Chilling-tolerance major gene in rice seedling stage and its encoding protein and application
By cloning and expressing the major cold-resistant gene RGA4L in rice seedlings, the problem of insufficient cold resistance in rice seedlings has been solved, achieving high survival rate and improved cold resistance of rice under low-temperature conditions, which has important breeding application prospects.
Patent Information
- Application Number
- CN202211486858.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-25
- Publication Date
- 2026-06-19
- Estimated Expiration
- 2042-11-25
AI Technical Summary
Existing technologies are insufficient to effectively improve the cold tolerance of rice seedlings, leading to impaired rice growth under low-temperature conditions, which affects yield and agricultural production stability.
We cloned and utilized the major cold-resistant gene RGA4L in rice seedlings and its encoded protein to enhance the cold resistance of rice through transgenic and overexpression methods, and then used molecular marker-assisted selection technology for breeding.
It significantly improved the survival rate and cold resistance of rice under low temperature conditions, provided a basis for the breeding of cold-resistant rice varieties, and enhanced the stability of agricultural production and food security.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, and specifically relates to a major gene for cold tolerance in rice seedlings, its encoded protein, and its application. Background Technology
[0002] In agricultural production, abiotic stress mainly refers to the damage caused to crops during cultivation by various abnormal climatic factors (such as drought, low temperature, and high temperature) and pests and diseases. Among these, low temperature is one of the major abiotic stresses that seriously affects crop growth and yield.
[0003] Rice is a warm-season crop, with an optimal growth temperature range of 15-33℃. Japonica rice suffers chilling injury when the ambient temperature drops below 15℃, while indica rice experiences chilling injury as early as 18℃. Major rice-producing areas in my country frequently experience chilling injury during the rice growing season. For example, in Northeast China, chilling injury occurs on average every 3-4 years. In the middle and lower reaches of the Yangtze River and southern rice-growing areas, early rice encountering a "late spring frost" can cause seedling rot, while late rice encountering a "cold dew wind" can lead to delayed heading. The severe low-temperature and snow disaster that struck southern my country in early 2008 caused significant damage to hybrid rice seed lines already planted in South China.
[0004] To address the adverse effects of low temperatures on rice cultivation, in addition to general agricultural measures, breeding cold-resistant rice varieties is one of the most economical and effective means of eliminating the harm caused by low temperatures. Cloning rice cold-resistance regulatory QTLs / genes, understanding the molecular mechanisms of cold-resistance regulation, and mastering the application techniques of cold-resistance regulatory genes are the foundation for breeding cold-resistant rice varieties and are of great significance for improving the low-temperature resistance of rice varieties and ensuring my country's food security. Summary of the Invention
[0005] The purpose of this invention is to develop a major gene for controlling cold tolerance in rice seedlings, its encoded protein, and its application.
[0006] This invention provides a major gene for controlling cold tolerance in rice seedlings. RGA4L It originates from common cultivated rice (Oryza spp.) O.sativa Its nucleotide sequence is:
[0007] 1) The nucleotide sequence shown in SEQ ID No: 1; or
[0008] 2) A nucleotide sequence encoding the same function as 1) formed by the substitution, deletion, or addition of one or more nucleotides of the nucleotide sequence shown in SEQ ID No: 1; or
[0009] 3) A DNA sequence that is ≥90% homology (preferably ≥95%, more preferably ≥98%) to the nucleotide sequence shown in SEQ ID No: 1, generated by a variation of 1) and capable of encoding a protein with the same function as 1).
[0010] This invention also provides a major gene for controlling cold tolerance in rice seedlings. RGA4L cold-sensitive allele rga4l It originates from common cultivated rice (Oryza spp.) O.sativa The nucleotide sequence is as follows:
[0011] 1) The nucleotide sequence shown in SEQ ID No: 2; or
[0012] 2) A nucleotide sequence encoding a protein with the same function as 1) generated by the mutation shown in SEQ ID No: 2, formed by substitution, deletion, or addition of one or more nucleotides; or
[0013] 3) A nucleotide sequence that is ≥90% homology (preferably ≥95%, more preferably ≥98%) to the nucleotide sequence shown in SEQ ID No: 2, generated by the variation of 1) and capable of encoding a protein with the same function as 1).
[0014] The major gene for controlling cold tolerance in rice seedlings in this invention RGA4L and the cold-sensitive alleles generated by their effector variants rga4l :
[0015] (1) The cold-sensitive allele shown in SEQ ID No: 2 is generated by the deletion of 34 bp upstream of the stop codon TGA in the gene sequence shown in SEQ ID No: 1;
[0016] (2) The nucleotide sequence shown in SEQ ID No: 2 is obtained by forming an early stop codon TAA at the end of the nucleotide sequence shown in SEQ ID No: 1 by the nucleotide sequence missing in (1);
[0017] (3) The alleles shown in (2) cause rice to exhibit a cold-sensitive phenotype.
[0018] This invention also provides a major gene for cold tolerance in rice seedlings. RGA4L The biomaterials are expression vectors, cells, or engineered bacteria.
[0019] When constructing a plant expression vector for the gene provided by this invention, any type of enhancing, constitutive, tissue-specific, or inducible promoter can be added before its transcription initiation nucleotide, such as the cauliflower mosaic virus (CAMV) 35S promoter, the ubiquitin gene Ubiquitin promoter (pUbi), etc. They can be used alone or in combination with other plant promoters.
[0020] This invention provides a major gene for controlling cold tolerance in rice seedlings. RGA4L Or the application of biomaterials containing it in improving the cold resistance of rice.
[0021] In the above application, the gene shown in SEQ ID No: 1 was introduced into cold-sensitive indica rice varieties through a hybridization backcross method to improve the cold resistance of the indica rice varieties.
[0022] This invention provides a major gene for controlling cold tolerance in rice seedlings. RGA4L Or the application of biological materials containing it in the cultivation of cold-resistant rice.
[0023] In the above applications, the gene shown in SEQ ID No: 1 was overexpressed in cold-sensitive indica rice varieties, and cold-resistant transgenic indica rice varieties were obtained through screening.
[0024] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as antibiotic resistance markers (gentamicin markers, kanamycin markers, etc.) or chemical reagent resistance marker genes (such as herbicide resistance genes).
[0025] This invention provides a method for improving the cold tolerance of rice by using transgenic, hybridization, backcrossing, self-pollination, or asexual reproduction methods to induce the expression or overexpression of a major cold tolerance gene in rice. RGA4L, The nucleotide sequence is shown in SEQ ID No:1.
[0026] Specifically, the methods mentioned above for improving the cold tolerance of rice will include controlling the major genes responsible for cold tolerance during the rice seedling stage. RGA4L The plant expression vectors are used to transform rice cells or tissues through methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electrocoagulation, and Agrobacterium-mediated transformation, and the transformed rice cells or tissues are then cultured into plants.
[0027] A major gene controlling cold tolerance in rice seedlings RGA4LThe molecular marker method uses a specific PCR primer pair QS, with the forward primer sequence being: actgctgttacttcgtgtat and the reverse primer sequence being: agatagatatatccccaagg. This method amplifies the gene DNA of materials containing cold-resistant and cold-sensitive varieties. The amplified band with a molecular weight of 176 bp indicates the cold-resistant variety, and the amplified band with a molecular weight of 142 bp indicates the cold-sensitive variety.
[0028] Compared with existing technologies, the present invention has the following advantages:
[0029] The major gene for controlling cold tolerance in rice seedlings in this invention RGA4L After the expression of the gene was reduced in rice, the T3 transgenic plants showed a significant decrease in cold tolerance and became cold-sensitive; the gene was expressed or overexpressed. RGA4L Rice varieties with this gene exhibit high survival rates at low temperatures and demonstrate cold tolerance. Research on the molecular mechanism regulating cold tolerance in rice seedlings has significant theoretical and practical implications for the breeding of new cold-tolerant rice varieties. It also has broad application potential and market prospects in the agricultural field. Attached Figure Description
[0030] Figure 1 The cold-sensitive chromosome segment replacement line SN143 was obtained through screening in Example 1 of this invention.
[0031] Figure 2 In the two parent lines of Embodiment 1 of the present invention RGA4L Different variation sites in the genome.
[0032] Figure 3 This is for screening important exchange individuals in Embodiment 1 of the present invention.
[0033] Figure 4 In this invention RGA4L The gene encodes an R protein.
[0034] Figure 5 In Embodiment 2 of the present invention RGA4L Results of cold tolerance assessment of transgenic seedlings.
[0035] Figure 6 In Embodiment 4 of the present invention RGA4L Cold-resistant phenotype of near-isogenic lines after introduction of indica rice varieties. Detailed Implementation
[0036] The specific embodiments of the present invention will be described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments.
[0037] Example 1: Controlling the major gene for cold tolerance in rice seedlings RGA4L Get
[0038] The cold-resistant rice variety "Koshihikari" (japonica rice) Rice L. Japonica group) is the recurrent parent, and the cold-sensitive variety "Nona Bokra" (indica rice) is also a parent. Rice A chromosome segment replacement line was constructed using *L. indica* group as the donor parent. Through cold-resistance phenotype identification and effect evaluation of the chromosome segment replacement line population, a cold-sensitive chromosome segment replacement line SN143 was obtained (see...). Figure 1 By constructing a localization population and designing and developing molecular markers, molecular marker genotyping was performed on 6813 BC3F2 individuals to identify important exchangers within the localization region. Combined with the cold-tolerance phenotype data of these important exchangers, the final [analysis / analysis] was conducted. RGA4L The gene was located within a 12 kp region between two markers, W4 and W9 (designed by the inventors, see Table 1). Based on the Rice Reference Genome Annotation (MSU v7.0), the coding region and structure of the gene were predicted within the located region, revealing that only one gene coding region existed within this area. Genomic DNA was extracted from both parents using the CTAB method, and primers were designed to amplify the gene (see L251-S12G primers in Table 2).
[0039] Table 1 is used for RGA4L Location of INDEL and CAPS markers (primers)
[0040]
[0041] To obtain the cDNA sequence of the gene coding region, leaves from two parental plants that had undergone low-temperature treatment were collected. Total RNA was extracted from the samples using an RNA extraction kit (#74104, QIAGEN, Germany). The RNA was then reverse transcribed into cDNA using a HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) (R312, Novizan, China). To determine... RGA4L The 5' and 3' end sequences of the transcribed mRNA were subjected to 5'- and 3' RACE experiments (#634858, Clontech, TAKARA, JP) to ultimately determine the coding region (CDS) of the RGA4L gene. In the parental 'Koshihikari', the coding region of this gene is 4338 bp long (see SEQ ID No: 1); in the parental 'Nona Bokra', a 34 bp deletion occurred at nucleotide position 4297 of the gene's genomic sequence, resulting in the introduction of an early stop codon at the end of the coding sequence of this gene in that parental parent (see...). Figure 2Therefore, its coding region length is 4329 bp (see SEQ ID No: 2); in addition, there are 18 SNP sites at other locations on both. During fine mapping, we screened an important exchange individual, in which recombination events allowed us to determine that the 34 bp deletion is the functional effector variant site for the differential cold tolerance phenotype (see...). Figure 3 ).
[0042] Table 2 Primers used for sequencing and expression vector construction
[0043]
[0044] Example 2: Functional verification of the rice seedling cold tolerance gene RGA4L
[0045] 1. Validation of cold-resistant phenotypes of different alleles
[0046] To further verify RGA4L The relationship between genes and cold tolerance phenotypes in rice seedlings was investigated. Genomic DNA was extracted from 137 rice varieties (rice variety information is shown in Table 4). Genotyping (NonaBokra and Koshihikari types) was performed on these materials using the molecular marker QS (see Table 1). Specific genotyping methods are described in Example 3. Simultaneously, cold tolerance phenotypes in seedlings were identified for these rice varieties. The results showed that most indica rice varieties belonged to the NonaBokra type (73.53%), while most japonica rice varieties belonged to the Koshihikari type (>80%). Association analysis revealed that most NonaBokra type rice varieties exhibited a cold-sensitive phenotype, while most Koshihikari type rice varieties exhibited a cold-tolerant phenotype (see Table 3). Rice seeds listed in Table 4 were obtained from the National Germplasm Resource Bank.
[0047] Table 3 RGA4L Identification of cold-resistant phenotypes of different alleles
[0048]
[0049] 2. RGA4L Verification of transgenic function of genes
[0050] Using RNAi interference and overexpression methods to RGA4L To verify gene function, RNAi interference plasmids were transformed into the japonica rice varieties Nipponbare and Koshihikari; overexpression plasmids were transformed into the near-isogenic line NIL of Nipponbare, which incorporated the NonaBokra allele. rga4l -NIP (Cold Sensitive).
[0051] (1) Construction of RNAi vector
[0052] Amplification of the target gene using PCR method RGA4L The coding region was amplified starting at nucleotide 2313 of the 5' ATG in the PCR primers, and restriction endonuclease sites were introduced into the PCR primers. Specifically, using japonica rice *Viburnum kojima* cDNA as a template and L253-S12RNAi as primers (see Table 2), PCR amplification was performed, yielding a fragment of approximately 557 bp. Sequencing confirmed that the fragment contained nucleotides 2313-2877 bp of SEQ ID No:1 in the sequence listing. A portion of the PCR product was digested with BamHI and Kpn I, and the digested fragment was recovered and designated as the BK fragment; the other portion was digested with Spe I and Sac I, and the digested fragment was recovered and designated as the SS fragment.
[0053] The RNAi empty vector pTCK303, approximately 14621 bp in length, was first ligated into the RNAi empty vector pTCK303 after digestion with BamHI and KpnI at 16℃ using T4 ligase. After confirming successful ligation, the plasmid was extracted, and the product of double digestion with SpeI and SacI was ligated with the SS fragment. After further digestion to confirm successful ligation, the RNAi vector was obtained and named pRGA4L-RNAi.
[0054] (2) RGA4L Construction of overexpression plasmids
[0055] Amplification of the target gene using PCR method RGA4L The coding region fragment was extracted, and restriction endonuclease sites were introduced into the PCR primers. Specifically, using japonica rice *Viburnum kojima* cDNA as a template and KRGA4LORF as primers (see Table 2), PCR amplification was performed, yielding a fragment of approximately 4338 bp. Sequencing confirmed the correctness of the amplified fragment. A portion of the PCR product was digested with BamHI and SalI, and the digested fragments were recovered. The recovered fragments were ligated into the empty vector pCAMBIA1301-3×myc, which had been digested with BamHI and SalI. After confirming successful ligation, the plasmid was extracted to obtain the overexpression vector, named pRGA4L-OE.
[0056] (3) Utilizing Agrobacterium ( Agrobacterium tumefaciens The plasmid was transformed into transgenic recipient materials Nipponbare, Koshihikari, and NIL using the metamorphic method. rga4l)-NIP. Callus tissue co-cultured with Agrobacterium was cultured in NB basal medium (N6 macro-, B5 iron salt, B5 micro-, B5 organic, 300 mg / L acid-hydrolyzed casein, 500 mg / L glutamine, 500 mg / L proline, 30 g / L sucrose, 3 g / L plant gel) containing 2 mg / L 2,4-D, and cultured in the dark at 25-28℃ for one week to allow for growth recovery. Then, it was transferred to NB selection medium (NB basal medium + 50 mg / L hygromycin + 2 mg / L 2,4-D) and cultured in the dark at 25-28℃ for approximately 30 days. Resistant callus was selected and cultured in NB selection medium for another 30 days (dark culture at 25-28℃). The resistant callus was then transferred to predifferentiation medium (NB basal medium + 50 mg / L hygromycin + 5 mg / L ABA + 2 mg / L NAA + 1 mg / L... The plants were cultured with 6-BA for about 20 days (at 25-28℃ light conditions); then, they were cultured and differentiated in differentiation medium (NB basal medium + 50 mg / L hygromycin + 1 mg / L NAA + 2 mg / L 6-BA) (at 25-28℃ light conditions); finally, they were transferred to 1 / 2 MS rooting medium containing 50 mg / L hygromycin (1 / 2 MS basal medium + 100 mg / L inositol + 0.5 mg / L NAA + 0.25 mg / L paclobutrazol + 50 mg / L hygromycin) and cultured for 30-40 days (at 25-28℃ light conditions), and then transplanted into soil to obtain transgenic plants.
[0057] (4) The obtained transgenic plants were verified by PCR amplification of the hygromycin resistance gene fragment. The detection primers are as follows:
[0058] HYG_F:5′-TACTTCTACACAGCCATC-3′
[0059] HYG_R:5′-CGTCTGTCGAGAAGTTTC-3′
[0060] The results showed that both RNAi interference and overexpression transformation yielded positive transgenic plants (20 plants each).
[0061] (5) The T3 generation transgenic pure lines were identified by cold-resistant phenotype, and the results are shown in [see attached table]. Figure 5 RNAi interference line (Ri-1 (NIP)) had a significantly lower survival rate than the control Nipponbare (NIP) under cold treatment conditions; while in the near-isogenic line NIL (Ri-1 (NIP)...) rga4l Overexpression (OE1 and OE2) or complementary expression (Com1 and Com2) in )-NIP RGA4L The survival rate of the gene under low-temperature treatment conditions (8 / 6℃) (day / night) was significantly higher than that of the control NIL. rga4l)-NIP. The above results indicate that a major gene for cold tolerance in rice seedlings has been cloned and expressed or overexpressed. RGA4L The genetically modified rice is cold-resistant and has a high survival rate at low temperatures.
[0062] Example 3 RGA4L Molecular marker-assisted selection
[0063] The major cold-resistant gene for rice seedlings provided by this invention RGA4L A 34 bp deletion-effect variant was found between the alleles of the two parents (Koshihikari and Nona Bokra), and the association between two variant types and cold tolerance was found in the identification of 137 rice varieties containing indica and japonica subspecies. This indicates that this deletion can be used as an important molecular marker (see QS markers in Table 1) for molecular-assisted selection breeding of rice cold tolerance. The specific method is as follows:
[0064] (1) Genomic DNA was extracted from leaves of the cold-resistant rice variety Koshihikari and the cold-sensitive variety Nona Bokra. RGA4L QS-marked amplification primers were designed within the gene coding region. The primer sequences are shown in Table 1.
[0065] (2) PCR amplification was performed using primers. The amplified products were detected by 2.5% agarose gel electrophoresis, revealing DNA polymorphism between the amplified bands of cold-resistant and cold-sensitive varieties. The molecular weight of the amplified band from the cold-resistant variety was approximately 176 bp (Yueguang type), while that from the cold-sensitive variety was approximately 142 bp (Nona Bokra type). Therefore, this marker can serve as a specific molecular marker for identifying the strength of cold tolerance in rice. In the hybrid offspring population of cold-resistant and cold-sensitive varieties, this molecular marker can rapidly identify individuals carrying the cold-resistant gene. This molecular marker can be used as an important molecular marker in cold-resistant breeding applications.
[0066] Example 4 RGA4L Molecular breeding
[0067] In this invention, we will RGA4L Genes were applied to molecular breeding. We crossed high-quality indica rice varieties Huanghuazhan, Nanjing 11, and 556 with Yueguang to obtain F1. The F1 plants were then backcrossed three times with these indica rice varieties to obtain the BC3F2 population. Molecular marker-assisted selection was then used to identify homozygous individuals containing... RGA4L Plants with the desired genetic traits, and after multiple generations of self-pollination to obtain a stable BC3F8 generation line, are known as the new cultivar line NIL. RGA4L )-HHZ, NIL( RGA4L )-NJ11 and NIL( RGA4L )-556.
[0068] The results were obtained through cold-resistant phenotype identification. Figure 6 As shown in the figure. It can be seen from the figure that, compared with their respective control parents, the new strain NIL ( RGA4L )-HHZ, NIL( RGA4L )-NJ11 and NIL( RGA4L The cold resistance of the )-556 strain was significantly improved. Under low-temperature treatment conditions (10 / 8℃) (day / night), the control parents all showed cold sensitivity and died; while the introduced strains... RGA4L The new strain exhibits a cold-resistant phenotype and has a 100% survival rate. RGA4L Genes have promising applications in resistance breeding.
[0069]
[0070]
[0071]
[0072]
[0073] The foregoing description of specific exemplary embodiments of the invention is for illustrative and explanatory purposes. These descriptions are not intended to limit the invention to the precise forms disclosed, and it will be apparent that many changes and variations can be made in accordance with the foregoing teachings. The exemplary embodiments were chosen and described in order to explain the specific principles of the invention and its practical application, thereby enabling those skilled in the art to implement and utilize various different exemplary embodiments of the invention, as well as various different choices and variations. The scope of the invention is intended to be defined by the claims and their equivalents.
Claims
1. Controlling the major genes for cold tolerance in rice seedlings RGA4L Its application in improving the cold resistance of rice is characterized by, The major effect gene RGA4L The nucleotide sequence is shown in SEQ ID No:
1.
2. Controlling the major genes for cold tolerance in rice seedlings RGA4L or RGA4L The application of the encoded protein in breeding cold-resistant rice varieties is characterized by, The major effect gene RGA4L The nucleotide sequence is shown in SEQ ID No:
1.
3. A method for improving the cold resistance of rice, characterized in that, Rice can be induced to express or overexpress major cold-resistance genes through transgenic, hybrid, backcross, self-pollination, or asexual reproduction methods. RGA4L, The cold-resistant main effect gene RGA4L The nucleotide sequence is shown in SEQ ID No:
1.
4. The method for improving the cold resistance of rice according to claim 3, characterized in that, It will contain the main gene controlling cold tolerance in rice seedlings. RGA4L The plant expression vectors are used to transform rice cells or tissues using Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electrocoagulation, or Agrobacterium-mediated transformation, and the transformed rice cells or tissues are then cultured into plants.
5. A major gene controlling cold tolerance in rice seedlings RGA4L The molecular labeling method is characterized by, The major effect gene RGA4L The nucleotide sequence is shown in SEQ ID No:
1. Using a specific PCR primer pair QS, the forward primer sequence is: actgctgttacttcgtgtat, and the reverse primer sequence is: agatagatatatccccaagg. Gene DNA containing cold-resistant and cold-sensitive varieties was amplified. The amplified band with a molecular weight of 176 bp indicates the cold-resistant variety, and the amplified band with a molecular weight of 142 bp indicates the cold-sensitive variety.