Preparation method and application of photoelectrochemical aptamer sensor based on co(ii) / g-c3n4 nanotube
By preparing Co(Ⅱ)/g-C3N4 nanotube photoactive materials and constructing aptamer sensors, the problems of light absorption and carrier separation of g-C3N4 in the field of photoelectrochemical sensing were solved, and high sensitivity and high selectivity detection of ATZ were achieved.
Patent Information
- Application Number
- CN202310057153.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-01-16
- Publication Date
- 2026-01-02
- Estimated Expiration
- 2043-01-16
AI Technical Summary
In the existing technology, the application of graphitic carbon nitride (g-C3N4) in the field of photoelectrochemical sensing is limited by its limited light absorption capacity and high recombination rate of photogenerated electron-hole pairs, making it difficult to achieve high sensitivity and high selectivity in the detection of triazine herbicide atrazine (ATZ).
Co(II)/g-C3N4 nanotube photoelectric active materials were prepared by supramolecular self-assembly, and aptamers were introduced on their surface to construct a three-electrode photoelectrochemical aptamer sensor. Co(II) doping and nanotube structure were used to enhance light absorption and carrier separation capabilities.
It achieves high sensitivity and selectivity for ATZ detection, with good linear range and low detection limit, exhibiting excellent photoelectric performance and anti-interference ability.
Smart Images

Figure CN116337974B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of photoelectrochemistry and analytical detection, and particularly relates to a preparation method of a photoelectrochemical aptamer sensor based on Co(II) / g-C3N4 nanotubes and application thereof in atrazine (ATZ) detection, which realizes high-sensitivity and high-selectivity detection of ATZ. BACKGROUND
[0002] ATZ, as a triazine herbicide, is widely used in the world, but it is stable in structure, not easy to degrade, has certain toxicity and biological accumulation, and may cause serious damage to organisms and destroy the ecological balance. Therefore, many countries have determined the residual amount of ATZ. In China, the maximum residual amount of ATZ in drinking water (GB 5749-2006) and surface water (GB3838-2002) is 2 and 3 μg / L respectively. At present, the detection methods of ATZ mainly include gas chromatography, gas chromatography-mass spectrometry, high performance liquid chromatography, etc., but these detection methods have problems such as expensive instruments, complex pretreatment, complex operation, etc. Therefore, it is of great importance to realize rapid, accurate, high-sensitivity and high-selectivity quantitative analysis and detection of ATZ in water environment.
[0003] As a portable detection method, photoelectrochemical aptamer sensor has attracted extensive attention due to its high sensitivity, low cost and miniaturization. Photoelectrochemical aptamer sensor takes optical signal as excitation signal and electrical signal as detection signal, which completely separates excitation light source and detection signal, and significantly reduces background current. In the process of photoelectrochemical aptamer sensor, the concentration change of target detection substance leads to the change of sensing interface and the change of photocurrent response. The key to constructing photoelectrochemical sensor with excellent analytical performance lies in the design and preparation of photoelectric active material with high photoelectric conversion efficiency.
[0004] Graphitic carbon nitride (g-C3N4) has the advantages of suitable band gap (~2.7 eV), low cost and chemical stability. However, the limited light absorption capacity and the higher photo-generated electron-hole pair recombination rate limit the application of g-C3N4 in photoelectrochemical sensing field. In the present application, g-C3N4 nanotubes are prepared by supramolecular self-assembly, and transition metal ion Co(II) is creatively introduced on the surface of g-C3N4 nanotubes. From the perspective of photophysics and photochemistry, the structure of g-C3N4 is optimized, so that the material has stronger light absorption capacity and faster carrier separation and transmission rate, which significantly enhances the photoelectric performance and is conducive to the high selectivity and high sensitivity detection of ATZ. In addition, there are few reports on the preparation of Co(Ⅱ) / g-C3N4 nanotubes and their application in photoelectrochemical aptamer sensor for detecting ATZ. Therefore, it is of great significance to develop a Co(Ⅱ) / g-C3N4 nanotube photoelectrochemical aptamer sensor with excellent photoelectric performance. SUMMARY
[0005] The purpose of the present application is to overcome the shortcomings of the prior art and provide a preparation method and application of a photoelectrochemical aptamer sensor based on a Co(Ⅱ) / g-C3N4 nanotube working electrode. The present application first prepares a Co(Ⅱ) / g-C3N4 nanotube working electrode: first, a Co(Ⅱ) / g-C3N4 nanotube photoelectric active material is prepared by supramolecular self-assembly, then a Co(Ⅱ) / g-C3N4 nanotube working electrode is prepared by drop coating technology, and an aptamer capable of specifically recognizing ATZ is introduced on the electrode to prepare an aptamer-modified Co(Ⅱ) / g-C3N4 nanotube working electrode. Then, a photoelectrochemical aptamer sensing platform with a Co(Ⅱ) / g-C3N4 nanotube as a working electrode is constructed by using a three-electrode system, realizing high sensitivity and high selectivity detection of ATZ.
[0006] The present application achieves the above technical purpose by the following technical means.
[0007] The present application provides a preparation method of a photoelectrochemical aptamer sensor based on Co(Ⅱ) / g-C3N4 nanotubes, which is carried out according to the following steps:
[0008] (1) Preparation of Co(Ⅱ) / g-C3N4 nanotube photoelectric active material:
[0009] First, the cobalt salt, carbon and nitrogen source and hydroxylamine acid salt are added into ionized water respectively, stirred uniformly to form a solution; the three reaction solutions are mixed uniformly and transferred into a reaction kettle containing polytetrafluoroethylene lining to conduct constant temperature hydrothermal reaction; after the reaction, the reaction kettle is taken out and cooled to room temperature naturally; the product is centrifuged, washed and dried to obtain a precursor; then, a certain amount of the precursor is weighed and calcined in a muffle furnace at high temperature to obtain a Co(II) / g-C3N4 nanotube photoelectric active material;
[0010] (2) Preparation of Co(II) / g-C3N4 / conductive glass (ITO) electrode:
[0011] The Co(II) / g-C3N4 nanotube photoelectric active material prepared in step (1) is stably dispersed in a dispersant by ultrasonic treatment to obtain a stable dispersion liquid; then the dispersion liquid is drop-coated on the surface of an ITO electrode and dried naturally to obtain a Co(II) / g-C3N4 / ITO electrode.
[0012] (3) Preparation of Co(II) / g-C3N4 / aptamer / ITO photoelectrochemical aptamer sensor:
[0013] A certain amount of aptamer capable of specifically recognizing ATZ is drop-coated on the surface of the Co(II) / g-C3N4 / ITO electrode prepared in step (2), and after incubation at room temperature for a certain period of time, the unanchored aptamer on the surface of the electrode is washed with deionized water and dried at room temperature to obtain a Co(II) / g-C3N4 / aptamer / ITO photoelectrochemical aptamer sensor.
[0014] In step (1), the cobalt salt is cobalt nitrate hexahydrate or cobalt chloride, the carbon and nitrogen source is monocyamine, dicyanamide, melamine or urea, and the hydroxylamine acid salt is hydroxylamine hydrochloride or hydroxylamine sulfate.
[0015] The amount ratio of the cobalt salt, carbon and nitrogen source and hydroxylamine acid salt is 0.01-0.1 mmol: 0.5-2 g: 1-4 g; the hydrothermal reaction time is 10-24 h, the hydrothermal temperature is 100-200 ℃; the drying temperature is 60-100 ℃; the high-temperature calcination rate is 1-10 ℃ / min; the calcination temperature is 500-600 ℃; and the holding time is 2-8 h.
[0016] In step (2), the dispersant is deionized water, anhydrous ethanol or a mixture of deionized water and anhydrous ethanol; the concentration of the prepared dispersion liquid is 0.5-3 mg / mL; and the drop-coating amount is 20-70 μL.
[0017] In step (3), the concentration of the ATZ aptamer is 0.1-3 μmol / L; the dosage is 10-50 μL; the incubation time is 4-18 h; and the sequence of the ATZ aptamer is 5'-TGTACCGTCTGAGCGATTCGTACGAACGGC TTTGTACTGTTTGCACTGGCGGATTTAGCCAGTCAGTGTTAAGGAGTGC-3'.
[0018] The application also provides an application of the photoelectrochemical aptamer sensor based on Co(II) / g-C3N4 nanotubes, which is used for detecting ATZ, and the specific steps are as follows:
[0019] (4) The prepared Co(II) / g-C3N4 / aptamer / ITO photoelectrochemical aptamer sensor is used as a working electrode, Ag / AgCl is used as a reference electrode, and Pt is used as a counter electrode in the determination by using a three-electrode system of an electrochemical workstation; a 300W xenon lamp is used as an excitation light source, a phosphate buffer solution is used as an electrolyte, a certain external bias voltage is set, a time-current method is used to determine standard solutions with different concentrations of ATZ, a series of concentration-photocurrent corresponding relationships are obtained, and then a standard curve of ATZ concentration-photocurrent is drawn;
[0020] When a sample to be tested is tested, a certain amount of the sample to be tested is added to the above-mentioned electrolyte system, the photocurrent of the Co(II) / g-C3N4 / aptamer / ITO electrode is tested, and the concentration of ATZ in the detection solution can be obtained in combination with the standard curve.
[0021] In the above steps, the phosphate buffer solution is obtained by mutual modulation of 0.1-1 mol / L NaH2PO4·12H2O and Na2HPO4·2H2O; the external bias voltage is set to -0.2-0 V; and the amount of the sample to be tested is 10-100 μL.
[0022] The application has the following advantages:
[0023] (1) The Co(II) doping can enhance the visible light response of the material, introduce impurity energy levels between the valence band and the conduction band of the material, reduce the band gap (Eg), enhance the utilization rate of sunlight, and promote the separation of photoelectrons and holes, so that the Co(II) / g-C3N4 has excellent photoelectric performance.
[0024] (2) The tubular structure can increase the specific surface area of the material, provide multiple light reflection / scattering channels to realize rapid and long-distance electron transmission, enhance the light absorption performance, and help to improve the photoelectric performance of the Co(II) / g-C3N4.
[0025] (3) The prepared photoelectric active material has high efficient light absorption capacity and fast charge transport / separation capacity due to the nanotube morphology advantage and the doping of transition metal ion Co(II) on the nanotube, and has superior photoelectric performance, thereby promoting the application and development of g-C3N4-based materials in the photoelectric field.
[0026] (4) The Co(II) / g-C3N4 nanotube photoelectrochemical aptamer sensor has good linear range (0.01 fmol / L-1000 fmol / L), low detection limit (0.033 fmol / L), good stability and anti-interference ability when detecting ATZ, and indicates that the material can be used to construct a photoelectrochemical aptamer sensor to detect ATZ pesticide. BRIEF DESCRIPTION OF DRAWINGS
[0027] Figure 1 Figure 6 is an X-ray diffraction (XRD) diagram of Co(II) / g-C3N4 nanotube material, wherein a is g-C3N4, and b is Co(II) / g-C3N4.
[0028] Figure 2 Figure 7 is a scanning (SEM) and transmission (TEM) electron microscope diagram of Co(II) / g-C3N4 nanotube material, wherein a is SEM, and b is TEM diagram.
[0029] Figure 3 Figure 8 is an X-ray photoelectron spectroscopy (XPS) diagram of Co(II) / g-C3N4 nanotube material, wherein a is a full spectrum diagram, and b-d are high-resolution spectra of C1s, N 1s and Co 2p, respectively.
[0030] Figure 4 Figure 9 is a solid ultraviolet diffuse reflectance (DRS) diagram of Co(II) / g-C3N4 nanotube material, wherein a is g-C3N4, and b is Co(II) / g-C3N4.
[0031] Figure 5 Figure 10 is a diagram for constructing a Co(II) / g-C3N4 sensor, wherein a is a photocurrent response diagram, and b is an electrochemical impedance (EIS) diagram, wherein I is g-C3N4 / ITO, II is Co(II) / g-C3N4 / ITO, III is Co(II) / g-C3N4 / aptamer / ITO, and IV is Co(II) / g-C3N4 / aptamer / ATZ / ITO.
[0032] Figure 6 Figure 11 is a photocurrent response diagram of a Co(II) / g-C3N4 / aptamer / ITO electrode for detecting different concentrations of ATZ, wherein a is a photocurrent diagram obtained by detecting different concentrations of ATZ, and the concentrations of ATZ added from bottom to top are 0, 1×10 -2 、5×10-2 , 1 x 10 -1 , 5 x 10 -1 , 1, 5, 1 x 10 1 , 5 x 10 1 , 1 x 10 2 , 5 x 10 2 and 1 x 10 3 fM, b is the linear relationship diagram of the ATZ concentration-photocurrent drawn.
[0033] Figure 7 The performance evaluation diagram of the sensor, wherein a is an anti-interference ability diagram, the interference agents are profenofos (PFF), omethoate (OMT), diazinphos (DIZ), cypermethrin (EDF) and edifenphos (CYP), b is a reproducibility diagram, c and d are short-time and long-time stability diagrams, respectively. DETAILED DESCRIPTION
[0034] The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the accompanying drawings of the present application, so that those skilled in the art can better understand the present application, but the protection scope of the present application is not limited to the following embodiments. Obviously, the described embodiments are only a part of the embodiments of the present application, not all.
[0035] Example 1:
[0036] A preparation method of a photoelectrochemical aptamer sensor based on a Co(II) / g-C3N4 nanotube working electrode, the method is carried out according to the following steps:
[0037] (1) Preparation of Co(II) / g-C3N4 nanotube photoelectric active material:
[0038] First, 0.05 mmol of cobalt nitrate hexahydrate, 1 g of melamine and 2 g of hydroxylamine hydrochloride are added to 10 mL of ionized water, respectively, and stirred uniformly to form a solution. The above three reaction solutions are mixed uniformly and transferred to a reaction kettle containing a polytetrafluoroethylene liner, and a constant temperature hydrothermal reaction is carried out at 120℃ for 12 h. After the reaction is completed, the reaction kettle is taken out and naturally cooled to room temperature; the product is centrifuged, washed and dried at 60℃ to obtain a precursor; Next, 2 g of the precursor is weighed and calcined at 500℃ in a muffle furnace at a rate of 2℃ / min for 4 h to obtain the Co(II) / g-C3N4 nanotube photoelectric active material.
[0039] (2) Preparation of Co(II) / g-C3N4 / ITO electrode:
[0040] The photoelectric active material of Co(II) / g-C3N4 nanotube prepared in step (1) is stably dispersed in deionized water by ultrasonic treatment to obtain a 1 mg / mL stable dispersion; then 50 μL of the dispersion is drop-coated on the surface of an ITO electrode and naturally dried to obtain a Co(II) / g-C3N4 / ITO electrode.
[0041] (3) Preparation of a photoelectrochemical aptamer sensor of Co(II) / g-C3N4 / aptamer / ITO:
[0042] 20 μL of 0.2 μmol / L aptamer capable of specifically recognizing ATZ is drop-coated on the surface of the Co(II) / g-C3N4 / ITO electrode prepared in step (2), incubated at room temperature for 6 h, and the unanchored aptamer on the surface of the electrode is washed with deionized water and dried at room temperature to obtain a photoelectrochemical aptamer sensor of Co(II) / g-C3N4 / aptamer / ITO.
[0043] The sequence of the ATZ aptamer is 5'-TGTAC CGTCT GAGCG ATTCG TACGA ACGGC TTTGT ACTGTTTGCA CTGGC GGATT TAGCC AGTCA GTGTT AAGGA GTGC-3'.
[0044] The application also provides an application of the photoelectrochemical aptamer sensor based on Co(II) / g-C3N4 nanotube, which is used for detecting ATZ, and the specific steps are as follows:
[0045] (4) The prepared photoelectrochemical aptamer sensor of Co(II) / g-C3N4 / aptamer / ITO is used as a working electrode, Ag / AgCl is used as a reference electrode, and Pt is used as a counter electrode in a three-electrode system of an electrochemical workstation; a 300 W xenon lamp is used as an excitation light source, a phosphate buffer solution (obtained by mutual modulation of 0.1 mol / L NaH2PO4·12H2O and Na2HPO4·2H2O) is used as an electrolyte, an external bias voltage of 0 V is set, and a time-current method is used to determine standard solutions of different concentrations of ATZ to obtain a series of concentration-photocurrent corresponding relationships, and then a standard curve of ATZ concentration-photocurrent is drawn;
[0046] When a sample to be tested is tested, 10 μL of the sample to be tested is added to the above-mentioned electrolyte system, and the photocurrent of the Co(II) / g-C3N4 / aptamer / ITO electrode is tested, and the concentration of ATZ in the detection solution can be obtained in combination with the standard curve.
[0047] Example 2:
[0048] A preparation method of a photoelectrochemical aptamer sensor based on Co(II) / g-C3N4 nanotubes, which is carried out according to the following steps:
[0049] (1) Preparation of Co(II) / g-C3N4 nanotube photoelectric active material:
[0050] Firstly, 0.05 mmol of cobalt nitrate hexahydrate, 0.5 g of melamine and 1 g of hydroxylamine sulfate are respectively added into 10 mL of ionized water, and stirred uniformly to form a solution. The three reaction solutions are mixed uniformly, and then transferred into a reaction kettle containing a polytetrafluoroethylene liner, and subjected to constant temperature hydrothermal reaction at 140 DEG C for 16 h. After the reaction is completed, the reaction kettle is taken out and naturally cooled to room temperature. The product is centrifuged, washed and dried at 60 DEG C to obtain a precursor. Next, 2 g of the precursor is weighed and subjected to high-temperature calcination at 550 DEG C at a rate of 5 DEG C / min in a muffle furnace for 4 h to obtain the Co(II) / g-C3N4 nanotube photoelectric active material.
[0051] (2) Preparation of Co(II) / g-C3N4 / ITO electrode:
[0052] The Co(II) / g-C3N4 nanotube photoelectric active material prepared in step (1) is stably dispersed in deionized water by ultrasonic treatment to obtain a stable dispersion liquid with a concentration of 2 mg / mL. Then, 50 μL of the dispersion liquid is dropped and coated on the surface of an ITO electrode, and naturally dried to obtain the Co(II) / g-C3N4 / ITO electrode.
[0053] (3) Preparation of Co(II) / g-C3N4 / aptamer / ITO photoelectrochemical aptamer sensor:
[0054] 20 μL of aptamer with a concentration of 0.1 μmol / L and capable of specifically recognizing ATZ is dropped and coated on the surface of the Co(II) / g-C3N4 / ITO electrode prepared in step (2), and incubated at room temperature for 12 h. The electrode surface is washed with deionized water to remove the unanchored aptamer, and then dried at room temperature to obtain the Co(II) / g-C3N4 / aptamer / ITO photoelectrochemical aptamer sensor.
[0055] The sequence of the ATZ aptamer is 5'-TGTAC CGTCT GAGCG ATTCG TACGA ACGGC TTTGT ACTGTTTGCA CTGGC GGATT TAGCC AGTCA GTGTT AAGGA GTGC-3'.
[0056] The application further provides an application of the photoelectrochemical aptamer sensor based on the Co(II) / g-C3N4 nanotube working electrode, which is used for detecting ATZ, and the specific steps are as follows:
[0057] (4) The prepared Co(II) / g-C3N4 / aptamer / ITO electrode is used as a working electrode, Ag / AgCl is used as a reference electrode, and Pt is used as a counter electrode in a three-electrode system of an electrochemical workstation; a 300W xenon lamp is used as an excitation light source, a phosphate buffer solution (obtained by mutual modulation of 0.2 mol / L NaH2PO4·12H2O and Na2HPO4·2H2O) is used as an electrolyte, an external bias voltage of -0.1V is set, and time-current method is used to determine standard solutions of different concentrations of ATZ to obtain a series of concentration-photocurrent corresponding relationships, and then a standard curve of ATZ concentration-photocurrent is drawn; when a sample to be tested is tested, 20 μL of the sample to be tested is added to the above-mentioned electrolyte system, and the photocurrent of the Co(II) / g-C3N4 / aptamer / ITO electrode is tested, and the concentration of ATZ in the detection solution can be obtained by combining the standard curve.
[0058] Example 3:
[0059] A preparation method of a photoelectrochemical aptamer sensor based on Co(II) / g-C3N4 nanotubes, the method is carried out according to the following steps:
[0060] (1) Preparation of Co(II) / g-C3N4 nanotube photoelectric active material:
[0061] First, 0.05 mmol of cobalt chloride, 2 g of melamine and 4 g of hydroxylamine hydrochloride are added to 10 mL of ionized water, respectively, and stirred uniformly to form a solution. The above three reaction solutions are mixed uniformly and transferred to a reaction kettle containing a polytetrafluoroethylene liner, and a constant temperature hydrothermal reaction is carried out at 160°C for 20h. After the reaction is completed, the reaction kettle is taken out and naturally cooled to room temperature; the product is centrifuged, washed and dried at 60°C to obtain a precursor; next, 1 g of the precursor is weighed and calcined at 600°C at a rate of 5°C / min in a muffle furnace for 2h to obtain the Co(II) / g-C3N4 nanotube photoelectric active material.
[0062] (2) Preparation of Co(II) / g-C3N4 / ITO electrode:
[0063] The Co(II) / g-C3N4 nanotube photoelectric active material prepared in step (1) is stably dispersed in deionized water by ultrasonic treatment to obtain a 1 mg / mL stable dispersion liquid; then 70 μL of the dispersion liquid is dropped and coated on the surface of the ITO electrode and naturally dried to obtain the Co(II) / g-C3N4 / ITO electrode.
[0064] (3) Preparation of Co(II) / g-C3N4 / aptamer / ITO photoelectrochemical aptamer sensor:
[0065] Take 20 μL, 0.3 μmol / L aptamer capable of specifically recognizing ATZ is dropped on the surface of the Co(II) / g-C3N4 / ITO electrode prepared in step (2), and incubated at room temperature for 18 h, and the electrode surface is washed with deionized water and dried at room temperature. The unanchored aptamer on the electrode surface is obtained, that is, the Co(II) / g-C3N4 / aptamer / ITO photoelectrochemical aptamer sensor is obtained.
[0066] The sequence of the ATZ aptamer is 5'-TGTAC CGTCT GAGCG ATTCG TACGA ACGGC TTTGT ACTGTTTGCA CTGGC GGATT TAGCC AGTCA GTGTT AAGGA GTGC-3'.
[0067] The application also provides an application of the Co(II) / g-C3N4 nanotube-based photoelectrochemical aptamer sensor, which is used for detecting ATZ, and the specific steps are as follows:
[0068] (4) The prepared Co(II) / g-C3N4 / aptamer / ITO electrode is used as a working electrode, Ag / AgCl is used as a reference electrode, and Pt is used as a counter electrode in the three-electrode system of an electrochemical workstation; a 300W xenon lamp is used as an excitation light source, a phosphate buffer solution (prepared by mutual modulation of 0.5mol / L NaH2PO4·12H2O and Na2HPO4·2H2O) is used as an electrolyte, an external bias voltage of 0V is set, and a time-current method is used to determine standard solutions of different concentrations of ATZ, so as to obtain a series of concentration-photocurrent corresponding relationships, and then a standard curve of ATZ concentration-photocurrent is drawn;
[0069] When testing a sample to be tested, 20 μL of the sample to be tested is introduced into the above-mentioned electrolyte system, and the photocurrent of the Co(II) / g-C3N4 / aptamer / ITO electrode is tested, and the concentration of ATZ in the detection solution can be obtained by combining the standard curve.
[0070] Figure 1 X-ray diffraction (XRD) pattern of Co(II) / g-C3N4 nanotube material, wherein a is g-C3N4, and b is Co(II) / g-C3N4. From a, the diffraction peaks of the (100) and (002) crystal planes of g-C3N4 are observed; in b, the diffraction peak of the (002) crystal plane of the Co(II) / g-C3N4 nanotube is weak, and the (100) crystal plane almost disappears, which may be because the modified Co(II) / g-C3N4 is thinner than g-C3N4.
[0071] Figure 2are scanning (SEM) and transmission electron microscopy (TEM) images of Co(II) / g-C3N4 nanotube material, wherein a is SEM and b is TEM image. The tubular structure can increase the specific surface area of the material and provide multiple light reflection / scattering channels to achieve fast and long-distance electron transport, effectively realize space charge separation, enhance light absorption performance, all of which help to improve the photoelectric performance of Co(II) / g-C3N4 nanotube material.
[0072] Figure 3 are X-ray photoelectron spectroscopy (XPS) images of Co(II) / g-C3N4 nanotube material, wherein a is a full spectrum image, and b-d are high-resolution spectra of C 1s, N 1s and Co 2p, respectively. From Figure 3 As can be seen from a, in addition to C, N and O elements, there is also Co element, which confirms the successful preparation of Co(II) / g-C3N4 nanotube material. From Figure 3 As can be seen from b, there are three peaks at 284.2, 285.7 and 287.6 eV on the C 1s spectrum, which correspond to C–C, C–N and C–(N)3 bonds, respectively. From Figure 3 As can be seen from c, there are three peaks at 398.0, 399.7 and 400.7 eV on the N 1s spectrum, which correspond to C=N-C, N-(C)3 and C-N-H, respectively. From Figure 3 As can be seen from d, the characteristic peak of Co 2p at 780.7 eV corresponds to Co 2p3 / 2, indicating that Co(II) exists in the form of Co–N, while the peak at 796.5 eV is consistent with Co 2p1 / 2, and other peaks are satellite peaks. This shows the successful preparation of Co(II) / g-C3N4 nanotube material.
[0073] Figure 4 are solid-state ultraviolet diffuse reflectance (DRS) images of Co(II) / g-C3N4 nanotube material, wherein a is g-C3N4 and b is Co(II) / g-C3N4. After the introduction of Co(II), the absorption edge of Co(II) / g-C3N4 nanotube material has a red shift compared with g-C3N4, and in addition, the visible light absorption part of Co(II) / g-C3N4 nanotube material has obvious tailing, which is mainly due to the strong coordination and metal ligand charge transfer process between Co(II) and g-C3N4, which improves the utilization rate of visible light of the material, is conducive to the generation of more electron-hole pairs, and makes it have good photoelectric performance.
[0074] Figure 5Figure for the construction of Co(II) / g-C3N4 sensor, wherein a is the photocurrent response graph, b is the electrochemical impedance (EIS) graph, wherein I is g-C3N4 / ITO, II is Co(II) / g-C3N4 / ITO, III is Co(II) / g-C3N4 / aptamer / ITO, IV is Co(II) / g-C3N4 / aptamer / ATZ / ITO. From Figure 5 As can be seen from a, in phosphate buffer (pH 7.0), the photocurrent of Co(II) / g-C3N4 / ITO electrode is 3.8 times that of g-C3N4 / ITO electrode. This is because the doping of Co(II) introduces impurity energy levels between the valence band and the conduction band of g-C3N4. The impurity energy level provides a sub-band gap radiation for two-step excitation of electron generation, which is beneficial to the reduction of band gap (Eg), optimization of optical and conductive properties, promotion of the separation and migration of photo-generated carriers, thereby improving the photoelectric performance thereof. In addition, according to the differential charge data, it is shown that the electrons lost by Co(II) overlap with the upper and lower layers of g-C3N4, forming an interlayer charge transfer channel, which promotes the efficient transmission of photo-generated charges, so that the Co(II) / g-C3N4 nanotube material exhibits excellent photoelectric performance. The photocurrent of Co(II) / g-C3N4 / aptamer / ITO is lower than that of Co(II) / g-C3N4 / ITO, because the aptamer exists steric hindrance, which inhibits charge transfer. After adding ATZ, the Co(II) / g-C3N4 / aptamer / ATZ / ITO electrode has a lower photocurrent value than the Co(II) / g-C3N4 / aptamer / ITO, because ATZ combines with the aptamer to form a macromolecule, which enhances the steric hindrance and inhibits the directional migration of photo-generated electrons. From Figure 5 As can be seen from b, the Co(II) / g-C3N4 / ITO working electrode prepared by the application exhibits the smallest electron transfer resistance (R et ), and the impedance value increases after incubating the aptamer and ATZ, which is consistent with the result of the photocurrent response graph. The results show that the Co(II) / g-C3N4 nanotube material can construct a photoelectrochemical aptamer sensor for ATZ pesticide detection.
[0075] Figure 6 Figure for the photocurrent response of Co(II) / g-C3N4 / aptamer / ITO electrode for detecting different concentrations of ATZ, wherein a is the photocurrent graph obtained by detecting different concentrations of ATZ, and the concentrations of ATZ added from bottom to top are 0, 1×10 -2 , 5×10 -2 , 1×10 -1 , 5×10 -1 , 1, 5, 1×10 1 , 5×10 1 , 1×10 2, 5 x 10 2 and 1 x 10 3 fM. As can be seen from the figure, there is a clear photocurrent response after the addition of ATZ, and with the increase of ATZ concentration, the response photocurrent is gradually reduced. Figure 6 b is a linear relationship diagram of ATZ concentration-photocurrent drawn, and from the figure, it can be seen that a good linear relationship is maintained between ATZ concentration of 0.01 fmol / L-1000 fmol / L, and the linear equation is I (μA) = 0.0807-0.0243log(C ATZ / fmol / L )(R 2 =0.991), and the detection limit is 0.033 fmol / L.
[0076] Figure 7 is a performance evaluation diagram of the sensor, wherein a is an anti-interference ability diagram, and the interference agents are profenofos (PFF), omethoate (OMT), diazinphos (DIZ), cypermethrin (EDF) and edifenphos (CYP). As can be seen from the figure, when 0.5 fM ATZ is added, the Co(II) / g-C3N4 / aptamer / ITO electrode has a higher photocurrent response, and when 50 fM of the above interference agents is added, the Co(II) / g-C3N4 / aptamer / ITO electrode hardly produces a photocurrent response. This result shows that the proposed photoelectrochemical aptamer sensor has higher selectivity for the detection of ATZ. Figure 7 b is a reproducibility diagram, and five Co(II) / g-C3N4 / aptamer / ATZ / ITO electrodes are constructed in the same way and tested for photocurrent, and the relative standard deviation (RSD) is only 1.98%, which proves that the constructed photoelectrochemical aptamer sensor has satisfactory reproducibility. Figure 7 c and 7d are short-time and long-time stability diagrams, respectively, and from the figures, it can be seen that after short-time and long-time on-off light, the photocurrent value is basically maintained at the original photocurrent value, which shows that the constructed Co(II) / g-C3N4 nanotube photoelectrochemical aptamer sensor has better stability when detecting ATZ.
Claims
1. A method for fabricating a photoelectrochemical aptamer sensor based on Co(II) / g-C3N4 nanotubes, characterized in that, The steps are as follows: (1) Preparation of Co(Ⅱ) / g-C3N4 nanotube photoelectric active materials: First, cobalt salt, carbon nitrogen source, and hydroxylamine salt were added to deionized water and stirred until homogeneous to form a solution. The three reaction solutions were then mixed and transferred to a reaction vessel with a polytetrafluoroethylene liner for a constant-temperature hydrothermal reaction. After the reaction was completed, the reaction vessel was removed and allowed to cool naturally to room temperature. The product was centrifuged, washed, and dried to obtain the precursor. A certain amount of the precursor was weighed and calcined at high temperature in a muffle furnace to obtain Co(II) / g-C3N4 nanotube photoelectric active material. The cobalt salt is cobalt nitrate hexahydrate or cobalt chloride, the carbon and nitrogen source is cyanamide, dicyandiamide, melamine or urea, and the hydroxylamine salt is hydroxylamine hydrochloride or hydroxylamine sulfate; the ratio of the cobalt salt, carbon and nitrogen source and hydroxylamine salt is 0.01~0.1mmol:0.5~2g:1~4g, respectively. (2) Preparation of Co(II) / g-C3N4 / ITO electrode: The Co(II) / g-C3N4 nanotube photoelectric active material prepared in step (1) was ultrasonically dispersed in a dispersant to obtain a stable dispersion; then the obtained dispersion was drop-coated onto the surface of an ITO electrode and allowed to dry naturally to obtain a Co(II) / g-C3N4 / ITO electrode. (3) Preparation of Co(II) / g-C3N4 / aptamer / ITO photoelectrochemical aptamer sensor: A certain amount of aptamer that can specifically recognize atrazine was drop-coated onto the surface of the Co(II) / g-C3N4 / ITO electrode prepared in step (2). After incubating at room temperature for a certain period of time, the unanchored aptamer on the electrode surface was rinsed with deionized water and dried at room temperature to obtain the Co(II) / g-C3N4 / aptamer / ITO photoelectrochemical aptamer sensor.
2. The preparation method according to claim 1, characterized in that, In step (1), the temperature of the constant temperature hydrothermal reaction is 100~200 ºC, the reaction time is 10~24 h, and the drying temperature is 60~100 ºC.
3. The preparation method according to claim 1, characterized in that, In step (1), the heating rate of high-temperature calcination is 1~10ºC / min; the calcination temperature is 500-600 ºC; and the holding time is 2~8 h.
4. The preparation method according to claim 1, characterized in that, In step (2), the dispersant is deionized water, anhydrous ethanol, or a mixture of deionized water and anhydrous ethanol; the concentration of the prepared dispersion is 0.5~3 mg / mL; and the amount of liquid used for drop coating is 20~70 μL.
5. The preparation method according to claim 1, characterized in that, In step (3), the concentration of the atrazine aptamer is 0.1~3 μmol / L; the amount used is 10~50 μL; and the incubation time is 4~18 h.
6. The preparation method according to claim 1, characterized in that, In step (3), the sequence of the atrazine aptamer is 5′-TGTAC CGTCT GAGCG ATTCG TACGA ACGGC TTTGT ACTGT TTGCA CTGGC GGATT TAGCCAGTCA GTGTT AAGGA GTGC-3′.
7. The application of the photoelectrochemical aptamer sensor based on Co(II) / g-C3N4 nanotubes prepared by the preparation method according to any one of claims 1 to 6 for the quantitative detection of atrazine.
8. The application as described in claim 7, characterized in that, The specific steps are as follows: The measurements were performed using a three-electrode system on an electrochemical workstation. The prepared Co(II) / g-C3N4 / aptamer / ITO photoelectrochemical aptamer sensor was used as the working electrode, Ag / AgCl as the reference electrode, and Pt as the counter electrode. A 300 W xenon lamp was used as the excitation source, and phosphate buffer solution was used as the electrolyte. A certain external bias voltage was set, and the time-current method was used to measure the standard solutions of atrazine at different concentrations. A series of concentration-photocurrent correspondences were obtained, and then a standard curve of atrazine concentration-photocurrent was plotted. When testing the sample, a certain amount of the sample is added to the above electrolyte system, and the photocurrent of the Co(Ⅱ) / g-C3N4 / aptamer / ITO electrode is tested. Combined with the standard curve, the concentration of atrazine in the test solution can be obtained.
9. The application as described in claim 8, characterized in that, The phosphate buffer solution was prepared by intermodulating NaH2PO4·12H2O and Na2HPO4·2H2O at equal concentrations of 0.1~1 mol / L; the applied bias voltage was set to -0.2~0 V; and the amount of the sample to be tested was 10~100 μL.
Citation Information
Patent Citations
Preparation method and application of photoelectrochemical aptamer sensor for detecting enrofloxacin
CN112461904A
Process for the synthesis of oxidized graphitic carbon nitrides and their use as electrochemical sensors.
MX2017014756A