pH = 8.0), 1.4 mol / L NaCl, 20 mmol / L EDTA pH = 8.0, 2% β-mercaptoethanol) and mix thoroughly, and incubate in a 65°C water bath for 1 hour, shaking gently every 10 minutes.
[0034] ii. Remove the centrifuge tube, cool to room temperature, and centrifuge at 13,000 rpm for 10 minutes. Aspirate the supernatant and transfer it to a fresh centrifuge tube. To prevent mechanical shear damage to the DNA, use scissors to cut the tip of the pipette tip used for transfer to widen the pipette opening.
[0035] iii. Add 750 μL of chloroform:isoamyl alcohol (24:1, V / V) solution to the adherent cells, mix thoroughly, let stand for 10 minutes, and then centrifuge at 13,000 rpm for 10 minutes.
[0036] iv. Remove the centrifuge tube and use the same treatment method as above to aspirate 700 μL of supernatant with a pipette tip attached to the wall and place it in a new centrifuge tube.
[0037] v. Add 700 μL of chloroform:isoamyl alcohol (24:1, V / V) solution to the adherent tube, gently shake the centrifuge tube to fully mix the solution, let it stand for 10 minutes, and then centrifuge at 13,000 rpm for 10 minutes.
[0038] vi. Aspirate 650 μL of supernatant from the tube and place it in a new tube. Add 2 μL of RNase (10 mg / mL) and mix well. Place the tube in a 37°C water bath for 2 hours.
[0039] vii. Add 650 μL of chloroform:isoamyl alcohol (24:1, V / V) solution to the adhered cells, mix thoroughly, let stand for 10 minutes, and then centrifuge at 13,000 rpm for 10 minutes.
[0040] viii. Aspirate 550 μL of the supernatant from the tube and place it in a new tube. Add 550 μL of -20°C pre-cooled isopropanol (add while the tube adheres to the wall). Close the tube tightly, invert it several times, and place it in a -20°C refrigerator for 60 minutes.
[0041] ix. Remove the centrifuge tube and centrifuge at 13,000 rpm for 10 minutes. Carefully discard the supernatant and retain the sediment at the bottom of the centrifuge tube.
[0042] x. Wash the precipitate three times with pre-cooled 70% ethanol, place the centrifuge tube in a clean bench, blow dry with sterile air, add 200 μL ddH2O to dissolve it, and store at -20°C until use.
[0043] F. Development of InDel molecular markers tightly linked to the light green rind trait of watermelon using parental resequencing data.
[0044] The specific operation is as follows: within the initial positioning interval, primers are designed based on the InDel differences in the sequencing data of the two parents. The InDel primers are used to perform PCR amplification on the genomic DNA of each individual plant in the paternal, maternal, F1 and F2 generation populations to obtain PCR products;
[0045] The primer sequences in the above PCR reaction are as follows:
[0046] light green rind-F (upstream primer sequence): 5′-TGAGACTTGTTAAGCCTATTG-3′;
[0047] light green rind-R (upstream primer sequence): 5′-GACATGACAATTTGTGATCG-3′;
[0048] The PCR reaction system is as follows: 1 μL of upstream and downstream primers (primer concentration is 2 pM), 2 μL of DNA template (concentration is 30 ng / μL), 1 μL of 10× PCR Buffer (containing Mg 2+ 15 mM), dNTP 0.15 μL (concentration is 10 mM), Taq enzyme 0.1 μL (5 U / μL), sterile deionized water 6.75 μL;
[0049] The PCR reaction program was as follows: 94°C pre-denaturation for 7 min, 94°C denaturation for 30 s, 53°C annealing for 30 s, 72°C extension for 30 s, 30 cycles, 72°C extension for 10 min, and storage at 4°C.
[0050] PCR amplification product detection: PCR amplification product detection: Take 2 μL of PCR product, add 2 μL of Loading Buffer, mix well, and then spot on polyacrylamide gel. Electrophoresis is performed at 220V / 400mA for 50-60 minutes. The color of the watermelon peel is determined based on the electrophoresis results. If only a 164 bp fragment is present, the peel is light green. If a 179 bp fragment is present or both 179 and 164 bp fragments are present, the peel is green.
[0051] Figure 2 These are the electrophoresis results of PCR products for the light green peel and green peel watermelon varieties in Example 1. Lane 32 is the PCR band result (179bp) of the green peel watermelon variety COS, lane 33 is the PCR band result (164bp) of the light green peel watermelon variety ZXG1555, lane 34 is the PCR amplification result of the F1 generation, lanes 1-2 are the PCR amplification results of the watermelon varieties with light green peel in the natural population, and lanes 3-31 are the PCR amplification results of the watermelon varieties with green peel in the natural population. The test results show that the identification results of the watermelon seed peel color trait are highly correlated with the marker gene typing results.
[0052] Second, if the sample to be tested contains the sequence of SEQ ID NO. 1, then the watermelon peel has a light green peel trait; if the sample to be tested contains the sequence of SEQ ID NO. 2, then the watermelon peel has a green peel trait. The genotype and phenotype are completely consistent, with a 100% consistency.
[0053] Example 3: Kit for detecting light green peel of watermelon
[0054] light green rind-F (upstream primer sequence): 5′-TGAGACTTGTTAAGCCTATTG-3′;
[0055] light green rind-R (upstream primer sequence): 5′-GACATGACAATTTGTGATCG-3′;
[0056] The primer concentration was 2pM, 10×PCR Buffer (containing Mg 2+ 15 mM), dNTP (concentration of 10 mM), Taq enzyme (5 U / μL), sterile deionized water.
[0057] The instruments and reagents used in this embodiment are all conventional products on the market.
[0058] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.
[0059] SEQ ID NO.1:
[0060] TGAGACTTGTTAAGCCTATTG GAGCTATCCGATTTTCCTTTTGATCATGCCACTAAATCTGATGGGCACCATCCAATAATGTCAACTGATTCTAAGATAGAAGATTAGTTCTAATAATAGAGTGTTGAATGAGAAATTTTGGAC CG ATCACAAATTGTCATGTC
[0061] SEQ ID NO.2:
[0062] TGAGACTTGTTAAGCCTATTG GAGCTATCCGATTTTCCTTTTGATCATGCCACTAAATCTCATGCCACTAAATCTGATGGGCACCATCCAATAATGTCAACTGATTCTAAGATAGAAGATTAGTTCTAATAATAGAGTGTTGAATGAGAAATTTTGGAC CGATCACAAATTGTCATGTC
Claims
1. A molecular marker combination for identifying the light green peel trait of watermelon, characterized in that: The molecular marker composition is shown in SEQ ID NO.1 and SEQ ID NO.
2.
2. The use of the molecular marker combination according to claim 1 in identifying the color of watermelon peel, characterized in that: The peel color is light green or green.
3. The use according to claim 2, characterized in that If the watermelon to be tested contains only the SEQ ID NO.1 sequence, the watermelon has a light green peel trait; if the watermelon to be tested contains the SEQ ID NO.2 sequence or contains both the SEQ ID NO.1 and SEQ ID NO.2 sequences, the watermelon has a green peel trait.
4. A kit for identifying the color of watermelon peel, characterized in that: The kit contains the primer pair shown in SEQ ID NO. 3 and SEQ ID NO.
4.
5. Use of the primer pair shown in SEQ ID NO. 3 and SEQ ID NO. 4 or the kit according to claim 4 in identifying the color of watermelon peel, characterized in that: The peel color is light green or green.
6. A method for identifying the color of watermelon peel, characterized in that: The steps of the method are as follows: (1) Extract genomic DNA from the watermelon leaves to be tested; (2) using the genomic DNA obtained in step (1) as a template, performing PCR amplification using a primer pair to obtain a PCR product; the primer pair includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.4; (3) Determine the color of the watermelon peel by detecting the PCR product; the color of the peel is green or light green.
7. The method according to claim 6, characterized in that the PCR product in step (3) is detected by using polyacrylamide gel electrophoresis to detect the fragment size of the PCR product. If only a 164 bp fragment is present, the fruit peel trait is light green; if a 179 bp fragment is present or both 179 bp and 164 bp fragments are present, the fruit peel trait is green.
8. The molecular marker combination according to claim 1 or 2, the primer pair shown in SEQ ID NO.3 and SEQ ID NO.4, Use of the kit according to claim 4 or the method according to claim 6 or 7 in assisted identification of watermelon peel color, assisted breeding, and watermelon peel color screening; the peel color is green or light green.
Citation Information
Patent Citations
CAPS molecular marker for identifying background color of watermelon peel and application thereof
CN109251995A
DNA marker for selecting fruit shape of watermelon
KR1020160095213A