A DNA barcode, primers, and their applications for screening high-quality Tibetan brown mushrooms.
By designing 17 DNA barcodes and amplification primers, combined with PCR amplification and capillary fluorescence electrophoresis detection, the problem of inaccurate screening of Tibetan brown mushroom varieties in existing technologies has been solved, achieving rapid and low-cost screening of high-quality varieties.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- LHASA PLATEAU BIOSES RES INST
- Filing Date
- 2020-02-21
- Publication Date
- 2026-05-26
AI Technical Summary
Existing DNA barcoding technology has problems such as poor identification effect, complicated operation, high cost and unstable repeatability when screening Tibetan brown mushroom varieties. It is difficult to accurately screen high-quality varieties with high total protein, total soluble protein, total hydrolyzed amino acids, total polysaccharide and total polyphenol content, strong antioxidant activity and low polyphenol oxidase activity.
A design containing 17 DNA barcodes and 17 pairs of amplification primers, based on simple repetitive sequences (SSRs) in the whole genome of *Pleurotus ostreatus*, was developed to screen for high-quality varieties with the aforementioned traits. Rapid identification was achieved through PCR amplification and capillary fluorescence electrophoresis.
This method enables rapid and accurate screening of Tibetan brown mushroom varieties, reduces costs, improves screening efficiency and result stability, and avoids waste and inaccuracy in traditional methods.
Smart Images

Figure CN116334291B_ABST
Abstract
Description
[0001] This application is a divisional application of the invention patent application filed on February 21, 2020, with application number 202010108852.8 and invention title "A DNA barcode, primer and its application for screening high-quality Tibetan brown mushrooms". Technical Field
[0002] This invention relates to the field of edible fungi germplasm resource screening technology, and more specifically, to a DNA barcode, primer, and its application for screening high-quality Tibetan brown mushrooms. Background Technology
[0003] The Tibetan brown mushroom, a type of button mushroom, has a light brown color between brown and white button mushrooms. White button mushrooms are prone to browning, affecting their quality, while brown button mushrooms are less prone to browning and have a high protein content. The main factor causing browning is the activity of polyphenol oxidase in button mushrooms; the higher the activity, the easier it is to brown. The Tibetan brown mushroom is a type of mushroom that is less prone to browning and possesses the excellent qualities of both white and brown button mushrooms. The main indicators for evaluating high-quality edible fungi varieties such as button mushrooms include: high content of total protein, total soluble protein, total hydrolyzed amino acids, total polysaccharides, and total polyphenols, strong antioxidant activity, and low polyphenol oxidase activity. Traditionally, wild samples are collected, domesticated, and then cultivated in the field. Plump, disease-free fruiting bodies are selected to isolate mycelium and preserve the strain. Simultaneously, the above indicators are measured on each fruiting body. Only by selecting high-quality individuals and corresponding strains can high-quality varieties be obtained. This selection process is lengthy and inefficient. The limited number of wild samples makes it impossible to determine the above indicators. Sufficient individuals must be obtained through mycelial isolation and preservation of the fungal strain for field cultivation before these indicators can be measured. Furthermore, for wild samples lacking high-quality indicators, subsequent domestication and field cultivation efforts will be wasted.
[0004] To realize the development and utilization of Tibetan brown mushrooms, screening high-quality Tibetan brown mushroom varieties is particularly important and urgent. Previously, the breeding of Tibetan brown mushrooms mainly relied on morphological methods combined with the determination of the aforementioned beneficial indicators. However, due to the unique climate and environment of the Qinghai-Tibet Plateau, Tibetan brown mushrooms from different regions often exhibit homonyms and synonyms, making morphological identification methods ineffective. Even more challenging is the inability to screen for high-quality varieties with high total protein, total soluble protein, total hydrolyzed amino acids, total polysaccharides, and total polyphenol content, strong antioxidant activity, and low polyphenol oxidase activity using morphological methods. DNA barcoding molecular identification technology is a molecular biology technique based on DNA barcoding (conserved and stable genetic DNA sequences in the genome) for species and quality identification. It is an effective supplement and extension to traditional breeding methods, enabling accurate and effective identification of samples when morphological features are incomplete or lack morphological structure (processed products such as powders). Existing DNA barcoding technologies utilize ITS (internal transcribed spacer region) in ribosomes and non-coding regions or conserved gene sequences in mitochondria as DNA barcoding sequences. However, this approach is primarily limited to identifying a small number of genes or fragments, resulting in low information content and poor identification efficiency. Furthermore, it cannot be used for screening for superior quality characteristics. Restriction fragment length polymorphism (RFLP) in existing DNA barcoding technologies is cumbersome and complex, requiring radioactive isotope labels or carcinogenic imaging markers. It also consumes large amounts of genomic templates, resulting in few bands and limited information, and is susceptible to gene mutations, leading to unstable results. Random amplified polymorphic DNA (RAPD) in existing DNA barcoding technologies is prone to interference, demanding high operator skill and stability for reproducibility. Additionally, the quality and concentration of the sample genomic template, primer length and sequence, PCR cycle number, genomic DNA complexity, and equipment all contribute to poor reproducibility of RAPD. Existing DNA barcoding technologies, particularly single nucleotide polymorphism (SNP) techniques, rely on SNP chips or mass spectrometry and sequencing, which are demanding, expensive, and costly. Therefore, to address the shortcomings of traditional breeding methods for selecting Tibetan brown mushroom varieties—namely, inaccuracy, time-consumingness, and labor-intensiveness—it is necessary to provide a DNA barcoding technology that can accurately and quickly identify the variety of Tibetan brown mushroom while simultaneously enabling the selection of high-quality varieties. Furthermore, this technology should address the deficiencies of existing DNA barcoding techniques by providing a low-cost, efficient, easy-to-operate, and stable, reliable, and reproducible detection method. Summary of the Invention
[0005] The purpose of this invention is to overcome the above-mentioned defects and deficiencies in the prior art and to provide a DNA barcode for screening high-quality Tibetan brown mushrooms.
[0006] Another objective of this invention is to provide a DNA barcoding amplification primer for screening high-quality Tibetan brown mushrooms.
[0007] Another object of the present invention is to provide the application of the DNA barcode and amplification primers.
[0008] Another object of the present invention is to provide a method for screening high-quality Tibetan brown mushroom varieties.
[0009] The above-mentioned objective of this invention is achieved through the following technical solution:
[0010] DNA barcodes used for screening high-quality Tibetan brown mushrooms contain one or more of 17 DNA fragments with nucleotide sequences as shown in SEQ ID NO: 1 to 17.
[0011] This invention screens all simple sequence repeats (SSRs) in the whole genome of *Pleurotus eryngii* to identify 17 DNA barcodes that can both identify the species and are associated with high levels of total protein, total soluble protein, total hydrolyzed amino acids, total polysaccharides, and total polyphenols, strong antioxidant activity, and low polyphenol oxidase activity. These barcodes can be used to assist in the breeding of *Pleurotus eryngii* varieties with high levels of total protein, total soluble protein, total hydrolyzed amino acids, total polysaccharides, and total polyphenols, strong antioxidant activity, and low polyphenol oxidase activity. The DNA barcodes used for screening total protein and total soluble protein content indicators have nucleotide sequences as shown in SEQ ID NO: 1–3, respectively; the DNA barcodes used for screening total hydrolyzed amino acid content indicators have nucleotide sequences as shown in SEQ ID NO: 4–5, respectively; the DNA barcodes used for screening total polysaccharide content indicators have nucleotide sequences as shown in SEQ ID NO: 6–8, respectively; the DNA barcodes used for screening total polyphenol content indicators have nucleotide sequences as shown in SEQ ID NO: 9–11, respectively; the DNA barcodes used for screening antioxidant activity indicators have nucleotide sequences as shown in SEQ ID NO: 12–14, respectively; and the DNA barcodes used for screening polyphenol oxidase activity indicators have nucleotide sequences as shown in SEQ ID NO: 15–17, respectively. This invention provides 2 to 3 DNA barcodes for each screening trait of Tibetan brown mushroom varieties. When only one DNA barcode is selected as the target sequence for detection, Tibetan brown mushroom varieties with excellent traits can be selected. When all DNA barcodes are selected as target sequences at the same time, the accuracy and efficiency of screening varieties with excellent traits can be greatly improved.
[0012] The DNA barcodes corresponding to the aforementioned trait indicators of this invention can be combined and used in combination according to actual screening needs. For example, when only one Tibetan brown mushroom variety with superior traits needs to be screened, such as Tibetan brown mushroom varieties with high total protein and total soluble protein content, high total hydrolyzed amino acid content, high total polysaccharide content, high total polyphenol content, strong antioxidant activity, or low polyphenol oxidase activity, the DNA barcodes corresponding to the aforementioned screening indicators are selected as target sequences for detection. When two or more Tibetan brown mushroom varieties with superior traits need to be screened simultaneously, the DNA barcodes corresponding to the trait indicators can be combined and used in combination according to actual needs. When the above 17 DNA barcodes are used together as target sequences for screening, Tibetan brown mushroom varieties with the highest screening accuracy, characterized by high total protein, total soluble protein, total hydrolyzed amino acid, total polysaccharide, and total polyphenol content, strong antioxidant activity, and low polyphenol oxidase activity, can be obtained.
[0013] Preferably, a set of DNA barcodes for screening Tibetan brown mushroom varieties with high content of total protein, total soluble protein, total hydrolyzed amino acids, total polysaccharides and total polyphenols, strong antioxidant activity and low polyphenol oxidase activity contains a total of 17 DNA fragments, the nucleotide sequences of which are shown in SEQ ID NO: 1 to 17.
[0014] DNA barcoding amplification primers for screening high-quality Tibetan brown mushrooms contain one or more of 17 primer pairs with upstream and downstream nucleotide sequences as shown in SEQ ID NO: 18-51, respectively. The DNA barcode amplification primers used for screening total protein and total soluble protein content indicators include three pairs of primers, with nucleotide sequences shown in SEQ ID NO: 18-23; the DNA barcode amplification primers used for screening total hydrolyzed amino acid content indicators include two pairs of primers, with nucleotide sequences shown in SEQ ID NO: 24-27; the DNA barcode amplification primers used for screening total polysaccharide content indicators include three pairs of primers, with nucleotide sequences shown in SEQ ID NO: 28-33; the DNA barcode amplification primers used for screening total polyphenol content indicators include three pairs of primers, with nucleotide sequences shown in SEQ ID NO: 34-39; the DNA barcode amplification primers used for screening antioxidant activity indicators include three pairs of primers, with nucleotide sequences shown in SEQ ID NO: 40-45; and the DNA barcode amplification primers used for screening polyphenol oxidase activity indicators include three pairs of primers, with nucleotide sequences shown in SEQ ID NO: 18-23. ID NO: 46-51 as shown.
[0015] This invention uses the aforementioned 17 DNA barcodes as target sequences and designs 17 primer pairs based on the analysis of all simple sequence repeat (SSR) sites in the whole genome of *Pleurotus eryngii*. The polymorphisms of the fragments amplified using these 17 primer pairs can assist in the selection of brown mushrooms with high total protein, total soluble protein, total hydrolyzed amino acids, total polysaccharides, and total polyphenols content, strong antioxidant activity, and low polyphenol oxidase activity. The effect of assisted breeding can be achieved by electrophoresis detection after PCR amplification. As described above regarding DNA barcodes, the 17 DNA barcode amplification primer pairs can be selected from 2-3 primer pairs included in the trait indicators to be screened, or used together, to improve the accuracy and efficiency of screening varieties with superior traits, depending on the actual trait screening requirements. When the above 17 pairs of DNA barcode amplification primers are used together as detection primers, Tibetan brown mushroom varieties with the highest screening accuracy, high content of total protein, total soluble protein, total hydrolyzed amino acids, total polysaccharides and total polyphenols, strong antioxidant activity and low polyphenol oxidase activity can be obtained.
[0016] Preferably, a set of DNA barcoding primers for screening Tibetan brown mushroom varieties with high total protein, total soluble protein, total hydrolyzed amino acids, total polysaccharides, and total polyphenols content, strong antioxidant activity, and low polyphenol oxidase activity is provided. The set comprises 17 pairs of primers, with the upstream and downstream nucleotide sequences of which are shown in SEQ ID NO: 18-51, respectively. High-quality Agaricus bisporus As2796 has an average total protein content of 260 mg / g, an average soluble total protein content of 80 mg / g, an average total hydrolyzed amino acid content of 160 mg / g, an average total polysaccharide content of 70 mg / g, an average total polyphenol content of 10 mg / g, an average ABTS free radical scavenging rate of 70%, and a polyphenol oxidase activity of 4420 units / g. Using the primers of this invention, Tibetan brown mushroom samples with superior performance across all indicators compared to Agaricus bisporus As2796 can be screened.
[0017] This invention also provides the application of the above-mentioned DNA barcode or DNA barcode amplification primers in screening or assisting in the breeding of high-quality Tibetan brown mushroom varieties.
[0018] A method for screening high-quality Tibetan brown mushroom varieties includes the following steps:
[0019] S1. Extract genomic DNA from the sample to be tested;
[0020] S2. Using S1 genomic DNA as a template, select one or more pairs of amplification primers from the above DNA barcodes according to the trait screening requirements and perform PCR amplification reactions respectively;
[0021] S3. The PCR amplification products of S2 are detected by capillary fluorescence electrophoresis, and the results are determined by the number of fragments, the number of SSR sites, the number of SSR repeat elements and their repeat times.
[0022] For example, when it is necessary to screen for Tibetan brown mushroom varieties with high total protein and total soluble protein content, at least one pair of the three primer pairs shown in SEQ ID NO: 18-23 is used for PCR amplification reaction detection in step S2; when it is necessary to screen for Tibetan brown mushroom varieties with high total protein, high total soluble protein content, and high total hydrolyzed amino acid content, at least one pair of the three primer pairs shown in SEQ ID NO: 18-23 and at least one pair of the two primer pairs shown in SEQ ID NO: 24-27 are used for PCR amplification reaction detection in step S2.
[0023] Preferably, the PCR amplification reaction system in step S2 consists of 5 μL of 2×Taq PCR Master Mix, 1 μL of template, 0.1 μL of upstream primer, 0.4 μL of downstream primer, 0.4 μL of 10 μM fluorescent M13 primer, and diluted to 10 μL with sterile deionized water.
[0024] Preferably, the PCR amplification reaction program in step S2 is as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, PCR annealing at 62 to 55℃ for 30 s, extension at 72℃ for 30 s, for a total of 10 cycles; 95℃ denaturation for 30 s, 52℃ annealing for 30 s, extension at 72℃ for 30 s, for a total of 25 cycles; final extension at 72℃ for 20 min; and incubation at 4℃ for 6 h.
[0025] Specifically, when screening for Tibetan brown mushroom varieties with high total protein and total soluble protein content in step S2, PCR amplification reactions can be performed using the three primer pairs shown in SEQ ID NO: 18-23, and the PCR amplification products can be detected by capillary electrophoresis. Detection and judgment: Judgment is made based on the SSR sites and SSR repeat elements in the primer amplification fragments. When using primer 1.1 for fragment amplification, if two fragments (two peaks) are obtained, each containing two SSR sites with an SSR repeat element of AG, and one fragment has 5 repeats of AG while the other has 6 repeats of AG, then the sample is identified as *Pleurotus ostreatus*, a mushroom with high total protein and total soluble protein content. When using primer 1.2 for fragment amplification, if two fragments (two peaks) are obtained, each containing two SSR sites with an SSR repeat element of CA, and one fragment has 6 repeats of CA while the other has 7 repeats of CA, then the sample is identified as *Pleurotus ostreatus*, a mushroom with high total protein and total soluble protein content. When using primer 1.3 for fragment amplification, if one fragment (one peak) is obtained, containing one SSR site with an SSR repeat element of AC, and the fragment has 5 repeats of AC, then the sample is identified as *Pleurotus ostreatus*, a mushroom with high total protein and total soluble protein content. The best accuracy is achieved when primers 1.1, 1.2, and 1.3 are used simultaneously for comprehensive detection and identification.
[0026] Specifically, when screening for Tibetan brown mushroom varieties with high total hydrolyzed amino acid content in step S2, PCR amplification reactions can be performed using the two primer pairs shown in SEQ ID NO: 24-27, and the PCR amplification products can be detected by capillary electrophoresis. The detection is based on the SSR sites and SSR repeat elements in the primer-amplified fragments. When using primer 2.1 for fragment amplification, if a fragment (one peak) containing one SSR site with an AT repeat element and 11 AT repeats is obtained, the sample is identified as Tibetan brown mushroom with high total hydrolyzed amino acid content. When using primer 2.2 for fragment amplification, if a fragment (one peak) containing one SSR site with an AT repeat element and 5 AT repeats is obtained, the sample is identified as Tibetan brown mushroom with high total hydrolyzed amino acid content. The accuracy is best when primers 1.1 and 1.2 are used simultaneously for comprehensive detection.
[0027] Specifically, when screening for Tibetan brown mushroom varieties with high total polysaccharide content in step S2, PCR amplification reactions are performed using the three primer pairs shown in SEQ ID NO: 28-33, and the PCR amplification products are detected by capillary electrophoresis. Detection and judgment are based on the SSR sites and SSR repeat elements in the primer amplification fragments. When using primer 3.1 for fragment amplification, if two fragments (two peaks) are obtained, each containing two SSR sites with the SSR repeat element TG, and one fragment has 7 repeats of TG while the other has 9 repeats of TG, then the sample is identified as *Pleurotus tumefaciens*, a mushroom with high total polysaccharide content. When using primer 3.2 for fragment amplification, if one fragment (one peak) is obtained, containing one SSR site with the SSR repeat element TC, and the fragment has 11 repeats of TC, then the sample is identified as *Pleurotus tumefaciens*, a mushroom with high total polysaccharide content. When using primer 3.3 for fragment amplification, if one fragment (one peak) is obtained, containing one SSR site with the SSR repeat element AT, and the fragment has 6 repeats of AT, then the sample is identified as *Pleurotus tumefaciens*, a mushroom with high total polysaccharide content. The best accuracy is achieved when primers 3.1, 3.2, and 3.3 are used simultaneously for comprehensive detection and identification.
[0028] Specifically, when screening for Tibetan brown mushroom varieties with high total polyphenol content in step S2, PCR amplification reactions are performed using the three primer pairs shown in SEQ ID NO: 34-39, and the PCR amplification products are detected by capillary electrophoresis. Detection and judgment are based on the SSR sites and SSR repeat elements in the primer amplification fragments. When using primer 4.1 for fragment amplification, if one fragment (one peak) is amplified, containing one SSR site with the SSR repeat element CT, and the amplified fragment has 7 repeats of CT, then the sample is identified as *Mammillaria tibetica*, a Tibetan brown mushroom with high total polyphenol content. When using primer 4.2 for fragment amplification, if one fragment (one peak) is amplified, containing one SSR site with the SSR repeat element AT, and the amplified fragment has 6 repeats of AT, then the sample is identified as *Mammillaria tibetica*, a Tibetan brown mushroom with high total polyphenol content. When using primer 4.3 for fragment amplification, if two fragments (two peaks) are amplified, containing two SSR sites with the SSR repeat element AT, and one amplified fragment has 6 repeats of GA while the other has 11 repeats of GA, then the sample is identified as *Mammillaria tibetica*, a Tibetan brown mushroom with high total polyphenol content. The accuracy is best when primers 4.1, 4.2, and 4.3 are used simultaneously for comprehensive detection and identification.
[0029] Specifically, when screening for Tibetan brown mushroom varieties with strong antioxidant activity in step S2, PCR amplification reactions were performed using the three primer pairs shown in SEQ ID NO: 40-45, and the PCR amplification products were detected by capillary electrophoresis. Detection and judgment were based on the SSR sites and SSR repeat elements in the primer amplification fragments. When using primer 5.1 for fragment amplification, if two fragments (two peaks) are amplified, each containing two SSR sites with the SSR repeat element AG, and one fragment has six AG repeats while the other has seven, then the sample is identified as *Pleurotus ostreatus*, a species with strong antioxidant activity. When using primer 5.2 for fragment amplification, if one fragment (one peak) is amplified, each containing one SSR site with the SSR repeat element CCA, and the fragment has four CCA repeats, then the sample is identified as *Pleurotus ostreatus*, a species with high total polyphenol content. When using primer 5.3 for fragment amplification, if two fragments (two peaks) are amplified, each containing two SSR sites with the SSR repeat element CAG, and one fragment has six CAG repeats while the other has eight, then the sample is identified as *Pleurotus ostreatus*, a species with high total polyphenol content. The best accuracy is achieved when primers 5.1, 5.2, and 5.3 are used simultaneously for comprehensive detection and identification.
[0030] Specifically, when screening for Tibetan brown mushroom varieties with low polyphenol oxidase activity in step S2, PCR amplification reactions were performed using the three primer pairs shown in SEQ ID NO: 46-51, and the PCR amplification products were detected by capillary electrophoresis. Detection and judgment were based on the SSR sites and SSR repeat elements in the primer amplification fragments. When using primer 6.1 for fragment amplification, if two fragments (two peaks) are obtained, each containing two SSR sites with the SSR repeat element TGA, and one fragment has five TGA repeats while the other has eight, then the sample is identified as *Pleurotus tumefaciens*, a species with low polyphenol oxidase activity. When using primer 6.2, if one fragment (one peak) is obtained, containing one SSR site with the SSR repeat element TTG, and the fragment has eight TTG repeats, then the sample is identified as *Pleurotus tumefaciens*, a species with low polyphenol oxidase activity. When using primer 6.3, if one fragment (one peak) is obtained, containing one SSR site with the SSR repeat element AAG, and the fragment has three AAG repeats, then the sample is identified as *Pleurotus tumefaciens*, a species with high total polyphenol content. The best accuracy is achieved when primers 6.1, 6.2, and 6.3 are used simultaneously for comprehensive detection and identification.
[0031] The present invention also claims protection for the use of the above-mentioned DNA barcode or the above-mentioned DNA barcode amplification primers in the preparation of products for screening high-quality Tibetan brown mushroom varieties.
[0032] A product for screening high-quality Tibetan brown mushrooms contains amplification primers for detecting the aforementioned 17 DNA barcodes.
[0033] Preferably, it comprises one or more of the 17 pairs of primers, with upstream and downstream nucleotide sequences as shown in SEQ ID NO: 18-51, respectively.
[0034] Preferably, the product further comprises reagents required for PCR amplification reactions and for fluorescence capillary electrophoresis detection.
[0035] Preferably, the product is a reagent kit.
[0036] Compared with the prior art, the present invention has the following beneficial effects:
[0037] This invention provides a DNA barcode and primers for screening high-quality Tibetan brown mushrooms. It allows for identification and selection of superior varieties using wild samples of Tibetan brown mushrooms and small amounts of tissue or mycelium. It can identify varieties and select superior varieties at different growth stages of Tibetan brown mushrooms, including mycelium, primordia, fruiting bodies, and spores. The screening cycle is short, not limited by sample type, and avoids waste, overcoming the shortcomings of traditional breeding methods for selecting Tibetan brown mushroom varieties, which are often inaccurate, time-consuming, and labor-intensive. The DNA barcode and primers of this invention can accurately identify varieties with high morphological similarity and correspond to superior qualities such as high content of total protein, total soluble protein, total hydrolyzed amino acids, total polysaccharides, and total polyphenols, strong antioxidant activity, and low polyphenol oxidase activity, thus assisting in the selection of superior Tibetan brown mushroom varieties. It is not only low-cost and highly efficient, but also simple to operate, with stable, reliable, and reproducible results. Compared with traditional breeding methods and other existing DNA barcoding technologies, this invention has the advantages of being time-saving, labor-saving, cost-saving, accurate, and efficient. It plays a positive role in the genetic breeding of high-quality Tibetan brown mushrooms and also provides an effective method for the identification and protection of germplasm resources. Attached Figure Description
[0038] Figure 1 Specific primers were screened for high-quality varieties of *Mushroom tigrinum* with high total protein and total soluble protein content. PCR amplification products were detected by capillary electrophoresis. (1.1, 1.2, 1.3)
[0039] Figure 2 Specific primers were screened for high-quality varieties of Tibetan brown mushrooms with high total hydrolyzed amino acid content. 2.1, 2.2 PCR amplification products were detected by capillary electrophoresis.
[0040] Figure 3 Specific primers were screened for high-quality varieties of *Mushroom tigrinum* with high total polysaccharide content. 3.1, 3.2, 3.3 PCR amplification products were detected by capillary electrophoresis.
[0041] Figure 4 Screening specific primers for high-quality varieties of Tibetan brown mushrooms with high total polyphenol content. 4.1, 4.2, 4.3 PCR amplification products were detected by capillary electrophoresis.
[0042] Figure 5 Screening specific primers for high-quality varieties of *Pleurotus ostreatus* with strong antioxidant activity. 5.1, 5.2, 5.3 PCR amplification products were detected by capillary electrophoresis.
[0043] Figure 6 Screening specific primers for high-quality varieties of *Mushroom tigrinum* with low polyphenol oxidase activity. 6.1, 6.2, 6.3 PCR amplification products were detected by capillary electrophoresis.
[0044] Figure 7 The results show the comparison of total protein content between Example 1 and Comparative Example 1.
[0045] Figure 8 The results show the comparison of soluble total protein content between Example 1 and Comparative Example 1.
[0046] Figure 9 The amplification results of Example 1 and Comparative Example 1 were amplified using primer 1.1.
[0047] Figure 10 To amplify the amplification results of Example 1 and Comparative Example 1 using primer 1.2.
[0048] Figure 11 The amplification results of Example 1 and Comparative Example 1 were amplified using primer 1.3.
[0049] Figure 12 The results show the comparison of the total hydrolyzed amino acid content between Example 2 and Comparative Example 2.
[0050] Figure 13 To amplify the amplification results of Example 2 and Comparative Example 2 using primer 2.1.
[0051] Figure 14 To amplify the amplification results of Example 2 and Comparative Example 2 using primer 2.2.
[0052] Figure 15 The results show the comparison of total polysaccharide content between Example 3 and Comparative Example 3.
[0053] Figure 16 The amplification results of Example 3 and Comparative Example 3 were amplified using primer 3.1.
[0054] Figure 17 The amplification results of Example 3 and Comparative Example 3 were amplified using primer 3.2.
[0055] Figure 18 To amplify the amplification results of Example 3 and Comparative Example 3 using primer 3.3.
[0056] Figure 19 The results show the comparison of total polyphenol content between Example 4 and Comparative Example 4.
[0057] Figure 20 The amplification results of Example 4 and Comparative Example 4 were amplified using primer 4.1.
[0058] Figure 21 The amplification results of Example 4 and Comparative Example 4 were amplified using primer 4.2.
[0059] Figure 22 The amplification results of Example 4 and Comparative Example 4 were amplified using primer 4.3.
[0060] Figure 23 The results show the comparison of antioxidant activity between Example 5 and Comparative Example 5.
[0061] Figure 24 The amplification results of Example 5 and Comparative Example 5 were amplified using primer 5.1.
[0062] Figure 25 The amplification results of Example 5 and Comparative Example 5 were amplified using primer 5.2.
[0063] Figure 26 The amplification results of Example 5 and Comparative Example 5 were amplified using primer 5.3.
[0064] Figure 27 The results show the comparison of polyphenol oxidase activity between Example 6 and Comparative Example 6.
[0065] Figure 28 The amplification results of Example 6 and Comparative Example 6 were amplified using primer 6.1.
[0066] Figure 29 The amplification results of Example 6 and Comparative Example 6 were amplified using primer 6.2.
[0067] Figure 30 The amplification results of Example 6 and Comparative Example 6 were amplified using primer 6.3. Detailed Implementation
[0068] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.
[0069] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.
[0070] Example 0: Construction and identification method of DNA barcodes from *Brown Mushroom tibetica*
[0071] Based on the analysis of all simple sequence repeat (SSR) sites in the whole genome of *Pleurotus eryngii*, 17 pairs of primers were screened and designed. The polymorphism of the fragments obtained by amplifying the genome of the sample using these 17 pairs of primers can help select brown mushrooms with high content of total protein, total soluble protein, total hydrolyzed amino acids, total polysaccharides and total polyphenols, strong antioxidant activity and low polyphenol oxidase activity.
[0072] (1) SSR-specific primer amplification for varieties with high total protein and total soluble protein content
[0073] The total protein content in the fruiting bodies of *Pleurotus ostreatus* was determined according to the Kjeldahl method in GB5009.5-2016, "National Food Safety Standard: Determination of Protein in Food".
[0074] For the extraction of soluble total protein, the fruiting bodies of *Agaricus bisporus* were collected, dehydrated by vacuum freeze-drying, pulverized, and passed through a 50-mesh sieve. 1 gram of dry powder was added to 20 mL of double-distilled water, and extraction was performed using ultrasound at 300 W for 30 min. The mixture was then centrifuged at 5000 rpm for 30 min, and the supernatant was collected to prepare the soluble total protein extract. The soluble total protein content in the extract was determined using the Beyotime Biotechnology BCA Protein Assay Kit (Enhanced Version) (catalog number P0010S) and converted to mg / g. *Agaricus bisporus* samples with total protein and soluble total protein contents higher than 260 mg / g and 80 mg / g respectively (these indicators are the average total protein and soluble total protein contents of *Agaricus bisporus* As2796) were selected for SSR-specific primer amplification, as follows:
[0075] The genome of *Brownia tomentosa* samples was extracted using the Ezup column-based fungal genomic DNA extraction kit (catalog number B518259) from Sangon Biotech (Shanghai) Co., Ltd., and diluted to 20 ng / μL for subsequent validation experiments via fluorescent PCR amplification.
[0076] Dilute the primers to 10 μM and perform PCR amplification according to the following conditions and the specific primers described in Table 1. Reaction system (10 μL): 5 μL 2×Taq PCR Master Mix, 1 μL template (genomic DNA), 0.1 μL upstream primer, 0.4 μL downstream primer, 0.4 μL fluorescent M13 primer (10 μM concentration), and bring to a final volume of 10 μL with sterile deionized water; Reaction conditions: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 62 to 55℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 10 cycles; 95℃ denaturation for 30 s, 52℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 25 cycles; final extension at 72℃ for 20 min; incubate at 4℃ for 6 h before detection by fluorescent capillary electrophoresis.
[0077] Table 1. Specific primers for screening high-quality varieties of *Mushroom tigrinum* with high total protein and total soluble protein content.
[0078] serial number upstream primer Depolymerization temperature (°C) Downstream primer Depolymerization temperature (°C) Amplified fragment length (bp) 1.1 AAGCCGGGTATCATGAAGCC 60.179 GCGTCTTTCTCTGTCACCGA 60.039 124 1.2 GGTCAGGGCATACGAACACA 60.037 GCCTAGGCGCGATTAGAGTT 59.968 158 1.3 GAGGATCATCATACCCGCGG 60.109 AAGATTCCTCTCCTCCGGCT 60.032 270
[0079] Primer 1.1 amplifies the fragment (target sequence) as shown in SEQ ID NO: 1, 124bp.
[0080] Primer 1.2 amplifies the fragment (target sequence) as shown in SEQ ID NO: 2, 158bp.
[0081] Primer 1.3 amplifies the fragment (target sequence) as shown in SEQ ID NO: 3, 270bp.
[0082] After quantitative dilution of the PCR product, 1 μL of the diluted PCR product was denatured with 9 μL of formamide (containing 1% internal standard) and then analyzed by capillary fluorescence electrophoresis on an ABI 3730xl DNA sequencer. The internal standard was LIZ-500 molecular weight internal standard (also known as internal lane standard), consisting of 16 double-stranded DNA fragments labeled with LIZ fluorescein (orange), with molecular weights of 35, 50, 75, 100, 139, 150, 160, 200, 250, 300, 340, 350, 400, 450, 490, and 500 bp. The amplification results are as follows. Figure 1 As shown, the fragment size in the electrophoresis diagram is equal to the actual bp number of the amplified fragment plus 18 bp of the M13 fluorescent primer. The two peaks in the capillary electrophoresis indicate that the gene is heterozygous and has two similar fragments.
[0083] Detection and Judgment: Judgment is made based on the SSR sites and SSR repeat elements in the amplified fragments. When using primer 1.1 for fragment amplification, if two fragments (two peaks) are obtained, containing two SSR sites and an SSR repeat element of AG, with one fragment having 5 repeats of AG and the other having 6 repeats of AG, then the sample is identified as *Mammillaria tibetica*, a mushroom with high total protein and total soluble protein content. When using primer 1.2 for fragment amplification, if two fragments (two peaks) are obtained, containing two SSR sites and an SSR repeat element of CA, with one fragment having 6 repeats of CA and the other having 7 repeats of CA, then the sample is identified as *Mammillaria tibetica*, a mushroom with high total protein and total soluble protein content. When using primer 1.3 for fragment amplification, if one fragment (one peak) is obtained, containing one SSR site and an SSR repeat element of AC, with the amplified fragment having 5 repeats of AC, then the sample is identified as *Mammillaria tibetica*, a mushroom with high total protein and total soluble protein content. The accuracy is best when primers 1.1, 1.2, and 1.3 are used simultaneously for comprehensive detection and judgment.
[0084] (2) SSR-specific primer amplification for varieties with high total hydrolyzed amino acid content
[0085] The total hydrolyzed amino acid content in the fruiting bodies of *Pleurotus ostreatus* was determined according to the method specified in GB 5009.124-2016, "National Food Safety Standard: Determination of Amino Acids in Food".
[0086] Tibetan brown mushroom samples with a total hydrolyzed amino acid content higher than 160 mg / g were selected (this index is the average total hydrolyzed amino acid content of Agaricus bisporus As2796). Primer sequences are shown in Table 2, and SSR-specific primer amplification was performed as described in (1). The amplification results are as follows. Figure 2 As shown in the electrophoresis diagram, the fragment size is equal to the actual bp number of the amplified fragment plus 18 bp of the M13 fluorescent primer.
[0087] Table 2. Specific primers for screening high-quality varieties of *Mushroom tibetica* with high total hydrolyzed amino acid content.
[0088] serial number upstream primer Depolymerization temperature (°C) Downstream primer Depolymerization temperature (°C) Amplified fragment length (bp) 2.1 GCTTCACTCGTGGTGCTACT 60.038 ACTCTCCAGGGCCTCAATCT 59.956 213 2.2 TACCGAATTGCCCACTGGTC 60.036 GCTTCAACGATCACGATGGC 59.973 198
[0089] Primer 2.1 amplifies the fragment (target sequence) as shown in SEQ ID NO: 4, 213 bp.
[0090] Primer 2.2 amplifies the fragment (target sequence) as shown in SEQ ID NO: 5, 198bp.
[0091] Detection and Judgment: Judgment is made based on the SSR sites and SSR repeat elements in the amplified fragments. When using primer 2.1 for fragment amplification, if a fragment (one peak) containing one SSR site with an SSR repeat element of AT and 11 repeats of AT, the sample is identified as *Mammillaria tibetica*, a mushroom with high total hydrolyzed amino acid content. When using primer 2.2 for fragment amplification, if a fragment (one peak) containing one SSR site with an SSR repeat element of AT and 5 repeats of AT, the sample is identified as *Mammillaria tibetica*, a mushroom with high total hydrolyzed amino acid content. The accuracy is best when primers 1.1 and 1.2 are used simultaneously for comprehensive detection and judgment.
[0092] (3) Screening of varieties with high total polysaccharide content
[0093] For the extraction of total polysaccharides, the fruiting bodies of *Pleurotus ostreatus* were collected, dehydrated by vacuum freeze-drying, pulverized, and passed through a 50-mesh sieve. 1 gram of dry powder was added to 20 mL of double-distilled water, and the mixture was extracted using ultrasound at 300 W for 30 min. Then, it was centrifuged at 5000 rpm for 30 min, and the supernatant was collected to prepare the total polysaccharide extract. The total polysaccharide content in the *Pleurotus ostreatus* fruiting body extract was determined using the sulfuric acid-phenol method, specifically referring to Zhao Qiduo et al. (Zhao Qiduo, Shu Lexin, Ma Lin, Cui Guohong. Determination of polysaccharide content in *Pleurotus ostreatus* by sulfuric acid-phenol method [J]. Journal of Yichun University, 2011, 33(08):74-76.), and converted to milligrams per gram.
[0094] Samples with a total polysaccharide content higher than 70 mg / g (this index is the average total polysaccharide content of Agaricus bisporus As2796) were selected for SSR-specific primer amplification. The primer sequences are shown in Table 3, and the method is as described in (1). The amplification results are as follows. Figure 3 As shown, the fragment size in the electrophoresis diagram is equal to the actual bp number of the amplified fragment plus 18 bp of the M13 fluorescent primer. Two peaks in capillary electrophoresis indicate that the gene is heterozygous and has two similar fragments.
[0095] Table 3. Specific primers for screening high-quality varieties of *Pleurotus ostreatus* with high total polysaccharide content.
[0096] serial number upstream primer Depolymerization temperature (°C) Downstream primer Depolymerization temperature (°C) Amplified fragment length (bp) 3.1 CCTCAAGTGATTCGGCCACA 60.322 AGCTCGCGCTGCAAATTATC 59.694 261 3.2 AATGCGTGGACGTGCTCTTA 60.038 GGAATGGACCTTACTGCGGA 59.46 273 3.3 GTTGAAATCAGGCAAGCGCA 60.039 GAGGAATGGAGGCCATCGAG 59.965 180
[0097] Primer 3.1 amplifies the fragment (target sequence) as shown in SEQ ID NO: 6, 261 bp.
[0098] Primer 3.2 amplifies the fragment (target sequence) as shown in SEQ ID NO: 7, 273bp.
[0099] Primer 3.3 amplifies the fragment (target sequence) as shown in SEQ ID NO: 8, 180bp.
[0100] Detection and Judgment: Judgment is made based on the SSR sites and SSR repeat elements in the amplified fragments. When using primer 3.1 for fragment amplification, if two fragments (two peaks) are amplified, containing two SSR sites, with the SSR repeat element being TG, and one amplified fragment has 7 repeats of TG and the other has 9 repeats of TG, then the sample is identified as *Mammillaria tibetica* with a high total polysaccharide content. When using primer 3.2 for fragment amplification, if one fragment (one peak) is amplified, containing one SSR site, with the SSR repeat element being TC, and the amplified fragment has 11 repeats of TC, then the sample is identified as *Mammillaria tibetica* with a high total polysaccharide content. When using primer 3.3 for fragment amplification, if one fragment (one peak) is amplified, containing one SSR site, with the SSR repeat element being AT, and the amplified fragment has 6 repeats of AT, then the sample is identified as *Mammillaria tibetica* with a high total polysaccharide content. The best accuracy is achieved when primers 3.1, 3.2, and 3.3 are used simultaneously for comprehensive detection and judgment.
[0101] (4) Screening of varieties with high total polyphenol content
[0102] For the extraction of total polyphenols, the fruiting bodies of *Mammillaria tibetica* were collected, dehydrated by vacuum freeze-drying, pulverized, and passed through a 50-mesh sieve. 1 gram of dry powder was added to 20 mL of double-distilled water, and the mixture was extracted using ultrasound at 300 W for 30 min. Then, the mixture was centrifuged at 5000 rpm for 30 min, and the supernatant was collected to prepare the total polyphenol extract. The total polyphenol content in the *Mammillaria tibetica* fruiting body extract was determined using the Folin-Ciocalteu method, specifically referring to Wang Jiadan et al. (Wang Jiadan, Xu Ting, Han Wei. Optimization of the method for determining the total polyphenol content in *Flammulina velutipes* [J]. Journal of Nanjing University of Technology (Natural Science Edition), 2017, 39(02):113-120.), and converted to mg / g.
[0103] Samples with a total polyphenol content higher than 10 mg / g (this index is the average total polyphenol content of Agaricus bisporus As2796) were selected. The primer sequences are shown in Table 4. The method is as described in (1). SSR-specific primer amplification was performed, and the amplification results are as follows. Figure 4 As shown in the electrophoresis diagram, the fragment size equals the actual bp number of the amplified fragment plus the 18 bp of the M13 fluorescent primer. The two peaks in capillary electrophoresis indicate that the gene is a heterozygous fragment with two similar segments. Primer 4.3 amplified three fragments with lengths of 125, 270, and 282 base pairs, respectively. The amplified 125 bp allele differs significantly from the corresponding fragment length in the genome (256 bp genomic locus + 18 bp M13 primer). Whole-genome SSR locus analysis indicates a theoretical length of 256 base pairs. Therefore, the 125 bp fragment is determined to be a non-specific amplification fragment and will not be analyzed further in subsequent analyses.
[0104] Table 4. Specific primers for screening high-quality varieties of *Mushroom tigrinum* with high total polyphenol content.
[0105] serial number upstream primer Depolymerization temperature (°C) Downstream primer Depolymerization temperature (°C) Amplified fragment length (bp) 4.1 TCCGGCAATTGAAATGCGTG 60.109 AGAGTTGCGTTGAGAGCGAA 59.968 262 4.2 GGGTCGAAGTGTCAGGTCAG 60.038 TGTAAGCGAGCACGTGTCTT 59.968 147 4.3 ATCCTGAACGTGCGGAACAT 60.036 GCAGAAGTTTGGAGGGACGA 59.965 256
[0106] Primer 4.1 amplifies the fragment (target sequence) as shown in SEQ ID NO: 9, 262bp.
[0107] Primer 4.2 amplifies the fragment (target sequence) as shown in SEQ ID NO: 10, 147bp.
[0108] Primer 4.3 amplifies the fragment (target sequence) as shown in SEQ ID NO: 11, 256 bp.
[0109] Detection and Judgment: Judgment is made based on the SSR sites and SSR repeat elements in the primer-amplified fragments. When using primer 4.1 for fragment amplification, if one fragment (one peak) is amplified, containing one SSR site, with the SSR repeat element being CT, and the amplified fragment has 7 repeats of CT, then the sample is identified as *Mammillaria tibetica*, a mushroom with high total polyphenol content. When using primer 4.2 for fragment amplification, if one fragment (one peak) is amplified, containing one SSR site, with the SSR repeat element being AT, and the amplified fragment has 6 repeats of AT, then the sample is identified as *Mammillaria tibetica*, a mushroom with high total polyphenol content. When using primer 4.3 for fragment amplification, if two fragments (two peaks) are amplified, containing two SSR sites, with the SSR repeat element being AT, and one amplified fragment has 6 repeats of GA, while the other fragment has 11 repeats of GA, then the sample is identified as *Mammillaria tibetica*, a mushroom with high total polyphenol content. The best accuracy is achieved when primers 4.1, 4.2, and 4.3 are used simultaneously for comprehensive detection and judgment.
[0110] (5) Screening of varieties with strong antioxidant activity
[0111] The fruiting bodies of *Pleurotus eryngii* were collected, dehydrated by vacuum freeze-drying, pulverized, and passed through a 50-mesh sieve. 1 gram of dry powder was added to 20 mL of double-distilled water, and extraction was performed using ultrasound-assisted extraction at 300 W for 30 min. The mixture was then centrifuged at 5000 rpm for 30 min, and the supernatant was collected to prepare the aqueous extract. The antioxidant activity of the aqueous extract of *Pleurotus eryngii* fruiting bodies was determined using the Total Antioxidant Capacity Assay Kit (ABTS Rapid Method) (catalog number S0121) from Beyotime Biotechnology Co., Ltd. ABTS is 2,2-azino-bis(3-ethyl-benzothiazole-6-sulfonic acid) diammonium salt, used to determine the total antioxidant activity of food, expressed as a percentage of scavenging.
[0112] Samples with an ABTS free radical scavenging rate higher than 70% were selected. This index is the average percentage of ABTS free radical scavenging in the total antioxidant activity of Agaricus bisporus As2796. Primer sequences are shown in Table 5. SSR-specific primer amplification was performed as described in (1). The amplification results are as follows. Figure 5 As shown, the fragment size in the electrophoresis diagram is equal to the actual bp number of the amplified fragment plus 18 bp of the M13 fluorescent primer. Two peaks in capillary electrophoresis indicate that the gene is heterozygous and has two similar fragments.
[0113] Table 5. Specific primers for screening high-quality varieties of *Pleurotus ostreatus* with strong antioxidant activity.
[0114] serial number upstream primer Depolymerization temperature (°C) Downstream primer Depolymerization temperature (°C) Amplified fragment length (bp) 5.1 CGCCACTGAACAGGTAGAGG 60.109 GGTGACGGAAAGGAACCCAT 59.962 255 5.2 GCACGAGCGATATGTCCTGT 60.249 CCTGCTACAAGTGCGGTGTA 60.038 214 5.3 ACGCCGCTTATCAAGACCAA 60.037 GAAGCTCCCACGACAAGGAA 59.965 223
[0115] Primer 5.1 amplifies the fragment (target sequence) as shown in SEQ ID NO: 12, 255bp.
[0116] Primer 5.2 amplifies the fragment (target sequence) as shown in SEQ ID NO: 13, 214bp.
[0117] Primer 5.3 amplifies the fragment (target sequence) as shown in SEQ ID NO: 14, 223 bp.
[0118] Detection and Judgment: Judgment is made based on the SSR sites and SSR repeat elements in the primer-amplified fragments. When using primer 5.1 for fragment amplification, if two fragments (two peaks) are amplified, containing two SSR sites, with the SSR repeat element being AG, and one amplified fragment has 6 repeats of AG while the other has 7 repeats of AG, then the sample is identified as *Mammillaria tibetica*, a Tibetan brown mushroom with strong antioxidant activity. When using primer 5.2 for fragment amplification, if one fragment (one peak) is amplified, containing one SSR site, with the SSR repeat element being CCA, and the amplified fragment has 4 repeats of CCA, then the sample is identified as *Mammillaria tibetica*, a Tibetan brown mushroom with high total polyphenol content. When using primer 5.3 for fragment amplification, if two fragments (two peaks) are amplified, containing two SSR sites, with the SSR repeat element being CAG, and one amplified fragment has 6 repeats of CAG while the other has 8 repeats of CAG, then the sample is identified as *Mammillaria tibetica*, a Tibetan brown mushroom with high total polyphenol content. The accuracy is best when primers 5.1, 5.2, and 5.3 are used simultaneously for comprehensive detection and judgment.
[0119] (6) Screening of varieties with low polyphenol oxidase activity
[0120] Polyphenol oxidase was extracted from the fruiting bodies of *Pleurotus ostreatus* (Tibetan brown mushroom), dehydrated by vacuum freeze-drying, pulverized, and passed through a 50-mesh sieve. 1 gram of dry powder was added to 20 mL of double-distilled water, and extraction was performed using ultrasound at 300 W for 30 min. The extract was then centrifuged at 5000 rpm for 30 min, and the supernatant was collected to prepare the polyphenol oxidase extract. The polyphenol oxidase activity of the *Pleurotus ostreatus* fruiting body extract was determined using a polyphenol oxidase (PPO) activity assay kit (catalog number BC0190) from Beijing Solarbio Science & Technology Co., Ltd., and expressed as enzyme activity units per milligram of sample.
[0121] Samples with a concentration lower than 4420 units per gram (this index is the average polyphenol oxidase activity of Agaricus bisporus As2796) were selected. Primer sequences are shown in Table 6. The method is as described in (1). SSR-specific primer amplification was performed, and the amplification results are as follows. Figure 6 As shown, the fragment size in the electrophoresis diagram is equal to the actual bp number of the amplified fragment plus 18 bp of the M13 fluorescent primer. Two peaks in capillary electrophoresis indicate that the gene is heterozygous and has two similar fragments.
[0122] Table 6. Specific primers for screening high-quality varieties of *Mushroom tigrinum* with low polyphenol oxidase activity.
[0123] serial number upstream primer Depolymerization temperature (°C) Downstream primer Depolymerization temperature (°C) Amplified fragment length (bp) 6.1 CAGACAGAGACGGCCTTGAG 60.109 CAGGTCGCGTCCATTCAAAC 59.834 246 6.2 CACGGATGCCAACTCAAACG 60.11 CGACGATCGAGCCACAGATT 60.249 191 6.3 GCCAACGATTACGGTACCCA 60.108 CTTCTTTGGATTGCACCCGC 60.109 257
[0124] Primer 6.1 amplifies the fragment (target sequence) as shown in SEQ ID NO: 15, 246 bp.
[0125] Primer 6.2 amplifies the fragment (target sequence) as shown in SEQ ID NO: 16, 191 bp.
[0126] Primer 6.3 amplifies the fragment (target sequence) as shown in SEQ ID NO: 17, 257bp.
[0127] Detection and Judgment: Judgment is made based on the SSR sites and SSR repeat elements in the primer-amplified fragments. When using primer 6.1 for fragment amplification, if two fragments (two peaks) are amplified, containing two SSR sites, with the SSR repeat element being TGA, and one amplified fragment has 5 repeats of TGA while the other has 8 repeats of TGA, then the sample is identified as *Mammillaria tibetica* with low polyphenol oxidase activity. When using primer 6.2 for fragment amplification, if one fragment (one peak) is amplified, containing one SSR site, with the SSR repeat element being TTG, and the amplified fragment has 8 repeats of TTG, then the sample is identified as *Mammillaria tibetica* with low polyphenol oxidase activity. When using primer 6.3 for fragment amplification, if one fragment (one peak) is amplified, containing one SSR site, with the SSR repeat element being AAG, and the amplified fragment has 3 repeats of AAG, then the sample is identified as *Mammillaria tibetica* with high total polyphenol content. The accuracy is best when primers 6.1, 6.2, and 6.3 are used simultaneously for comprehensive detection and judgment.
[0128] Example 1: Screening and Validation of Total Protein and Total Soluble Protein Indicators
[0129] Using the widely cultivated high-quality button mushroom variety As2796 as Comparative Example 1 and the high-quality Tibetan brown mushroom as Example 1, the fruiting bodies of Comparative Example 1 and Example 1 were collected, dehydrated by vacuum freeze-drying, pulverized, and passed through a 50-mesh sieve. The total protein content in the fruiting bodies was determined according to the Kjeldahl method in GB5009.5-2016 "National Food Safety Standard - Determination of Protein in Food". Figure 7 As shown, the total protein content of Example 1 was significantly higher than that of Comparative Example 1.
[0130] For the extraction of soluble total protein, the fruiting bodies of Comparative Example 1 and Example 1 were collected, dehydrated by vacuum freeze-drying, pulverized, and passed through a 50-mesh sieve. 1 gram of dry powder was added to 20 mL of double-distilled water, and extraction was performed using ultrasound-assisted extraction at 300 W for 30 min. Then, the mixture was centrifuged at 5000 rpm for 30 min, and the supernatant was collected to prepare the soluble total protein extract. The soluble total protein content in the extract was determined using the Beyotime Biotechnology BCA Protein Assay Kit (Enhanced Version) (catalog number P0010S) and converted to mg / g. Figure 8 As shown, the soluble total protein content of Example 1 was significantly higher than that of Comparative Example 1.
[0131] Fruit body samples from Comparative Example 1 and Example 1 were collected and amplified using primers 1.1, 1.2, and 1.3, respectively, following the steps described in (1) of Example 0.
[0132] (1) The amplification results of primer 1.1 are as follows Figure 9As shown; specifically, the SSR repeat element amplified by primer 1.1 is AG. In the example, *Bryophyllum tibetica* has two SSR sites, one is a 5-fold repeat AG of a 137 bp amplified fragment, and the other is a 6-fold repeat of a 139 bp amplified fragment; in the comparative example, *Agaricus bisporus* As2796 has one SSR site, which is a 5-fold repeat AG of a 137 bp amplified fragment. The specific sequence information is shown below; among them, the first 18 bases are 18 bp of the M13 fluorescent primer, and the underlined part is the SSR repeat element.
[0133] 137 bp amplified fragment sequence:
[0134] TGTAAAACGACGGCCAGTAAGCCGGGTATCATGAAGCCGTACATGATTCGGAGGAGAGATTCACTCTGATATATAGGAACAATGCAACTAA AGAGAGAGAG GGTCATGAAACGCAAATCGGTGACAGAGAAAGACGC
[0135] 139 bp amplified fragment sequence:
[0136] TGTAAAACGACGGCCAGTAAGCCGGGTATCATGAAGCCGTACATGATTCGGAGGAGAGATTCACTCTGATATATAGGAACAATGCAACTAA AGAGAGAGAGAG GGTCATGAAACGCAAATCGGTGACAGAGAAAGACGC.
[0137] (2) The amplification results of primers 1 and 2 are as follows: Figure 10 As shown; specifically, the SSR repeat element amplified by primer 1.2 is CA. In the example, *Brownia tomentosa* has two SSR sites, one is a 6-fold repeat CA of a 176 bp amplified fragment, and the other is a 7-fold repeat CA of a 177 bp amplified fragment; in the comparative example, *Agaricus bisporus* As2796 has one SSR site, which is a 6-fold repeat CA of a 176 bp amplified fragment. The specific sequence information is shown below; among them, the first 18 bases are 18 bp of the M13 fluorescent primer, and the underlined part is the SSR repeat element.
[0138] 176bp amplified fragment sequence:
[0139] TGTAAAACGACGGCCAGTGGTCAGGGCATACGAACACAACAAATGCCTTGGTTCGTTCTTTTATCTCATTTCTGCTATGCATGCTCACATTCTACTTTAGGTTATAGTTCCTCCATGGCCGACTTTGAAGGTAG CACACACACA CA CCTATACGATAACTCTAATCGCGCCTAGGC;
[0140] 177 bp amplified fragment sequence:
[0141] TGTAAAACGACGGCCAGTGGTCAGGGCATACGAACACAACAAATGCCTTGGTTCGTTCTTTATCTCATTTCTGCTATGCATGCTCACATTCTACTTTAGGTTATAGTTCCTCCATGGCCGACTTTGAAGGTAG CACACACACAC ACA CCTATACGATAACTCTAATCGCGCCTAGGC.
[0142] (3) The amplification results of primer 1.3 are as follows Figure 11 As shown; specifically, the SSR repeat element amplified by primer 1.3 is AC. In the example, *Bryophyllum tibetica* has one SSR site, which is a 5-time repeat AC of a 285 bp amplified fragment; in the comparative example, *Agaricus bisporus* As2796 has one SSR site, which is a 6-time repeat AC of a 287 bp amplified fragment. The specific sequence information is shown below; among them, the first 18 bases are 18 bp of the M13 fluorescent primer, and the underlined part is the SSR repeat element.
[0143] 285 bp amplified fragment sequence:
[0144] TGTAAAACGACGGCCAGTGAGGATCATCATACCCGCGGGTAAGTCTT ACACACACACTTGTTTCAACTTGACTAAAGTGCATTTACAGCATTGCGTCAATAGATTTTAAATCACCTTATATCGTTTCGGGATCTTCAGATAAACACATACGCCTTGTAGATATGAACACGTCCAGAGGATGTCAACGTCTTCGGAGTATGATACCCTACCCCTCGGACTTGGACTTGGAGATTCATCACCTTCGTTACCCACTGCGGGACATTCAGCCGGAGGAGAGGAATCTT;
[0145] 287 bp amplified fragment sequence:
[0146] TGTAAAACGACGGCCAGTGAGGATCATCATACCCGCGGGTAAGTCTT ACACACACACAC TTGTTTCAACTTGACTAAAGTGCATTTACAGCATTGCGTCAATAGATTTTAAATCACCTTATATCGTTTCGGGATCTTCAGATAAACACATACGCCTTGTAGATATGAACACGTCCAGAGGATGTCAACGTCTTCGGAGTATGATACCCTAACCCTCGGACTTGGACTTGGAGATTCATCACCTTCGTTACCCACTGCGGGACATTCAGCCGGAGGAGAGGAATCTT.
[0147] The above results indicate that primers 1.1, 1.2, and 1.3 can effectively distinguish Comparative Example 1 and Example 1. Primers 1.1, 1.2, and 1.3 can be used to screen for Tibetan brown mushrooms with high total protein and total soluble protein content.
[0148] Example 2 Screening and Validation of Total Hydrolyzed Amino Acid Indicators
[0149] Using the widely cultivated high-quality button mushroom variety As2796 as Comparative Example 2, and the high-quality Tibetan brown mushroom as Example 2, the fruiting bodies of Comparative Example 2 and Example 2 were collected, dehydrated by vacuum freeze-drying, pulverized, and passed through a 50-mesh sieve. The total hydrolyzed amino acid content was determined according to the method specified in GB 5009.124-2016 "National Food Safety Standard - Determination of Amino Acids in Food". Figure 12 As shown, the total hydrolyzed amino acid content in Example 2 is higher than that in Comparative Example 2.
[0150] Fruiting body samples from Comparative Example 2 and Example 2 were collected, and the genome was extracted and amplified using primers 2.1 and 2.2, as in Example 1.
[0151] (1) The amplification results of primer 2.1 are as follows Figure 13 As shown; specifically, the SSR repeat element amplified by primer 2.1 is AT; the Tibetan brown mushroom in the example has 1 SSR site, which is the 11th repeat of AT in the 260 bp amplified fragment; the comparative example Agaricus bisporus As2796 has 1 SSR site, which is the 7th repeat of AT in the 252 bp amplified fragment, and the specific sequence information is shown below; among them, the first 18 bases are 18 bp of the M13 fluorescent primer, and the underlined part is the SSR repeat element.
[0152] 252bp amplified fragment sequence:
[0153] TGTAAAACGACGGCCAGTGCTTCACTCGTGGTGCTACTCCACAAAAACTCTATTCATCTAATTTAGATCAAGCAC ATATATATATATAT CACGAAGATGCATTCAATAAAGCAGCACTTTCATCCGGTTTTGATTCAAAGCGCCTACGCATGGCGATAATCATTTTGGTAAAACCTGGGGTTCCATTGGTAAGAGGCAAAAAAATATATTCCGGGACGGCAGCATACCAAAGGAGATTGAGGCCCTGGAGAGT;
[0154] 260bp amplified fragment sequence:
[0155] TGTAAAACGACGGCCAGTGCTTCACTCGTGGTGCTACTCCACAAAAACTCTATTCATCTAATTTAGATCAAGCAC ATATATATATATATATATAT CACGAAGATGCATTCAATAAAGCAGCACTTTCATCCGGTTTTGATTCAAAGCGCCTACGCATGGCGATAATCATTTTGGTAAAACCTGGGGTTCCATTGGTAAGAGGCAAAAAAATATATTCCGGGACGGCAGCATACCAAAGGAGATTGAGGCCCTGGAGAGT.
[0156] (2) The amplification results of primer 2.2 are as follows Figure 14As shown; specifically, the SSR repeat element amplified by primer 2.2 is AT; the Tibetan brown mushroom example has one SSR site, which is a 5-fold repeat of AT in a 213 bp amplified fragment; the comparative example Agaricus bisporus As2796 has one SSR site, which is a 6-fold repeat of AT in a 214 bp amplified fragment. The specific sequence information is shown below; where the first 18 bases are 18 bp of the M13 fluorescent primer, and the underlined part is the SSR repeat element.
[0157] 213 bp amplified fragment sequence:
[0158] TGTAAAACGACGGCCAGTTACCGAATTGCCCACTGGTCAAGAGAGAGTTGATATTCCAGGCCGAAATCACTACCGACAAAAAAGCAAACATCAAGAGGAGAGCTTCAAATACTTA ATATATATAT GGACCTTGTCATGATAGAAACACTCACCAAAAGAACAGTTCGCAGAAGGAGAAACGTATTAAACATAGCCATCGTGATCGTTGAAGC;
[0159] 214bp amplified fragment sequence:
[0160] TGTAAAACGACGGCCAGTTACCGAATTGCCCACTGGTCAAGAGAGAGTTGATATTCCAGGCCGAAATCACTACCGACAAAAAAGCAAACATCAAGAGGAGAGCTTCAAATACTTA ATATATATATAT GGACCTTGTCATGAAGAAACACTCACCAAAAGAACAGTTCGCAGAAGGAGAAACGTATTAAACATAGCCATCGTGATCGTTGAAGC
[0161] The above results indicate that primers 2.1 and 2.2 can effectively distinguish between Comparative Example 2 and Example 2, and primers 2.1 and 2.2 can be used to screen for Tibetan brown mushrooms with high total hydrolyzed amino acid content.
[0162] Example 3: Screening and Validation of Total Polysaccharide Indicators
[0163] The widely cultivated high-quality button mushroom variety As2796 was used as Comparative Example 3, and the high-quality Tibetan brown mushroom was used as Example 3. The fruiting bodies of Examples 3 and Comparative Example 3 were collected, dehydrated by vacuum freeze-drying, pulverized, and passed through a 50-mesh sieve. 1 gram of dry powder was added to 20 mL of double-distilled water, and extraction was performed using 300 W ultrasonic-assisted extraction for 30 min. Then, the mixture was centrifuged at 5000 rpm for 30 min, and the supernatant was collected to prepare the total polysaccharide extract. The total polysaccharide content in the extracts of Examples 3 and Comparative Example 3 was determined using the sulfuric acid phenol method, specifically referring to Zhao Qiduo et al., Journal of Yichun University, 2011, 33(08):74-76, and converted to mg / g. Figure 15 As shown, the total polysaccharide content in Example 3 was higher than that in Comparative Example 3.
[0164] Fruiting body samples from Comparative Example 3 and Example 3 were collected, and the genome was extracted and amplified using primers 3.1, 3.2, and 3.3, as in Example 1.
[0165] (1) The amplification results of primer 3.1 are as follows Figure 16 As shown; specifically, the SSR repeat element amplified by primer 3.1 is TG; the Tibetan brown mushroom in the example has 2 SSR sites, one is a 7-repeated TG of a 277bp amplified fragment, and the other is a 9-repeated TG of a 283bp amplified fragment; the comparative example Agaricus bisporus As2796 has 1 SSR site, which is an 8-repeated TG of a 280bp amplified fragment. The specific sequence information is shown below; where the first 18 bases are 18bp of the M13 fluorescent primer, and the underlined part is the SSR repeat element.
[0166] 277 bp amplified fragment sequence:
[0167] TGTAAAACGACGGCCAGTCCTCAAGTGATTCGGCCACAGACGGCGTTGAGTGAGCGGGAGACGATGGAAACTGAGGTTATCAGTGAGTTTATCGGTTTATGATCGATGATCAAGTTTCCATGCTGATCGTATATGATTGTGAT T GTGTGTGTGTGTG CGTGCAGAGCTTTTGATACATTCGTACTTTAATATCGTGAAGCGCGAGATGATCGATATGGTTCCGAAAGCCATTTCACTGAACCTTGTTTCATTCGAAGGATAATTTGCAGCGCGAGCT;
[0168] 280 bp amplified fragment sequence:
[0169] TGTAAAACGACGGCCAGTCCTCAAGTGATTCGGCCACAGACGGCGTTGAGTGAGCGGGAGACGATGGAAACTGAGGTTATCAGTGAGTTTATCGGTTTATGATCGATGATCAAGTTTCCATGCTGATCGTATATGATTGTGAT T GTGTGTGTGTGTGTG CGTGCAGAGCTTTTGATACATTCGTACTTTAATATCGTGAAGCGCGAGATGATCGATATGGTTCCGAAAGCCATTTCACTGAACCTTGTTATCATTCGAAGGATAATTTGCAGCGCGAGCT;
[0170] 283bp amplified fragment sequence:
[0171] TGTAAAACGACGGCCAGTCCTCAAGTGATTCGGCCACAGACGGCGTTGAGTGAGCGGGAGACGATGGAAACTGAGGTTATCAGTGAGTTTATCGGTTTATGATCGATGATCAAGTTTCCATGCTGATCGTATATGATTGTGAT T GTGTGTGTGTGTGTGTG CGTGCAGAGCTTTTGATACATTCGTACTTTAATATCGTGAAGCGCGAGATGATCGATATGGTTCCGAAAGCCATTTCACTGAACCTTGTTAATCATTCGAAGGATAATTTGCAGCGCGAGCT.
[0172] (2) The amplification results of primer 3.2 are as follows Figure 17 As shown; specifically, the SSR repeat element amplified by primer 3.2 is TC; the Tibetan brown mushroom example has one SSR site, which is the 11th repeat TC of the 288bp amplified fragment; the comparative example Agaricus bisporus As2796 has two SSR sites, one is the 5th repeat TC of the 277bp amplified fragment, and the other is the 12th repeat TC of the 292bp amplified fragment. The specific sequence information is shown below; among them, the first 18 bases are the 18bp of the M13 fluorescent primer, and the underlined part is the SSR repeat element.
[0173] 277bp amplified fragment sequence:
[0174] TGTAAAACGACGGCCAGTAATGCGTGGACGTGCTCTTACGCGCACTTCGGTCACTCAGTACTTACACCCGAGTGGCAGGTGAGAATAATTCGCTATCTGATTTTATTTTGTTTTCCACCTATATTA TCTCTCTCT CTATCTTTTTTTCAAAATTGTTGACGTGTTAAACATTTTTTCGTAGCTGATTATCTCGAAACCTTGGAGCAAGACTACTTACCTCTCAAACAGACTGTGACATTAGTAGATAACACTGCGTTTCCGCAGTAAGGTCCATTCC;
[0175] 288 bp amplified fragment sequence:
[0176] TGTAAAACGACGGCCAGTAATGCGTGGACGTGCTCTTACGCGCACTTCGGTCACTCAGTACTTACACCCGAGTGGCAGGTGAGAATAATTCGCTATCTGATTTTATTTTGTTTTCCACCTATATTA TCTCTCTCTCTCTCTCTC TCTC TATCTTTTTTTCAAATTGTTGACGTGTTAAACATTTTTTCGTAGCTGATTATCTCGAAACCTTGGAGCAAGACTACTTACCTCTCAAACAGACTGTGACATTAGTAGATAACACTGCGTTTCCGCAGTAAGGTCCATTCC;
[0177] 292 bp amplified fragment sequence:
[0178] TGTAAAACGACGGCCAGTAATGCGTGGACGTGCTCTTACGCGCACTTCGGTCACTCAGTACTTACACCCGAGTGGCAGGTGAGAATAATTCGCTATCTGATTTTATTTTGTTTTCCACCTATATTA TCTCTCTCTCTCTCTCTC TCTC TATCTCTTTTTTCAAAATTGTTGACGTGTTAAACATTTTTTCGTAGCTGATTATCTCGAAACCTTGGAGCAAGACTACTTACCTCTCAAACAGACTGTGACATTAGTAGATAACACTGCGTTTCCGCAGTAAGGTCCATTCC
[0179] (3) The amplification results of primer 3.3 are as follows Figure 18 As shown; specifically, the SSR repeat element amplified by primer 3.3 is AT; the Tibetan brown mushroom example has one SSR site, which is the 6th repeat of AT in the 199bp amplified fragment; the comparative example Agaricus bisporus As2796 has two SSR sites, one is the 6th repeat of AT in the 197bp amplified fragment, and the other is the 6th repeat of AT in the 199bp amplified fragment. The specific sequence information is shown below; among them, the first 18 bases are 18bp of the M13 fluorescent primer, and the underlined part is the SSR repeat element.
[0180] 197bp amplified fragment sequence:
[0181] GTTGAAATCAGGCAAGATCAGGCAAGCGCAGGTGAATGCCATCAGCACAGGGCCGAGAAGAAAAAAATTTTTTGTCCCAGGTCCCAGCCCCTTTTG ATATATATATAT TAGACAGCGGTCAACCTGCTTCACCCCCACGTCCTACCTTCCTTTTTTGGTATCATACCTCTGTGCGTGCTCGATGGCCTCCATTCCTC;
[0182] 199bp amplified fragment sequence:
[0183] GTTGAAATCAGGCAAGATCAGGCAAGCGCAGGTGAATGCCATCAGCACAGGGCCGATAGAAGAAAAAAATTTTTTGTCCCAGGTCCCAGCCCCTTTTG ATATATATATAT TAGACAGCGGTCAACCTGCTTCACCCCCACGTCCTACCTTCCTTTTTTGGTATCATACCTCTGTGCGTGCTCGATGGCCTCCATTCCTC.
[0184] The above results show that Comparative Example 3 and Example 3 can be effectively distinguished using primers 3.1, 3.2, and 3.3. Primers 3.1, 3.2, and 3.3 can be used to screen for Tibetan brown mushrooms with high total polysaccharide content.
[0185] Example 4: Screening and Validation of Total Polyphenol Index
[0186] The widely cultivated high-quality button mushroom variety As2796 was used as Comparative Example 4, and the high-quality Tibetan brown mushroom was used as Example 4. The fruiting bodies of Example 4 and Comparative Example 4 were collected, dehydrated by vacuum freeze-drying, pulverized, and passed through a 50-mesh sieve. 1 gram of dry powder was added to 20 mL of double-distilled water, and extraction was performed using 300 W ultrasonic-assisted extraction for 30 min. Then, the mixture was centrifuged at 5000 rpm for 30 min, and the supernatant was collected to prepare the total polyphenol extract. The total polyphenol content in the extracts of Example 4 and Comparative Example 4 was determined using the Folin-Ciocalteu method, specifically referring to Wang Jiadan et al., Journal of Nanjing University of Technology (Natural Science Edition), 2017, 39(02):113-120, and converted to mg / g. Figure 19 As shown, the total polyphenol content in Example 4 is higher than that in Comparative Example 4.
[0187] Fruiting body samples from Comparative Example 4 and Example 4 were collected, and the genome was extracted and amplified using primers 4.1, 4.2, and 4.3, as in Example 1.
[0188] (1) The amplification results of primer 4.1 are as follows Figure 20 As shown; specifically, the SSR repeat element amplified by primer 4.1 is CT; the Tibetan brown mushroom example has one SSR site, which is a 7-repeated CT of a 280bp amplified fragment; the comparative example Agaricus bisporus As2796 has two SSR sites, one is a 6-repeated CT of a 278bp amplified fragment, and the other is a 7-repeated CT of a 280bp amplified fragment. The specific sequence information is shown below; among them, the first 18 bases are 18bp of the M13 fluorescent primer, and the underlined part is the SSR repeat element.
[0189] 278bp amplified fragment sequence:
[0190] TGTAAAACGACGGCCAGTTCCGGCAATTGAAATGCGTGGGAGACACCGGAGTAATCAATCAGAGGTCGTGTCACTCTCTCAGTGACCTTGTTACCAATTGCCAGCATTCGTTCAAATCCTTCAACACAAGGCTA CTCTCTCTCT CT CCACATTCAAGAACCAGGGACAAGAAAATCAATATCCTCATATCCTCACACGCAAGGGCGAATCGGATACCACCTTTTCAGTCATAACAAAATAACAACGTCGATTTCTTTTTTCGCTCTCAACGCAACTCT;
[0191] 280bp amplified fragment sequence:
[0192] TGTAAAACGACGGCCAGTTCCGGCAATTGAAATGCGTGGGAGACACCGGAGTAATCAATCAGAGGTCGTGTCACTCTCTCAGTGACCTTGTTACCAATTGCCAGCATTCGTTCAAATCCTTCAACACAAGGCTA CTCTCTCTCT CTCT CCACATTCAAGAACCAGGGACAAGAAAATCAATATCCTCATATCCTCACACGCAAGGGCGAATCGGATACCACCTTTTCAGTCATAACAAAATAACAACGTCGATTTCTTTTTTCGCTCTCAACGCAACTCT.
[0193] (2) The amplification results of primer 4.2 are as follows Figure 21 As shown; specifically, the SSR repeat element amplified by primer 4.2 is AT; the Tibetan brown mushroom example has one SSR site, which is the 6th repeat of AT in the 165bp amplified fragment; the comparative example Agaricus bisporus As2796 has two SSR sites, one is the 6th repeat of AT in the 165bp amplified fragment, and the other is the 7th repeat of AT in the 167bp amplified fragment. The specific sequence information is shown below; among them, the first 18 bases are 18bp of the M13 fluorescent primer, and the underlined part is the SSR repeat element.
[0194] 165bp amplified fragment sequence:
[0195] TGTAAAACGACGGCCAGTGGGTCGAAGTGTCAGGTCAGTGA ATATATATATAT CAGGCCTCCTACTTAGCTGATGATATGACTCGAGCTCATGGGATTGCTGATGTTGATGGAATCCAGAAAATCTGGTGATCTGAATTTAACTTAAGACACGTGCTCGCTTACA;
[0196] 167bp amplified fragment sequence:
[0197] TGTAAAACGACGGCCAGTGGGTCGAAGTGTCAGGTCAGTGA ATATATATATATAT CAGGCCTCCTACTTAGCTGATGATATGACTCGAGCTCATGGGATTGCTGATGTTGATGGAATCCAGAAAATCTGGTGATCTGAATTTAACTTAAGACACGTGCTCGCTTACA.
[0198] (3) The amplification results of primer 4.3 are as follows Figure 22 As shown; specifically, the SSR repeat element amplified by primer 4.3 is GA; the Tibetan brown mushroom in the example has 2 SSR sites, one is a 6-repeated GA of the 271bp amplified fragment, and the other is an 11-repeated GA of the 282bp amplified fragment; the comparative example Agaricus bisporus As2796 has 1 SSR site, which is an 11-repeated GA of the 282bp amplified fragment. The specific sequence information is shown below; among them, the first 18 bases are 18bp of the M13 fluorescent primer, and the underlined part is the SSR repeat element.
[0199] 271 bp amplified fragment sequence:
[0200] TGTAAAACGACGGCCAGTATCCTGAACGTGCGGAACATACTAGAGCGACTTTATGTTGATCAATGTAGTTCCTTGAAAAGAAGACGCGTGTCAGTTGAGGAACTCTCCATACACGAAAAAAAGG GAGAGAGAGAGA AAACGAAACGAAACGAAACGCAACGAAGTGTAATAAAACGAAAAGAAACGAAGGAAGAGGAAATGAAACGCACGAAACGATATCCTCTGCAATATTCACAGCAAATTTCCAACACTCGTCCCTCCAAACTTCTGC;
[0201] 282bp amplified fragment sequence:
[0202] TGTAAAACGACGGCCAGTATCCTGAACGTGCGGAACATACTAGAGCGACTTTATGTTGATCAATGTAGTTCCTTGAAAAGAAGACGCGTGTCAGTTGAGGAACTCTCCATACACGAAAAAAAGG GAGAGAGAGAGAGAGAGAGA GA AAACGAAACGAAACGAAACGCAACGAAGTGTAATAAAACGAAAAGAAACGAAGGAAGAGGAAATGAAACGCACGAAACGATATCCTCTGCAATATTCACAGCAAATTTTCCAACACTCGTCCCTCCAAACTTCTGC.
[0203] The above results show that Comparative Example 4 and Example 4 can be effectively distinguished using primers 4.1, 4.2, and 4.3. Primers 4.1, 4.2, and 4.3 can be used to screen for Tibetan brown mushrooms with high total polyphenol content.
[0204] Example 5 Screening and Validation of Antioxidant Activity Indicators
[0205] The widely cultivated high-quality button mushroom variety As2796 was used as Comparative Example 5, and the high-quality Tibetan brown mushroom was used as Example 5. The fruiting bodies of Examples 5 and Comparative Example 5 were collected, dehydrated by vacuum freeze-drying, pulverized, and passed through a 50-mesh sieve. 1 gram of dry powder was added to 20 mL of double-distilled water, and extraction was performed using 300 W ultrasonic-assisted extraction for 30 min. Then, the mixture was centrifuged at 5000 rpm for 30 min, and the supernatant was collected to prepare the aqueous extract. The antioxidant activity of the extracts from Examples 5 and Comparative Example 5 was determined using the Beyotime Biotechnology Co., Ltd. Total Antioxidant Capacity Assay Kit (ABTS Rapid Method) (Catalog No. S0121). ABTS is 2,2-adiazon-bis(3-ethyl-benzothiazole-6-sulfonic acid) diammonium salt, commonly used to determine the total antioxidant activity of food, expressed as a percentage of scavenging. Figure 23 As shown, the total antioxidant activity of Example 5 was stronger than that of Comparative Example 5.
[0206] Fruiting body samples from Comparative Example 5 and Example 5 were collected, and the genome was extracted and amplified using primers 5.1, 5.2, and 5.3, as in Example 1.
[0207] (1) The amplification results of primer 5.1 are as follows Figure 24 As shown; specifically, the SSR repeat element amplified by primer 5.1 is AG; the Tibetan brown mushroom in the example has two SSR sites, one is a 6-fold repeat AG of the 272bp amplified fragment, and the other is a 7-fold repeat AG of the 274bp amplified fragment; the comparative example, Agaricus bisporus As2796, has one SSR site, which is a 6-fold repeat AG of the 272bp amplified fragment. The specific sequence information is shown below; where the first 18 bases are 18bp of the M13 fluorescent primer, and the underlined part is the SSR repeat element.
[0208] 272 bp amplified fragment sequence:
[0209] TGTAAAACGACGGCCAGTCGCCACTGAACAGGTAGAGGCACAATA AGAGAGAGAGAGATAAAAGCAGTGTTCGTATGAGGAACAAGATGAACAAAAAGGGCGAGCGCTAAGGTGATCAACACTTTCGCTGTCCAAGTTTGGGAGACCTTTGTAAGTAAGAGTTTGGAAAATCGCTTATGAGGGCACCCCGTCCAACTCGTTACGATTGCGGTCCAAAGGGTAATTAAATTGGGATCTCGCATTAAGCTCAAAATGGGTTCCTTTCCGTCACC;
[0210] 274 bp amplified fragment sequence:
[0211] TGTAAAACGACGGCCAGTCGCCACTGAACAGGTAGAGGCACAATA AGAGAGAGAGAGAG ATAAAAGCAGTGTTCGTATGAGGAACAAGATGAACAAAAAGGGCGAGCGCTAAGGTGATCAACACTTTCGCTGTCCAAGTTTGGGAGACCTTTGTAAGTAAGAGTTTGGAAAATCGCTTATGAGGGCACCCCGTCCAACTCGTTACGATTGCGGTCCAAAGGGTAATTAAATTGGGATCTCGCATTAAGCTCAAAATGGGTTCCTTTCCGTCACC.
[0212] (2) The amplification results of primer 5.2 are as follows Figure 25 As shown; specifically, the SSR repeat element amplified by primer 5.2 is CCA; the Tibetan brown mushroom in the example has one SSR site, which is a 4-fold repeat CCA of a 228bp amplified fragment; the comparative example Agaricus bisporus As2796 has one SSR site, which is a 5-fold repeat CCA of a 231bp amplified fragment. The specific sequence information is shown below; where the first 18 bases are 18bp of the M13 fluorescent primer, and the underlined part is the SSR repeat element.
[0213] 228 bp amplified fragment sequence:
[0214] TGTAAAACGACGGCCAGTGCACGAGCGATATGTCCTGTCTGCCACAACGGTAACACTCCTGGCCACCGCCG CCACCACCACCACCGCCACTGGAGAATCCACCAGAGGCGGGAGCCTGTTGAGTGCATTCGCGGGACTGACGCGCACAAAGATATAAGAATTCTGGGCAATGTTGGAACATATAATATACACCTACAATATGACCCTCTACACCGCACTTGTAGCAGG;
[0215] 231 bp amplified fragment sequence:
[0216] TGTAAAACGACGGCCAGTGCACGAGCGATATGTCCTGTCTGCCACAACGGTAACACTCCTGGCCACCGCCG CCACCACCACCACCA CCGCCACTGGAGAATCCACCAGAGGCGGGAGCCTGTTGAGTGCATTCGCGGGACTGACGCGCACAAAGATATAAGAATTCTGGGCAATGTTGGAACATATAATATACACCTACAATATGACCCTCTACACCGCACTTGTAGCAGG.
[0217] (3) The amplification results of primer 5.3 are as follows Figure 26 As shown; specifically, the SSR repeat element amplified by primer 5.3 is CAG; the Tibetan brown mushroom in the example has two SSR sites, one is a 6-repeated CAG of a 239bp amplified fragment, and the other is an 8-repeated CAG of a 244bp amplified fragment; the comparative example, Agaricus bisporus As2796, has one SSR site, which is a 6-repeated CAG of a 239bp amplified fragment. The specific sequence information is shown below; where the first 18 bases are 18bp of the M13 fluorescent primer, and the underlined part is the SSR repeat element.
[0218] 239 bp amplified fragment sequence:
[0219] TGTAAAACGACGGCCAGTACGCCGCTTATCAAGACCAGAAACAGGCTATGGCAGCAGCAGGCTCAGTTCAGACCTCGTAGTGGCATGGACATCAACCAGCAGCCC CAGCAGCAGCAGCAGCAG CCTCAACAAGTGAGCCTTTCCCAACCCCACTTGCCCTCCCCACCCCTCTCTCCCACATACCTCTCTCCTTCCCTACCCCGCGGCCACTAACCCTTTCCTTGTCGTGGGAGCTTC;
[0220] 244bp amplified fragment sequence:
[0221] TGTAAAACGACGGCCAGTACGCCGCTTATCAAGACCAAAACAGGCTATGGCAGCAGCAGGCTCAGTTCAGACCTCGTAGTGGCATGGACATCAACCAGCAGCCC CAGCAGCAGCAGCAGCAGCAGCAG CCTCAACAAGTGAGCCTTTCCCAACCCCACTTGCCCTCCCCACCCCTCTCTCCCACATACCTCTCTCCTTCCCTACCCCGCGGCCACTAACCCTTTCCTTGTCGTGGGAGCTTC
[0222] The above results show that Comparative Example 5 and Example 5 can be effectively distinguished using primers 5.1, 5.2, and 5.3. Primers 5.1, 5.2, and 5.3 can be used to screen for Tibetan brown mushrooms with strong antioxidant activity.
[0223] Example 6: Screening and Validation of Polyphenol Oxidase Indicators
[0224] The widely cultivated high-quality button mushroom variety As2796 was used as Comparative Example 6, and the high-quality Tibetan brown mushroom was used as Example 6. The fruiting bodies of Example 6 and Comparative Example 6 were collected, dehydrated by vacuum freeze-drying, pulverized, and passed through a 50-mesh sieve. 1 gram of dry powder was added to 20 mL of double-distilled water, and extraction was performed using 300 W ultrasonic-assisted extraction for 30 min. Then, the mixture was centrifuged at 5000 rpm for 30 min, and the supernatant was collected to prepare the total polysaccharide extract. The phenol oxidase activity of the extracts from Example 6 and Comparative Example 6 was determined using a polyphenol oxidase (PPO) activity assay kit (catalog number BC0190) from Beijing Solarbio Science & Technology Co., Ltd., and expressed as enzyme activity units per gram of mushroom fruiting body dry powder. Figure 27 As shown, the polyphenol oxidase activity in Example 6 was significantly lower than that in Comparative Example 6.
[0225] Fruiting body samples from Comparative Example 6 and Example 6 were collected, and the genome was extracted and amplified using primers 6.1, 6.2, and 6.3, as in Example 1.
[0226] (1) The amplification results of primer 6.1 are as follows Figure 28As shown; specifically, the SSR repeat element amplified by primer 6.1 is a TGA; the Tibetan brown mushroom has two SSR sites, one is a 5-repeated TGA of a 265bp amplified fragment, and the other is an 8-repeated TGA of a 271bp amplified fragment; the comparative example, Agaricus bisporus As2796, has two SSR sites, one is a 5-repeated TGA of a 265bp amplified fragment, and the other is a 6-repeated TGA of a 268bp amplified fragment. The specific sequence information is shown below; where the first 18 bases are 18bp of the M13 fluorescent primer, and the underlined part is the SSR repeat element.
[0227] 265 bp amplified fragment sequence:
[0228] TGTAAAACGACGGCCAGTCAGACAGAGACGGCCTTGAGGATGGATGATGTTTCAGAAGTCACGGTCCCCAAGTCGCAATATGACGACGACACTCTACCAAAACATAGCGATATTCGTATACCTTGATTTTAGAAATTTGATATTCATGATATTTTGTGCATTAGCCACCTTCAGGTTGTACAGTACTTTGAG TGATGATGATGATGA TGTTGAGCGTCGAAGTTGCTGACTCAGCGAATCTCGCGGTTTGAATGGACGCGACCTG;
[0229] 268 bp amplified fragment sequence:
[0230] TGTAAAACGACGGCCAGTCAGACAGAGACGGCCTTGAGGATGGATGATGTTTCAGAAGTCACGGTCCCCAAGTCGCAATATGACGACGACACTCTACCAAAACATAGCGATATTCGTATACCTTGATTTTAGAAATTTGTATTCATGATATTTTGTGCATTAGCCACCTTCAGGTTGTACAGTACTTTGATGAG TGATGATGATGATGATGA TTGAGCGTCGAAGTTGCTGACTCAGCGAATCTCGCGGTTTGAATGGACGCGACCTG;
[0231] 271 bp amplified fragment sequence:
[0232] TGTAAAACGACGGCCAGTCAGACAGAGACGGCCTTGAGGATGGATGATGTTTCAGAAGTCACGGTCCCCAAGTCGCAATATGACGACGACACTCTACCAAAACATAGCGATATTCGTATACCTTGATTTTAGAAATTTGTATTCATGATATTTTGTGCATTAGCCACCTTCAGGTTGTACAGTACTTTGAG TGATGATGATGATGATGATGATGA TTGAGCGTCGAAGTTGCTGACTCAGCGAATCTCGCGGTTTGAATGGACGCGACCTG.
[0233] (2) The amplification results of primer 6.2 are as follows Figure 29 As shown; specifically, the SSR repeat element amplified by primer 6.2 is a TTG; the Tibetan brown mushroom in the example has one SSR site, which is an 8-repeated TTG of a 213bp amplified fragment; the comparative example Agaricus bisporus As2796 has two SSR sites, one is a 7-repeated TTG of a 209bp amplified fragment, and the other is an 8-repeated TTG of a 213bp amplified fragment. The specific sequence information is shown below; among them, the first 18 bases are 18bp of the M13 fluorescent primer, and the underlined part is the SSR repeat element.
[0234] 209bp amplified fragment sequence:
[0235] TGTAAAACGACGGCCAGTCACGGATGCCAACTCAAACGGAAAATCTATTACTACTTTTCCTCTAAACAAAGCGCCATCCCACAAACCACTAAATATATTACTGGTATTCTGTCGATGCCGCATAAGAAAGTTATGAGTTCTTCCTCCATTA TTGTTGTTGTTGTTGTTGTTG TGATAGGTATCTGAAGAATCTGTGGCTCGATCGTCG;
[0236] 213 bp amplified fragment sequence:
[0237] TGTAAAACGACGGCCAGTCACGGATGCCAACTCAAACGGAAAATCTATTACTACTTTTCCTCTAAACAAAGCGCCATCCCACAAACCACTAAATATATTACTGGTATTCTGTCGATGCCGCATAAGAAAGTTATGAGTTCTTGCCTCCATTA TTGTTGTTGTTGTTGTTGTTGTTGTGATAGGTATCTGAAGAATCTGTGGCTCGATCGTCG.
[0238] (3) The amplification results of primer 6.3 are as follows: Figure 30 As shown; specifically, the SSR repeat element amplified by primer 6.3 is AAG; the Tibetan brown mushroom in the example has 1 SSR site, which is a 3-repeated AAG of a 265bp amplified fragment; the comparative example Agaricus bisporus As2796 has 2 SSR sites, one is a 2-repeated AAG of a 264bp amplified fragment, and the other is a 6-repeated AAG of a 274bp amplified fragment.
[0239] 264 bp amplified fragment sequence:
[0240] TGTAAAACGACGGCCAGTGCCAACGATTACGGTACCCAATATACAAACGTCAACCTTCTTTGTTATTGGTATATATACGAATTTGTAGATGACGAAGTTCATTTAGACAATTTGGTTCGCATAGCCAAATTGCGGGGTCTAGTACAAGTAATCAAGTAAGT AAGAAG GTTTGCACAAATATAAAGAAATGAAGTCACTTTGGATGATTTTGATAAACTGGCAAGATCGTCTCAGGCGCCGGTACGCGGGTGCAATCCAAAGAAG;
[0241] 265 bp amplified fragment sequence:
[0242] TGTAAAACGACGGCCAGTGCCAACGATTACGGTACCCAATATACAAACGTCAACCTTCTTGTTATTGGTATATATACGAATTTGTAGATGACGAAGTTCATTTAGACAATTTGGTTCGCATAGCCAAATTGCGGGGTCTAGTACAGTAATCAAGTAAGT AAGAAGAAG GTTTGCACAAATATAAAGAAATGAAGTCACTTTGGATGATTTTGATAAACTGGCAAGATCGTCTCAGGCGCCGGTACGCGGGTGCAATCCAAAGAAG;
[0243] 274 bp amplified fragment sequence:
[0244] TGTAAAACGACGGCCAGTGCCAACGATTACGGTACCCAATATACAAACGTCAACCTTCTTGTTATTGGTATATATACGAATTTGTAGATGACGAAGTTCATTTAGACAATTTGGTTCGCATAGCCAAATTGCGGGGTCTAGTACAGTAATCAAGTAAGT AAGAAGAAGAAGAAGAAG GTTTGCACAAATATAAAGAAATGAAGTCACTTTGGATGATTTTGATAAACTGGCAAGATCGTCTCAGGCGCCGGTACGCGGGTGCAATCCAAAGAAG.
[0245] The above results show that Comparative Example 6 and Example 6 can be effectively distinguished using primers 6.1, 6.2, and 6.3. Primers 6.1, 6.2, and 6.3 can be used to screen for Tibetan brown mushrooms with low polyphenol oxidase activity.
Claims
1. DNA barcoding amplification primers for screening *Pleurotus ostreatus* with high antioxidant activity, characterized in that, The DNA barcode amplification primers are one or more of the three pairs of primers with upstream and downstream nucleotide sequences as shown in SEQ ID NO: 40 and SEQ ID NO: 41, SEQ ID NO: 42 and SEQ ID NO: 43, or SEQ ID NO: 44 and SEQ ID NO: 45, respectively.
2. The DNA barcoding amplification primers for screening *Brownia tibetica* with high antioxidant activity according to claim 1, characterized in that, The DNA barcode amplification primers are multiple pairs of three primer pairs, such as SEQ ID NO: 40 and SEQ ID NO: 41, SEQ ID NO: 42 and SEQ ID NO: 43, or SEQ ID NO: 44 and SEQ ID NO: 45, with upstream and downstream nucleotide sequences respectively.
3. A method for screening high-quality Tibetan brown mushroom varieties, characterized in that, The screening of Tibetan brown mushrooms with high antioxidant activity includes the following steps: S1. Extract genomic DNA from the sample to be tested; S2. Using S1 genomic DNA as a template, according to the trait screening requirements, select the amplification primers described in claim 1 or 2 to perform PCR amplification reactions respectively; S3. The PCR amplification products of S2 are detected by capillary fluorescence electrophoresis, and the results are determined by the number of fragments, the number of SSR sites, the number of SSR repeat elements and their repeat times.
4. The method for screening high-quality Tibetan brown mushroom varieties according to claim 3, characterized in that, The criteria for determining the presence of SSRs by the number of fragments, SSR sites, SSR repeat elements, and their repetition counts in step S3 are as follows: When using SEQ ID NO: 40 and 41 for fragment amplification, if two fragments are amplified, each containing two SSR sites and an SSR repeat element of AG, and one amplified fragment has 6 repetitions of AG while the other fragment has 7 repetitions of AG, then the sample to be tested is determined to be *Bryophyllum tibetans* with high antioxidant activity; when using SEQ ID NO: 42 and 43 for fragment amplification, if one fragment is amplified, each containing one SSR site and an SSR repeat element of CCA, and the amplified fragment has 4 repetitions of CCA, then the sample to be tested is determined to be *Bryophyllum tibetans* with high antioxidant activity; when using SEQ ID NO: 44 and 45 for fragment amplification, if two fragments are amplified, each containing two SSR sites and an SSR repeat element of CAG, and one amplified fragment has 6 repetitions of CAG while the other fragment has 8 repetitions of CAG, then the sample to be tested is determined to be *Bryophyllum tibetans* with high antioxidant activity.
5. The application of the DNA barcoding amplification primers according to claim 1 or 2 in screening or assisting in the breeding of Tibetan brown mushroom varieties with high antioxidant activity.
6. The use of the DNA barcoding amplification primers of claim 1 or 2 in the preparation of products for screening Tibetan brown mushroom varieties with high antioxidant activity.
7. A product for screening Tibetan brown mushrooms with high antioxidant activity, characterized in that, The product contains the DNA barcode amplification primers as described in claim 1 or 2.
8. The product according to claim 7, characterized in that, The product also includes reagents required for PCR amplification reactions and for fluorescence capillary electrophoresis detection.