A recombinant L-amino acid deaminase escherichia coli genetically engineered bacterium, a construction method and application thereof

Abstract

The application discloses a kind of recombinant L-amino acid deaminase escherichia coli genetically engineered bacteria and its construction method and application, the enzyme is named PM473 with the amino acid deaminase gene derived from Proteus mirabilis as template, with pET-20b as carrier, recombination is converted into BL21 (DE3) escherichia coli, obtain suitable amino acid deaminase function E.coli BL21 (DE3) / pET20b-PM473 genetically engineered bacteria, using verified genetically engineered bacteria to produce L-amino acid deaminase escherichia coli whole cell catalyst, can catalyze glutamine production alpha-ketoglutaric acid and realize the chiral resolution to racemic body, catalytic product only alpha-ketoglutaric acid and byproduct NH3, and remaining unreacted D-glutamine, simple separation and purification.Control reaction time, the conversion rate of L-glutamine in racemic substrate is 100%, and the conversion rate of D-glutamine is 58.5%.The enzyme can also catalyze L-alanine, L-threonine, phenylalanine, cysteine to produce corresponding alpha-keto acid.

Description

Technical Field

[0001] This invention relates to a wastewater treatment device for the catering industry, specifically to a recombinant L-amino acid deaminase-producing Escherichia coli genetically engineered bacterium, its construction method, and its application. Background Technology

[0002] α-Keto acids are important fine chemical intermediates with wide applications in the chemical synthesis of pharmaceuticals, food additives, food, and cosmetics. Currently, most keto acids on the market are prepared through chemical synthesis, which is not only environmentally unfriendly but also produces various toxic byproducts. With the development of bioengineering technology, the biosynthesis of keto acids has been discovered, and different metabolic engineering strategies are being applied in microorganisms to produce specific keto acids from renewable carbohydrates.

[0003] α-Ketoglutaramic acid, also known as α-ketoglutaramate, 2-oxoglutaramate, or 2-hydroxy-5-oxoproline, is synthesized and metabolized in plants through the continuous action of transaminases and hydrolases. Similar transaminases, hydrolases, and α-ketoglutaramic acid have also been found in the liver and kidneys of animals. Alpha-ketoglutamate (α-ketoglutamate) has wide applications in agriculture as a plant growth regulator. In biological research, human ω-amidase (nitrile hydrolase, Nitrilase 2) has been identified as a recognized tumor suppressor protein, inhibiting cancer cells at the G2 cell cycle stage. Nitrilase 2 is expressed in every human tissue studied (heart, brain, placenta, lung, liver, skeletal muscle, kidney, pancreas, spleen, thymus, prostate, testes, ovaries, small intestine, colon, and leukocytes), with the highest expression in the liver and kidneys. α-ketoglutamate, as a substrate of Nitrilase 2, is essential for studying the enzyme's normative function and its role in various diseases. Currently, the most readily available method for producing α-ketoglutamate is the oxidation of L-glutamine using snake venom-derived L-amino acid oxidases. This method is not only expensive but also generates harmful H2O2 during production. Summary of the Invention

[0004] The purpose of this invention is to provide a recombinant L-amino acid deaminase-producing Escherichia coli genetically engineered bacterium, its construction method, and its application, which can solve the technical problems mentioned in the background.

[0005] In one aspect of the invention, a recombinant L-amino acid deaminase-producing Escherichia coli genetically engineered bacterium is proposed. According to an embodiment of the invention, using an L-amino acid deaminase gene derived from *Proteus mirabilis* as a template, the enzyme is named PM473. Using pET-20b as a vector and SalI-XhoI as a cloning site, the gene is recombinantly transformed into competent *E. coli* cells BL21(DE3) to obtain the recombinant L-amino acid deaminase-producing *E. coli* BL21(DE3) / pET20b-PM473 genetically engineered bacterium.

[0006] In another aspect of the present invention, a method for constructing a recombinant L-amino acid deaminase-producing Escherichia coli genetically engineered bacterium is proposed. According to an embodiment of the present invention, using the L-amino acid deaminase gene from *Proteus mirabilis* (GeneBank: MG746627.1) as a template, the enzyme is named PM473. PM473 is inserted into the pET-20b vector using SalI-XhoI as the cloning site. The recombinant expression plasmid pET20b-PM473 is obtained by PCR amplification. The recombinant expression plasmid pET20b-PM473 is transformed into competent *E. coli* cells BL21(DE3). After ampicillin resistance screening, enzyme digestion, bacterial PCR, and SDS-PAGE verification, the recombinant L-amino acid deaminase-producing *E. coli* BL21(DE3) / pET20b-PM473 genetically engineered bacterium is obtained.

[0007] In another aspect, the present invention provides a whole-cell catalyst for L-amino acid deaminase-producing Escherichia coli. According to an embodiment of the present invention, the whole-cell catalyst is the whole cell of the recombinant L-amino acid deaminase-producing Escherichia coli genetically engineered bacterium.

[0008] In another aspect of the present invention, a method for preparing a whole-cell catalyst of L-amino acid deaminase *Escherichia coli* is provided. According to an embodiment of the present invention, the preparation method includes the following steps: inoculating the recombinant L-amino acid deaminase *Escherichia coli* genetically engineered bacteria as described in claim 1 into LB medium containing ampicillin to obtain a seed culture; adding the seed culture to TB medium containing ampicillin for further culture and induction of enzyme production; centrifuging the induced fermentation suspension; washing with Na2HPO4-NaH2PO4 buffer; centrifuging again to obtain whole-cell L-amino acid deaminase *Escherichia coli*, which is the whole-cell catalyst of L-amino acid deaminase *Escherichia coli*; and storing the whole-cell bacteria in the aforementioned Na2HPO4-NaH2PO4 buffer.

[0009] In addition, the method for preparing an L-amino acid deaminase Escherichia coli whole-cell catalyst according to the above embodiments of the present invention may also have the following additional technical features:

[0010] In some embodiments of the present invention, the genetically engineered bacteria are inoculated into LB medium containing 100-200 μg / ml ampicillin at a volume fraction of 0.5%-1%, and cultured at 30-40°C for 10-14 hours at a rotation speed of 200-250 r / min; the seed culture is inoculated into TB medium containing 100-200 μg / ml ampicillin at a volume fraction of 0.5-1%, and cultured on a shaker at 30-40°C; when fresh TB medium is added, the OD of the enriched bacterial culture is... 600 At a pH of 1.6–2.0, 0.05–0.5 mmol / L of isopropyl-β-D-thiogalactopyranoside (IPTG) was added, and fermentation was induced at 15–25 °C for 10–14 hours. The centrifugation temperature was 4–30 °C, the rotation speed was 8000–10000 r / min, and the time was 10–15 min. The pH of the Na2HPO4-NaH2PO4 buffer solution was 6.0–8.0, and the concentration was 0.01–0.05 mol / L.

[0011] In another aspect, the present invention provides a method for preparing α-keto acids. According to an embodiment of the present invention, amino acids are used as substrates, and the corresponding α-keto acids are generated by catalytic deamination using the L-amino acid deaminase Escherichia coli whole-cell catalyst described in claim 3.

[0012] In addition, the method for preparing α-keto acid according to the above embodiments of the present invention may also have the following additional technical features:

[0013] In some embodiments of the present invention, the amino acid is one of the following: vortex glutamine, L-alanine, L-threonine, phenylalanine, and cysteine, which respectively yield α-ketopentanediamine, pyruvic acid, 2-keto-3-hydroxybutyric acid, phenylpyruvic acid, and 2-keto-3-mercaptopropionic acid.

[0014] In some embodiments of the present invention, the following steps are specifically included: using amino acids as substrates, dissolving the substrates in Na2HPO4-NaH2PO4 buffer solution, adding L-amino acid deaminase Escherichia coli whole-cell catalyst for reaction, removing the reaction solution to inactivate the enzyme, then centrifuging, retaining the supernatant reaction solution after centrifugation and discarding the precipitate, wherein the supernatant reaction solution is α-ketopentanediamine.

[0015] In some embodiments of the present invention, when the amino acid is glutamine, the concentration of the amino acid is 40 mmol / L, the pH of the Na2HPO4-NaH2PO4 buffer is 6.5, the concentration is 0.02 mol / L, and the reaction temperature is 30°C; when the amino acid is one of L-alanine, L-threonine, phenylalanine, or cysteine, the concentration of the amino acid is 20 mmol / L, the pH of the Na2HPO4-NaH2PO4 buffer is 7, the concentration is 0.02 mol / L, and the reaction temperature is 37°C; the final concentration of the L-amino acid deaminase Escherichia coli whole-cell catalyst is 5 g / L.

[0016] In some embodiments of the present invention, the reaction time is 12 hours, and the reaction is carried out on a shaker at 220 r / min; the enzyme is inactivated by high-temperature heating at 100°C for 10-15 min; the centrifugation speed is 8000-10000 r / min for 10-15 min.

[0017] Compared with the prior art, the beneficial effects of the present invention are:

[0018] 1) L-amino acid deaminase (LAAD) is a membrane-bound riboflavin oxidase that utilizes riboflavin (FAD) to catalyze the deamination of amino acids, producing the corresponding keto acid and ammonia. Electrons from the reduced cofactor are transferred to cytochromes, thus preventing the production of hydrogen peroxide. This invention expresses an L-amino acid deaminase derived from *Proteus mirabilis* in *Escherichia coli*, and produces α-ketopentyldiamine via microbial transformation technology, while simultaneously achieving the chiral resolution of racemic glutamine.

[0019] 2) When using racemic glutamine as a substrate, the whole-cell catalyst of this invention can obtain α-ketopentanediamine product without additional cofactors, while simultaneously obtaining a single chiral enantiomer of D-glutamine, thus achieving chiral resolution of glutamine. The whole-cell activity of L-amino acid deaminase catalyzing racemic glutamine is 1126 μg / g·min. After 14 h of reaction, the conversion rate of L-glutamine is 100%, the substrate conversion rate of D-glutamine is 58.5%, and the total remaining 20.75% is the single chiral enantiomer of D-glutamine. Continuing the reaction for 20 h can achieve a total conversion rate of 100%, with all substrate converted to α-ketopentanediamine.

[0020] 3) The E. coli BL21(DE3) / pET20b-PM473 genetically engineered bacteria constructed in this invention produces fewer products by catalyzing glutamine, only α-ketoglutamate and NH3, without producing harmful H2O2, and the separation and purification are simple.

[0021] 4) The whole-cell catalyst of the present invention can also catalyze L-alanine, L-threonine, phenylalanine and cysteine ​​to specifically produce pyruvate, 2-keto-3-hydroxybutyric acid, phenylpyruvate and 2-keto-3-mercaptopropionic acid, simplifying the separation and purification steps, reducing production costs, and providing a new way to better produce α-keto acids. Attached Figure Description

[0022] Figure 1 This is a schematic diagram of the recombinant plasmid pET20b-PM473 in Example 1 of the present invention;

[0023] Figure 2 This is a diagram illustrating the reaction mechanism of glutamine catalyzed by the L-amino acid deaminase Escherichia coli whole-cell catalyst in Example 4 of this invention.

[0024] Figure 3 This is a time progression diagram of the L-amino acid deaminase Escherichia coli whole-cell catalyst catalyzing the conversion of glutamine substrate in Example 4 of this invention;

[0025] Figure 4 This is a liquid phase detection image of the L-amino acid deaminase Escherichia coli whole-cell catalyst catalyzing the conversion of glutamine substrate in Example 4 of this invention;

[0026] Figure 5 This is a one-dimensional hydrogen spectrum of α-ketopentanediamine acid isolated and purified in Example 4 of this invention;

[0027] Figure 6 This is a one-dimensional carbon spectrum of α-ketopentanediamine, isolated and purified in Example 4 of this invention, using DMSO-D6 (dimethyl sulfoxide-D6) as solvent;

[0028] Figure 7 This is a one-dimensional carbon spectrum of α-ketopentanediamine, isolated and purified in Example 4 of this invention, using CD3OD (deuterated methanol) as solvent. Detailed Implementation

[0029] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0030] Example 1

[0031] The construction of a recombinant L-amino acid deaminase-producing Escherichia coli genetically engineered bacterium includes the following steps:

[0032] Using the L-amino acid deaminase gene from *Proteus mirabilis* as a template, the L-amino acid deaminase gene was cloned and named PM473. Figure 1 As shown, SalI-XhoI was inserted into the pET-20b vector using this as the cloning site, and the recombinant expression plasmid pET20b-PM473 was obtained by PCR amplification. The recombinant expression plasmid was transformed into E. coli competent cells BL21(DE3), and after ampicillin resistance selection, enzyme digestion, bacterial PCR, and SDS-PAGE verification, the recombinant L-amino acid deaminase-producing E. coli BL21(DE3) / pET20b-PM473 genetically engineered bacteria suitable for amino acid deamination function was obtained.

[0033] The host bacteria transformation specifically includes the following steps:

[0034] (1) Take 200 μL of Escherichia coli BL21(DE3) competent cell suspension (purchased from Beijing TransGen Biotech Co., Ltd.) from a -80℃ freezer and thaw it on ice;

[0035] (2) Add the prepared recombinant expression plasmid solution, add about 5 μL of plasmid DNA to every 50 μL of competent cells, shake gently, and place on ice for 30 minutes;

[0036] (3) Heat shock in a 42℃ water bath for 45 seconds, and then quickly place on ice to cool for 2 minutes after heat shock;

[0037] (4) Add 450 μL of sterilized LB liquid medium (without antibiotics) to the tube, mix well, and incubate at 37°C for 1 hour to allow the bacteria to return to normal growth and express the resistance gene encoded by the plasmid.

[0038] (5) After shaking the above bacterial solution well, take 100 μL and spread it on a screening plate containing antibiotics. Place it face up for half an hour. When the bacterial solution is completely absorbed by the culture medium, invert the culture medium and incubate at 37°C for 16 to 24 hours. Select positive colonies and verify them by bacterial solution PCR to obtain the recombinant L-amino acid deaminase E. coli BL21(DE3) / pET20b-PM473 genetically engineered bacteria suitable for amino acid deamination function.

[0039] The gene sequence of PM473 is shown below:

[0040] 1atgaacattt caaggaaa gctgctttta ggtgttggtg ctgcgggtgt tttggccggt

[0041] 61ggtgctgcat tagttccaat ggtgcgccgt gatggcaaat tcgttgaagc taaatctaga

[0042] 121gcatcatttg tcgaaggtac agagggtgcg ctgcctaaag agtctgatgc agtgattatt

[0043] 181ggtggtggta ttcaaggtat catgactgct atcaaccttg cagaacgtgg catgagtgtc

[0044] 241 actatttag aaaaaggcga gattggtggt gaacaatccg gccgtgcata cagccaaatt

[0045] 301attagttatc aaacatcacc agaaattttc ccattgcacc attatgggaa aatcttatgg

[0046] 361 cgcggaatga acgagaaaat tggtgctgat actagttatc gtacacaagg tcgtgtagaa

[0047] 421gcgcttgctg atgaaaaagc atttgataaa gctcaagcgt ggatcaaaac agcaaaagaa

[0048] 481actgcgggat ttgatacacc attaaatact cgcattatta aaggtgaaga gttatcaaac

[0049] 541 cgcttagttg gtgctcaaac accatggaca gttgctgctt ttgaaga ctcaggttct

[0050] 601gttgatcccg aaaaggaac acctgcatta gcacgctacg ctaaaaaat tggcgtaaaa

[0051] 661atctatacta actgcgcggt aagaggcatt gaaactgctg gtggtaaaat ttctgatgtt

[0052] 721 gtaacaaa aaggcgcaat tagaacatct cacgttgttc ttgctggtgg tatttggtca

[0053] 781 cgtttatttatgggtaacat gggcattgat attccaacgc tgaatgttta cttatcacaa

[0054] 841caacgtgtat caggtgttcc tggcgcacct cgtggtaacg tgcatttacc gaatggtatt

[0055] 901 cacttccgtg aacaagctga cggtacttat gctgtcgcac cgcgttttt caccagttct

[0056] 961attgtaaaag atagcttttt attagggcct aagttcatgc acctattagg tggtggtgag

[0057] 1021ctgccattag aattctctat cggtgaagac ttgtttaatt cattcaagatgccaacatct1081tggaaattag atgaaaaaac accgtttgaa caatatcgta ttgcaacagcaacacaaaat1141actgagcact tagatgcggt attccaaaga atgaaagctg aattcccagtatttgaaaaa1201tcacaagttg ttgaacgttg gggtgctgtt gttagcccaa catttgatgaattaccaatt1261atctctgagg ttaaagaata ccctggctta gtcattaata cggcgacggtatggggtatg1321accgaaggcc cagcagcagg tgaagttact gctgatatcg taacgggcaaaaaaccagtt1381attgatccaa caccatttag tttggatcgt tttaagaag

[0058] The gene sequence of pET-20b(+) is shown as follows:

[0059] 1atccggatat agttcctcct ttcagcaaaa aacccctcaa gacccgttta gaggccccaa

[0060] 61ggggttatgc tagttattgc tcagcggtgg cagcagccaa ctcagcttcc tttcgggctt

[0061] 121tgttagcagc cggatctcag tggtggtggt ggtggtgctc gagtgcggcc gcaagcttgt

[0062] 181cgacggagct cgaattcgga tccgaattaattccgatatc catggccatc gccggctggg

[0063] 241cagcgaggag cagcagacca gcagcagcgg tcggcagcag gtatttcata tgtatatctc

[0064] 301cttcttaaag ttaaacaaaattatttctag agggaaaccg ttgtggtctc cctatagtga

[0065] 361gtcgtattaatttcgcggga tcgagatctc gggcagcgtt gggtcctggc cacgggtgcg

[0066] 421catgatcgtg ctcctgtcgt tgaggacccg gctaggctgg cggggttgcc ttactggtta

[0067] 481gcagaatgaa tcaccgatac gcgagcgaac gtgaagcgac tgctgctgca aaacgtctgc

[0068] 541gacctgagca acaacatgaa tggtcttcgg tttccgtgtt tcgtaaagtc tggaaacgcg

[0069] 601gaagtcagcg ccctgcacca ttatgttccg gatctgcatc gcaggatgct gctggctacc

[0070] 661ctgtggaaca cctacatctg tattaacgaa gcgctggcat tgaccctgag tgatttttct

[0071] 721ctggtcccgc cgcatccata ccgccagttg tttaccctca caacgttcca gtaaccgggc

[0072] 781atgttcatca tcagtaaccc gtatcgtgag catcctctct cgtttcatcg gtatcattac

[0073] 841ccccatgaac agaaatcccc cttacacgga ggcatcagtg accaaacagg aaaaaaccgc

[0074] 901ccttaacatg gcccgcttta tcagaagcca gacattaacg cttctggagaga aactcaacga

[0075] 961gctggacgcg gatgaacagg cagacatctg tgaatcgctt cacgaccacg ctgatgagct

[0076] 1021 ttaccgcagc tgcctcgcgc gtttcggtga tgacggtgaa aacctctgacacatgcagct

[0077] 1081 cccggagacg gtcacagctt gtctgtaagc ggatgccggg agcagacaagcccgtcaggg

[0078] 1141 cgcgtcagcg ggtgttggcg ggtgtcgggg cgcagccatg acccagtcacgtagcgatag

[0079] 1201 cggagtgtat actggcttaa ctatgcggca tcagagcaga ttgtactgagagtgcaccat

[0080] 1261 atatgcggtg tgaaataccg cacagatgcg tagggaagaaa ataccgcatcaggcgctctt

[0081] 1321 ccgcttctc gctcactgac tcgctgcgct cggtcgttcg gctgcggcgagcggtatcag

[0082] 1381 ctcactcaaa ggcggtaata cggttatcca cagaatcagg ggataacgcaggaaagaaca

[0083] 1441 tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa ggccgcgttgctggcgttttt

[0084] 1501 tccataggct ccgcccccct gacgagcatc acaaaaatcg acgctcaagtcagaggtggc

[0085] 1561 gaaacccgac aggactataa agataccagg cgtttccccc tggaagctccctcgtgcgct

[0086] 1621 ctcctgttcc gaccctgccg cttaccggat acctgtccgc ctttctcccttcgggaagcg

[0087] 1681 tggcgctttc tcatagctca cgctgtaggt atctcagttc ggtgtaggtcgttcgctcca

[0088] 1741 agctgggctg tgtgcacgaa ccccccgttc agcccgaccg ctgcgccttatccggtaact

[0089] 1801 atcgtcttga gtccaacccg gtaagacacg acttatcgcc actggcagcagccactggta

[0090] 1861 acaggattag cagagcgagg tatgtaggcg gtgctacaga gttcttgaagtggtggccta

[0091] 1921 actacggcta cactagaagg acagtatttg gtatctgcgc tctgctgaagccagttacct

[0092] 1981 tcggaaaaag agttggtagc tcttgatccg gcaaacaaac caccgctggtagcggtggtt

[0093] 2041 tttttgtttg caagcagcag attacgcgca gaaaaaaagg atctcaagaagatcctttga

[0094] 2101 tcttttctac ggggtctgac gctcagtgga acgaaaactc acgttaagggattttggtca

[0095] 2161 tgagattatc aaaaaggatc ttcacctaga tccttttaa ttaaaatgaagttttaaat

[0096] 2221 caatctaaag fathers taaacttggt ctgacagtta ccaatgcttaatcagtgagg

[0097] 2281 cacctatctc agcgatctgt ctattcgtt catccatagt tgcctgactccccgtcgtgt

[0098] 2341 agataactac gatacgggag ggcttaccat ctggccccag tgctgcaatgataccgcgag

[0099] 2401 acccacgctc accggctcca gatttatcag caataacca gccagccggaagggccgagc

[0100] 2461 gcagaagtgg tcctgcaact ttatccgcct ccatccagtc tattaattgttgccgggaag

[0101] 2521ctagagtaag tagttcgcca gttaatagtt tgcgcaacgt tgttgccatt gctgcaggca

[0102] 2581tcgtggtgtc acgctcgtcg tttggtatgg cttcattcag ctccggttcc caacgatcaa

[0103] 2641ggcgagttac atgatccccc atgttgtgca aaaaagcggt tagctccttc ggtcctccga

[0104] 2701tcgttgtcag aagtaagttg gccgcagtgt tatcactcat ggttatggca gcactgcata

[0105] 2761attctcttac tgtcatgcca tccgtaagat gcttttctgt gactggtgag tactcaacca

[0106] 2821agtcattctg agaatagtgt atgcggcgac cgagttgctc ttgcccggcg tcaatacggg

[0107] 2881ataataccgc gccacatagc agaactttaa aagtgctcat cattggaaaa cgttcttcgg

[0108] 2941ggcgaaaact ctcaaggatc ttaccgctgt tgagatccag ttcgatgtaa cccactcgtg

[0109] 3001cacccaactg atcttcagca tcttttactt tcaccagcgt ttctgggtga gcaaaaacag

[0110] 3061gaaggcaaaatgccgcaaaa aagggaataa gggcgacacg gaaatgttga atactcatac

[0111] 3121tcttccttt tcaatattat tgaagcattt atcagggtta ttgtctcatg agcggataca

[0112] 3181tatttgaatg tatttagaaa aataaacaaa taggggttcc gcgcacattt ccccgaaaag

[0113] 3241tgccacctga aattgtaaac gttaatattt tgttaaaatt cgcgttaaat ttttgttaaa

[0114] 3301tcagctcattttttaaccaa taggccgaaa tcggcaaaat cccttataaa tcaaaagaat

[0115] 3361agaccgagat agggttgagt gttgttccag tttggaacaa gagtccacta ttaaagaacg

[0116] 3421tggactccaa cgtcaaaggg cgaaaaaccg tctatcaggg cgatggccca ctacgtgaac

[0117] 3481catcacccta atcaagtttt ttggggtcga ggtgccgtaa agcactaaat cggaacccta

[0118] 3541aagggagccc ccgatttaga gcttgacggg gaaagccggc gaacgtggcg agaaaggaag

[0119] 3601ggaagaaagc gaaaggagcg ggcgctaggg cgctggcaag tgtagcggtc acgctgcgcg

[0120] 3661taaccaccac acccgccgcg cttaatgcgc cgctacaggg cgcgtcccat tcgcca

[0121] The gene sequence of pET20b-PM473 is shown below:

[0122]

[0123] Example 2

[0124] Expression of recombinant L-amino acid deaminase-rich Escherichia coli BL21(DE3) / pET20b-PM473 genetically engineered bacteria suitable for amino acid deamination:

[0125] The genetically engineered E. coli BL21(DE3) / pET20b-PM473 prepared in Example 1 was inoculated at a volume fraction of 1% into LB medium containing 100 μg / ml ampicillin, and cultured at 37°C for 14 hours at a rotation speed of 220 rpm. Then, 1% of the above seed culture was added to fresh TB medium and cultured on a shaker at 37°C. When the OD of the enriched culture solution... 600 At a concentration of 1.6–2.0, IPTG at a final concentration of 0.1 mM was added to induce enzyme production. Fermentation was induced at 20°C for 11 hours, followed by crushing and centrifugation. The samples were then analyzed by SDS-PAGE electrophoresis. The molecular weight of the expressed recombinant L-amino acid deaminase was approximately 51 kDa, consistent with the predicted value.

[0126] Example 3

[0127] A method for preparing an L-amino acid deaminase Escherichia coli whole-cell catalyst specifically includes the following steps:

[0128] The genetically engineered E. coli BL21(DE3) / pET20b-PM473 prepared in Example 1 was inoculated at a volume fraction of 1% into LB medium containing 100 μg / ml ampicillin, and cultured at 37°C for 14 hours at a rotation speed of 220 rpm. Then, 1% of the above seed culture was added to fresh TB medium and cultured on a shaker at 37°C. When the OD of the enriched culture solution... 600 At pH 1.6–2.0, add 0.1 mM IPTG to induce enzyme production. Maintain fermentation at 25°C for 11 hours. Centrifuge the induced fermentation suspension at 8000 rpm for 15 minutes at 4°C. Then, wash with 0.02 M Na2HPO4-NaH2PO4 buffer (pH 6.5) by shaking. After centrifugation again, the whole-cell catalyst of L-amino acid deaminase for E. coli is obtained. Store the cells in the above buffer.

[0129] Example 4

[0130] A method for preparing α-ketopentanediamine includes the following steps:

[0131] The L-amino acid deaminase obtained in Example 3 was used as a whole-cell catalyst from *E. coli* to catalyze the deamination of vortex glutamine to α-ketopentanediamine. The enzyme reaction system was prepared as follows: 40 mM glutamine substrate was dissolved in 0.02 M Na₂HPO₄-NaH₂PO₄ buffer at pH 6.5. A final concentration of 5 g / L wet whole-cell catalyst was added, and the reaction was carried out at 30°C and 220 rpm for 14 hours on a shaker. After removing the reaction solution, the enzyme was inactivated by heating at high temperature for 10 min. The mixture was then centrifuged at 10000 rpm for 15 min. The supernatant was retained, and the precipitate was discarded. The supernatant was the α-ketopentanediamine. Figure 5 The one-dimensional 1H spectrum of α-ketopentanediamine is shown below: 1 H NMR (CD3OD, 3.31ppm, 4.87ppm), δ3.57-3.52(m,1H), 2.52-2.39(m,2H), 2.18-2.10(m,1H), 2.05-1.96(m,1H). like Figure 6 The one-dimensional carbon spectrum of α-ketopentadiamine acid in DMSO-D6 (dimethyl sulfoxide-D6) solvent is shown below: 13 C NMR δ 172.8, 87.7, 22.2. (e.g.) Figure 7 The one-dimensional carbon spectrum of α-ketoglutamate with CD3OD (deuterated methanol) as solvent is shown below: 13 C NMR δ181.6, 174.8, 89.3, 35.7, 28.7.

[0132] like Figure 2 As shown, the reaction mechanism of L-amino acid deaminase catalyzed by the whole-cell catalyst of Escherichia coli is as follows: with the participation of oxygen, glutamine is oxidized and deaminated to generate α-ketopentanediamine, which mainly exists in the form of cyclic amide in solution.

[0133] Conversion rate was detected using UV-Vis liquid chromatography under the following conditions: a Crownpak CR-I chiral column in reverse mode; mobile phase consisting of perchloric acid aqueous solution (pH = 1-2) and acetonitrile in a volume ratio of 80%:20%; flow rate set at 0.2 mL / min; and column temperature at 25 °C. Figure 3 As shown, after 14 hours of reaction, 100% L-glutamine conversion and 58.5% D-glutamine substrate conversion were achieved, with 20.75% of the total substrate remaining as a single chiral enantiomer of D-glutamine. Continuing the reaction for 20 hours could achieve 100% overall conversion, with all substrate converted to α-ketopentanediamine. Figure 4 As shown, after 14 hours of reaction, the L-glutamine substrate peak basically disappeared, while 41.5% of the D-glutamine substrate remained.

[0134] Example 5

[0135] The application of the recombinant L-amino acid deaminase-producing *E. coli* BL21(DE3) / pET20b-PM473 genetically engineered strain, which is suitable for catalyzing the deamination of amino acids to α-keto acids, is as follows:

[0136] The whole-cell L-amino acid deaminase obtained in Example 3 was used to catalyze the deamination of L-alanine, L-threonine, phenylalanine, and cysteine ​​to generate the corresponding keto acids. The enzyme reaction system was prepared as follows: 20 mM of amino acid (the amino acid is L-alanine, L-threonine, phenylalanine, or cysteine) substrate was dissolved in 0.02 M Na2HPO4-NaH2PO4 buffer at pH 7.0. A final concentration of 5 g / L of wet whole-cell catalyst was added. The reaction was carried out at 37 °C and 220 r / min on a shaker for 12 hours. After removing the reaction solution, the enzyme was inactivated by heating at high temperature for 10 min. The reaction solution was centrifuged at 10000 r / min for 15 min. After centrifugation, the supernatant was retained and the precipitate was discarded.

[0137] Conversion rates were determined using UV-Vis liquid chromatography under the following conditions: a Crownpak CR-I chiral column in reverse mode; a mobile phase of perchloric acid aqueous solution (pH 1-2) and acetonitrile (80%:20% by volume); a flow rate of 0.2 mL / min; and a column temperature of 25 °C. The conversion rates were as follows: L-alanine 30.2%; L-threonine 34.5%; phenylalanine 48.7%; and cysteine ​​27.3%.

[0138] The above description is merely an example and illustration of the structure of the present invention. Those skilled in the art can make various modifications or additions to the specific embodiments described, or use similar methods to replace them, as long as they do not deviate from the structure of the present invention or exceed the scope defined in the claims, all of which should fall within the protection scope of the present invention.

Claims

1. A method for preparing α-keto acid, characterized in that: Specifically, the following steps are included: Using amino acids as substrates, the substrates were dissolved in Na2HPO4-NaH2PO4 buffer solution, and L-amino acid deaminase was added as a whole-cell catalyst from Escherichia coli to carry out the reaction. After removing the reaction solution, the enzyme was inactivated, and then centrifuged. After centrifugation, the supernatant reaction solution was retained and the precipitate was discarded. The supernatant reaction solution is α-ketopentanediamine. The amino acid is vortex glutamine, the concentration of the amino acid is 20~60 mmol / L, the pH of the Na2HPO4-NaH2PO4 buffer solution is 6.0~8.0, the concentration is 0.01~0.05 mol / L, and the reaction temperature is 25~45℃. The L-amino acid deaminase Escherichia coli whole-cell catalyst is the whole cell of recombinant L-amino acid deaminase Escherichia coli genetically engineered bacteria; The recombinant L-amino acid deaminase-producing Escherichia coli genetically engineered strain is obtained by recombinantly transforming the L-amino acid deaminase gene from Proteus mirabilis into competent Escherichia coli cells BL21(DE3) / pET20b-PM473 using pET-20b as a vector and using the gene as a template. The gene sequence of PM473 is shown in Seq_1.

2. The method for preparing an α-keto acid according to claim 1, characterized in that: The reaction time is 10-14 hours, and the reaction is carried out on a shaker at 200-250 r / min; Enzyme inactivation is achieved by high-temperature heating at 100°C for 10-15 minutes. The centrifugation temperature is 4~30℃, the rotation speed is 8000~10000r / min, and the time is 10~15min.

Images