Application of the β subunit of SnRK1 in rice resistance to Magnaporthe oryzae and Xanthomonas oryzae pv. oryzae
Through the knockout and overexpression of SnRK1β1A, SnRK1β1B and SnRK1β1C genes in rice, it was found that the important role of these genes in plant disease resistance was solved, and the shortcomings of the effect on these genes in the prior art were solved, and a one-time improvement in the disease resistance of rice was achieved.
Patent Information
- Application Number
- CN202310112719.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-02-14
- Publication Date
- 2025-06-10
- Estimated Expiration
- 2043-02-14
AI Technical Summary
The lack of research on the effects of SnRK1β subunits in rice blast and white leaf blight in the prior art has led to insufficient application in plant disease resistance.
The SnRK1β1A, SnRK1β1B and SnRK1β1C genes in rice were knocked out by CRISPR-Cas9 technology. It was found that the β subunit showed an opposite regulatory mechanism to the α subunit, and the susceptibility of rice was enhanced by overexpressing the SnRK1β1A protein.
Mutants deleting SnRK1β1A, SnRK1β1B and SnRK1β1C genes showed increased resistance to rice blast and leucorrhea, while overexpression of SnRK1β1A enhanced the perceptibility of rice, indicating the potential application value of the SnRK1β subunit in plant disease resistance.
Smart Images

Figure BDA0004077445060000131 
Figure BDA0004077445060000141 
Figure BDA0004077445060000171
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of plant genetic engineering and relates to the β subunit protein of SnRK1 related to plant disease resistance, its coding gene and applications. Background Art
[0002] SNF1-related protein kinase 1 (SnRK1) is homologous to yeast SNF1 and mammalian AMPK and belongs to the serine-threonine kinase family. SnRK1 acts as a cellular energy sensor, inducing catabolic reactions and inhibiting energy-consuming anabolic processes when energy supply becomes limited. Plant SnRK1 is a heterotrimeric complex, including the catalytic α subunits (SnRK1α1, SnRK1α2 and SnRK1α3), the regulatory β subunits (SnRK1β1, SnRK1β2 and SnRK1β3) and the βγ (SnRK1βγ) subunit.
[0003] The α catalytic subunits of SnRK1 have been widely reported to be involved in the plant immune process. Overexpression of SnRK1α1 and SnRK1α2 enhances the resistance of rice to Magnaporthe oryzae, while the RNAi lines of SnRK1α1 and SnRK1α2 show increased susceptibility to Magnaporthe oryzae.
[0004] Overexpression of SnRK1α in barley enhances the resistance of barley to Blumeria graminis, and this enhanced resistance depends on the kinase activity and nuclear localization of SnRK1α. Similarly, overexpression of SnRK1α also enhances the resistance of wheat to Fusarium graminearum, but the susceptibility of SnRK1α RNAi wheat lines to Fusarium graminearum is enhanced. The above shows that the α catalytic subunits of SnRK1 play a positive regulatory role in defending against the infection of multiple pathogens.
[0005] The β subunit can inhibit the regulation of target genes by the α subunit and is caused by changing the nucleocytoplasmic shuttle of the α subunit. However, there is no report on the role of the β subunit in rice resistance to Magnaporthe oryzae and Xanthomonas oryzae pv. oryzae. Summary of the Invention
[0006] To solve the above technical problems, the present invention first provides a class of susceptibility genes involved in plant disease resistance. The susceptibility genes involved in plant disease resistance provided by the present invention, namely the β subunits of SnRK1 related to plant disease resistance, are named SnRK1β1A, SnRK1β1B, and SnRK1β1C respectively. The present invention uses the CRISPR-Cas9 technology to knockout three SnRK1β subunits (SnRK1β1A, SnRK1β1B, and SnRK1β1C), and finds that the β subunits show a regulatory mechanism opposite to that of the α subunits. The mutants snrk1β1a, snrk1β1b, and snrk1β1c lacking the three β subunits all show enhanced resistance to Magnaporthe oryzae and Xanthomonas oryzae pv. oryzae, while the susceptibility of rice increases after overexpression of SnRK1β1A. In addition, the agronomic traits of the snrk1β1a mutant have no obvious change, indicating that the SnRK1β subunit has good application prospects in breeding.
[0007] The β subunit protein of SnRK1 related to plant disease resistance is a protein of any one of the following a), b), c), or d):
[0008] a) A protein with an amino acid sequence shown in SEQ ID NO: 2, 4, or 6;
[0009] b) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO: 2, 4, or 6;
[0010] c) A protein with the same function obtained by substituting and / or deleting and / or adding one or several amino acid residues to the amino acid sequence shown in SEQ ID NO: 2, 4, or 6;
[0011] d) A protein with 75% or more homology to the amino acid sequence shown in SEQ ID NO: 2, 4, or 6 and having the same function.
[0012] In order to facilitate the purification of the protein in a), a fusion protein can also be obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO: 2, 4, or 6; the tag can be tags such as Poly-Arg (RRRRR), Poly-His (HHHHHH), FLAG (DYKDDDDK), Strep-tag II (WSHPQFEK), c-myc (EQKLISEEDL), etc.
[0013] The β-subunit protein of SnRK1 related to plant disease resistance in a)-d) above is generally derived from rice in nature. That is, generally speaking, it is a natural product, and it can also be artificially expressed or synthesized. It can also be synthesized first and then biotically expressed after synthesizing its coding gene. The coding genes of the proteins in b)-d) above can be obtained by deleting the codons of one or several amino acid residues in the DNA sequences shown in Sequence 1, 3 or 5 in the sequence listing, and / or performing missense mutations of one or several nucleotide pairs, and / or connecting the coding sequences of the above tags at its 5'-end and / or 3'-end. Among them, Sequence 2 (SnRK1β1A) in the sequence listing consists of 290 amino acid residues. Sequence 4 (SnRK1β1B) in the sequence listing consists of 316 amino acid residues. Sequence 6 (SnRK1β1C) in the sequence listing consists of 295 amino acid residues.
[0014] To solve the above technical problems, the present invention also provides biological materials related to the β-subunit protein of SnRK1 related to plant disease resistance
[0015] The biological materials related to the β-subunit protein of SnRK1 related to plant disease resistance provided by the present invention are any one of the following A1) to A13):
[0016] A1) A nucleic acid molecule encoding the protein recited in claim 1;
[0017] A2) An expression cassette containing the nucleic acid molecule described in A1);
[0018] A3) A recombinant vector containing the nucleic acid molecule described in A1);
[0019] A4) A recombinant vector containing the expression cassette described in A2);
[0020] A5) A recombinant microorganism containing the nucleic acid molecule described in A1);
[0021] A6) A recombinant microorganism containing the expression cassette described in A2);
[0022] A7) A recombinant microorganism containing the recombinant vector described in A3);
[0023] A8) A recombinant microorganism containing the recombinant vector described in A4);
[0024] A9) A transgenic plant cell line containing the nucleic acid molecule described in A1);
[0025] A10) A transgenic plant cell line containing the expression cassette described in A2);
[0026] A11) A transgenic plant cell line containing the recombinant vector described in A3);
[0027] A12) A transgenic plant cell line containing the recombinant vector described in A4);
[0028] A13) An RNA molecule transcribed from the nucleic acid molecule described in A1); or a nucleic acid molecule that interferes with the translation of the RNA molecule.
[0029] Wherein, the nucleic acid molecule described in A1) is a gene shown in any of the following 1), 2), or 3):
[0030] 1) Its coding sequence is the nucleic acid molecule shown in Sequence 1, 3, 5, or 7;
[0031] 2) A cDNA molecule or genomic DNA molecule of the β subunit protein of SnRK1 that has 75% or more identity with the nucleotide sequence defined in 1) and is related to plant disease resistance;
[0032] 3) A cDNA molecule or genomic DNA molecule of the β subunit protein of SnRK1 that hybridizes with the nucleotide sequence defined in 1) or 2) under stringent conditions and is related to plant disease resistance.
[0033] Sequence 1 in the sequence listing consists of 873 nucleotides. The nucleotides from the 1st to the 873rd at the 5' end of Sequence 1 are the coding sequence, encoding the protein (SnRK1β1A) shown in Sequence 2 in the sequence listing; Sequence 3 in the sequence listing consists of 951 nucleotides. The nucleotides from the 1st to the 951st at the 5' end of Sequence 3 are the coding sequence, encoding the protein (SnRK1β1B) shown in Sequence 4 in the sequence listing; Sequence 5 in the sequence listing consists of 888 nucleotides. The nucleotides from the 1st to the 888th at the 5' end of Sequence 5 are the coding sequence, encoding the protein (SnRK1β1C) shown in Sequence 6 in the sequence listing. Sequence 7 in the sequence listing consists of 951 nucleotides. The nucleotides from the 1st to the 951st at the 5' end of the sequence are the coding sequence, encoding the protein (3×HA - SnRK1β1A) shown in Sequence 8 in the sequence listing, with a 3 - tandem HA tag sequence at the N - terminal and the protein sequence of SnRK1β1A at the C - terminal.
[0034] Those of ordinary skill in the art can easily mutate the nucleotide sequences encoding SnRK1β1A, SnRK1β1B, or SnRK1β1C of the present invention using known methods, such as directed evolution and point mutation methods. Those artificially modified nucleotides that have 75% or higher identity with the nucleotide sequences of SnRK1β1A, SnRK1β1B, or SnRK1β1C isolated from the present invention, as long as they encode SnRK1β1A, SnRK1β1B, or SnRK1β1C and have the same function, are derived from the nucleotide sequences of the present invention and are equivalent to the sequences of the present invention.
[0035] As used herein, the term "identity" refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences having 75% or higher, or 85% or higher, or 90% or higher, or 95% or higher identity to the nucleotide sequence of the protein consisting of the amino acid sequence shown in Coding Sequence 2 of the present invention. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.
[0036] The above-mentioned identity of 75% or more can be 80%, 85%, 90% or 95% or more identity.
[0037] Among the above biological materials, the expression cassette containing the nucleic acid molecule encoding SnRK1β1A, SnRK1β1B or SnRK1β1C (SnRK1β1A, SnRK1β1B or SnRK1β1C gene expression cassette) described in A2) refers to DNA that can express SnRK1β1A, SnRK1β1B or SnRK1β1C in a host cell. This DNA may not only include a promoter that initiates the transcription of SnRK1β1A, SnRK1β1B or SnRK1β1C, but also include a terminator that terminates the transcription of SnRK1β1A, SnRK1β1B or SnRK1β1C. Further, the expression cassette may also include an enhancer sequence. Promoters that can be used in the present invention include, but are not limited to: constitutive promoters; tissue-, organ- and development-specific promoters and inducible promoters. Suitable transcription terminators include, but are not limited to: Agrobacterium nopaline synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator, and nopaline and octopine synthase terminator.
[0038] The plant recombinant expression vector can be constructed using existing plant expression vectors. The plant expression vectors include binary Agrobacterium vectors and vectors suitable for microprojectile bombardment, such as pGreen0029, pCAMBIA3301, pCAMBIA1300, pCAMBIA1301, pBI121, pBin19, pCAMBIA2301, pCG1301 or other derivative plant expression vectors. The plant expression vector may also contain the 3'-untranslated region of the foreign gene, i.e., it contains a polyadenylation signal and any other DNA fragments involved in mRNA processing or gene expression. The polyadenylation signal can direct the addition of polyadenylic acid to the 3'-end of the mRNA precursor. When using the gene to construct a recombinant expression vector, any one of enhancer-type, constitutive, tissue-specific or inducible promoters can be added before the transcription start nucleotide, such as the cauliflower mosaic virus (CaMV) 35S promoter, the ubiquitin gene Ubiquitin promoter (pUbi), the stress-inducible promoter Rd29A, etc. They can be used alone or in combination with other plant promoters; in addition, when using the gene of the present invention to construct a recombinant expression vector, enhancers can also be used, including translation enhancers or transcription enhancers. These enhancer regions can be the ATG start or the start codon in the adjacent region, etc., but must be in the same reading frame as the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signal and the start codon are extensive and can be natural or synthetic. The translation initiation region can be from the transcription initiation region or the structural gene. To facilitate the identification and screening of transgenic plant cells or plants, the used plant expression vector can be processed, such as adding a gene encoding an enzyme or a luminescent compound that can produce a color change and can be expressed in plants, a resistant antibiotic marker, or an anti-chemical reagent marker gene, etc. It is also possible not to add any selectable marker gene and directly screen the transformed plants by adversity, etc.
[0039] In the present invention, the promoter that initiates the transcription of the coding genes SnRK1β1A, SnRK1β1B or SnRK1β1C in the recombinant expression vector can be the ubiquitin promoter, the 35S promoter or the Actin1 promoter. In the present invention, the promoter that specifically initiates the transcription of the coding gene SnRK1β1A is the ubiquitin promoter.
[0040] Among the above biological materials, the vector can be a plasmid, cosmid, phage or viral vector. In the present invention, the recombinant vector is specifically the vector obtained by inserting the ubiquitin promoter and the SnRK1β1A, SnRK1β1B or SnRK1β1C gene between the Sac I and Mlu I restriction enzyme cleavage sites of the pCAMBIA1301 vector.
[0041] Among the above biological materials, the microorganism can be yeast, bacteria, algae or fungi, such as Agrobacterium. In the present invention, the Agrobacterium used is specifically EHA105.
[0042] Among the above biological materials, none of the transgenic plant cell lines include propagation materials.
[0043] The present invention also provides the application of the related biological materials in regulating plant disease resistance;
[0044] The present invention also provides the application of the related biological materials in cultivating transgenic plants with improved disease resistance;
[0045] The present invention also provides the application of the related biological materials in plant breeding.
[0046] In the above application, the regulation of plant disease resistance is to improve or inhibit plant disease resistance.
[0047] The disease resistance is the disease resistance to rice blast and / or rice bacterial blight.
[0048] Furthermore, the present invention also provides a method for cultivating transgenic plants with improved disease resistance, including the step of reducing the expression level and / or activity of the protein in the recipient plant to obtain a transgenic plant; the disease resistance of the transgenic plant is higher than that of the recipient plant.
[0049] The method for reducing the expression level and / or activity of the protein in the recipient plant is to inhibit the activity of the protein in the genome of the recipient plant or inactivate it;
[0050] Or, the method for inhibiting the activity of the protein in the genome of the recipient plant or inactivating it includes: interfering with the expression of the protein in the genome of the recipient plant by RNAi technology; or mutating the coding gene of the protein in the genome of the recipient plant to reduce the expression level of the coding gene of the protein in the genome of the recipient plant or causing a deletion mutation or an insertion mutation in the coding gene of the protein in the genome of the recipient plant;
[0051] Or, the mutation method is CRISPR / Cas9 or TELLEN technology or T-DNA insertion or EMS mutagenesis;
[0052] Or, the nucleotide sequence of the coding gene of the protein is the DNA molecule shown in Sequence 1, 3, 5 or 7.
[0053] The recipient plant is a monocotyledonous plant or a dicotyledonous plant.
[0054] In the above applications or methods, the transgenic plants are understood to include not only the first-generation transgenic plants obtained by transforming the receptor plants with the SnRK1β1A, SnRK1β1B or SnRK1β1C gene, but also their progeny. For transgenic plants, the gene can be propagated in this species, or transferred into other varieties of the same species, especially commercial varieties, using conventional breeding techniques. The transgenic plants include seeds, callus, whole plants and cells.
[0055] In the above applications or methods, the receptor plant is a monocotyledonous plant or a dicotyledonous plant; the monocotyledonous plant can be rice, corn, wheat, etc. In the present invention, the plant is a monocotyledonous plant, and the monocotyledonous plant is rice, and the specific rice variety can be ZH11.
[0056] In the present invention, three SnRK1β subunits were knocked out in wild-type rice ZH11 by CRISPR-Cas9 technology, and two homozygous mutant plants were obtained respectively. The knockout of the SnRK1β subunit enhanced the resistance to rice blast and bacterial blight. After treatment with pathogen-associated molecular pattern (Chitin), it led to the up-regulated expression of pathogenesis-related proteins, the accumulation of ROS levels, and the activation of the MAPK pathway. In addition, the deletion of the SnRK1β1A gene did not affect the main agronomic traits of rice, indicating that the SnRK1β gene has good application potential in enhancing crop disease resistance. The present invention uses genetic engineering means to regulate the expression level of the SnRK1β gene for molecular breeding, and has potential application value in improving crop disease resistance. Brief Description of the Drawings
[0057] Figure 1 . Phylogenetic analysis of SnRK1β subunits (OsSnRK1β1A, OsSnRK1β1B, OsSnRK1β1C and OsSnRK1β3) in rice and SnRK1β subunits (AtSnRK1β1, AtSnRK1β2 and AtSnRK1β3) in Arabidopsis thaliana;
[0058] Figure 2 . Expression patterns of SnRK1β1A, SnRK1β1B and SnRK1β1C during the infection period of Magnaporthe oryzae and CRSPR-Cas9 target sequences and mutation types. a is the expression profiles of SnRK1β1A, SnRK1β1B and SnRK1β1C at each time point after Magnaporthe oryzae P131 infects rice Nipponbare (Nip); b is the schematic diagram of the SnRK1β1A knockout mutant; c is the schematic diagram of the SnRK1β1B knockout mutant; d is the schematic diagram of the SnRK1β1C knockout mutant;
[0059] Figure 3. The snrk1β1a, snrk1β1b, and snrk1β1c mutants show enhanced resistance to Magnaporthe oryzae and Xanthomonas oryzae pv. oryzae. a shows the inoculation of Magnaporthe oryzae RB22 by scratching on the wild-type ZH11 and the snrk1β1a mutant; b shows the detection of the biomass of Magnaporthe oryzae in the leaves in a; c shows the inoculation of Magnaporthe oryzae RB22 by scratching on the wild-type ZH11 and the snrk1β1b mutant; d shows the detection of the biomass of Magnaporthe oryzae in the leaves in c; e shows the inoculation of Magnaporthe oryzae RB22 by scratching on the wild-type ZH11 and the snrk1β1c mutant; f shows the detection of the biomass of Magnaporthe oryzae in the leaves in e; g shows the investigation of the incidence of Magnaporthe oryzae in the field (Beijing) for the wild-type ZH11 and the snrk1β1a mutant; h shows the statistical analysis of the disease index in the field for ZH11 and snrk1β1a. (**: P<0.01, Student's t-test)
[0060] Figure 4 . The snrk1β1a, snrk1β1b, and snrk1β1c mutants show enhanced resistance to Xanthomonas oryzae pv. oryzae. a shows the disease incidence results after inoculating the wild-type ZH11 and the snrk1β1a mutant with Xanthomonas oryzae pv. oryzae PXO99; b shows the statistical analysis of the lesion length in the leaves in a; c shows the statistical analysis of the bacterial biomass titer in the leaves in a. d shows the disease incidence results after inoculating the wild-type ZH11 and the snrk1β1b mutant with Xanthomonas oryzae pv. oryzae PXO99; e shows the statistical analysis of the lesion length in the leaves in d; f shows the statistical analysis of the bacterial biomass titer in the leaves in d. g shows the disease incidence results after inoculating the wild-type ZH11 and the snrk1β1c mutant with Xanthomonas oryzae pv. oryzae PXO99; h shows the statistical analysis of the lesion length in the leaves in g; i shows the statistical analysis of the bacterial biomass titer in the leaves in g. (**: P<0.01, Student's t-test)
[0061] Figure 5 . Chitin treatment results in ROS accumulation, MAPK pathway activation, and upregulated expression of PR genes in snrk1β1. a shows the detection of ROS accumulation in the wild-type ZH11 and the snrk1β1a mutant after chitin and water treatment; b shows the detection of ROS accumulation in the wild-type ZH11 and the snrk1β1b mutant after chitin and water treatment; c shows the detection of ROS accumulation in the wild-type ZH11 and the snrk1β1c mutant after chitin and water treatment; d shows the detection of MAPK kinase phosphorylation in the wild-type ZH11 and the snrk1β1a mutant after chitin treatment; e shows the detection of the transcriptional level of PR genes in the wild-type ZH11 and the snrk1β1a mutant after chitin treatment.
[0062] Figure 6. Overexpression of SnRK1β1A enhances susceptibility to Magnaporthe oryzae. a shows the detection of the transcriptional level of SnRK1β1A in plants overexpressing SnRK1β1A; b shows the detection of the protein level of SnRK1β1A in plants overexpressing SnRK1β1A; c shows the inoculation of Magnaporthe oryzae RB22 by scratching on wild-type ZH11 and SnRK1β1A OE plants; d shows the detection of the biomass of Magnaporthe oryzae in the leaves in c. (**: P<0.01, Student's t-test)
[0063] Figure 7 . The agronomic traits of the snrk1β1a mutant do not show obvious changes compared with those of the wild-type ZH11. a shows the plant appearance of wild-type ZH11 and snrk1β1a; b shows the plant height statistics of wild-type ZH11 and snrk1β1a; c shows the tiller number statistics of wild-type ZH11 and snrk1β1a; d shows the 1000-grain weight statistics of wild-type ZH11 and snrk1β1a; e shows the appearance of mature rice panicles of wild-type ZH11 and snrk1β1a; f shows the statistics of the number of branchlets per panicle of wild-type ZH11 and snrk1β1a; g shows the statistics of the number of grains per panicle of wild-type ZH11 and snrk1β1a; h shows the statistics of the number of shriveled grains per panicle of wild-type ZH11 and snrk1β1a. Detailed implementation manners
[0064] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods.
[0065] Unless otherwise specified, the materials, reagents, etc. used in the following examples can all be obtained from commercial channels.
[0066] The Magnaporthe oryzae race RB22 and the rice variety ZH11 in the following examples are recorded in the literature "Hao et al., A VQ-motif-containing protein fine-tunes rice immunity and growth by a hierarchical regulatory mechanism. Cell Rep. 2022 Aug 16; 40(7): 111235. doi: 10.1016 / j.celrep.2022.111235. PMID: 35977497.", and the public can obtain them from China Agricultural University.
[0067] The rice bacterial blight strain PXO99 in the following examples is described in the literature "Guo Sibin, Zhang Duanpin, Lin Xinghua. Identification and preliminary mapping of a new gene resistant to bacterial blight in Oryza minuta [J]. Scientia Agricultura Sinica, 2010, 43(13): 2611-2618. DOI: 10.3864 / j.issn.0578-1752.2010.13.001.", and the public can obtain it from China Agricultural University.
[0068] Example 1. Obtaining of snrk1β1a, snrk1β1b and snrk1β1c mutants and identification of their disease-resistant phenotypes
[0069] 1. Obtaining of rice SnRK1β1A, SnRK1β1B and SnRK1β1C proteins and their encoding genes
[0070] 1.1 Identification of SnRK1β1A, SnRK1β1B and SnRK1β1C genes
[0071] By aligning the gene sequences of the Arabidopsis SnRK1β subunit through NCBI BLAST (http: / / blast.ncbi.nlm.nih.gov / ), 4 homologous genes of AtSnRK1β in rice were obtained, and their gene IDs are LOC_Os05g41220 (SNF1-related protein kinase regulatory subunit beta-1), LOC_Os07g48790 (SNF1-related protein kinase regulatory subunit beta-1), LOC_Os03g20340 (SNF1-related protein kinase regulatory subunit beta-1) and LOC_Os09g20010 (SNF1-related protein kinase regulatory subunit beta-2). Through the Figure 1 phylogenetic relationship and protein structure analysis as shown, they were named SnRK1β1A (LOC_Os05g41220), SnRK1β1B (LOC_Os07g48790) and SnRK1β1C (LOC_Os03g20340) and SnRK1β3 (LOC_Os09g20010) respectively.
[0072] 1.2 Obtaining of SnRK1β1A, SnRK1β1B and SnRK1β1C mutants
[0073] The coding sequences and protein sequences of SnRK1β1A, SnRK1β1B, and SnRK1β1C were obtained from the Rice Genome Annotation Project database (http: / / rice.uga.edu / ).
[0074] The coding sequence of SnRK1β1A is shown as Sequence 1 in the sequence listing, as follows:
[0075] atggggaacg cgagcggcaaggaaggggaggagaacggccacgtggcggcgggggccgcc 60
[0076] gccggagtggctggctcggcgggggcagcggcccgggctccgccgccgcttatgccgccg 120
[0077] gacgccgtgatgcgggagctgcctcccccggtgccctacgtcttcacgccgcaggttcca 180
[0078] gtagccccactgcatatacctactgaattttctcctgttttcaacaattcatggataaat 240
[0079] gaatcggatgaatccaccaataaccatccccaggagaagggaattccaactttgatctca 300
[0080] tggagtcaaggaggaaatgaggtgtttgtggaaggatcatgggataactggacatcaagg 360
[0081] agggtgttagagaagtctgggaaagaccataccatattgctagttctgccatcaggggta 420
[0082] taccattacaggatcatcgtcgatggggaaccgaaatatgtccctgaactacctcatgtg 480
[0083] gctgatgagggagggcaggttgccaacctcctcgatgtccatgattatatcccagaaagc 540
[0084] ctgggcagcgtggcaggattcgactctcctccgtcgcctgaacacagctatgatctccag 600
[0085] ctcccaggtgatgaggagtttgccaaggagccacctatactgccacctcagcttgtaatg 660
[0086] tctgttcttggtgatactgataactctgaagaacaaactctgaagccaaagcatgttgtc 720
[0087] ctcaaccacctgtatatcgagaaaggatggggatcgcagtcgctgcttgctcttggagtc 780
[0088] actcaccggtttcaatccaagtatgtaagcttcgtgctgtacaagccgctgcgaaggtca 840
[0089] tccacggcgaagcgaacaaagaatggtggttaa 873
[0090] The protein sequence of SnRK1β1A is shown in Sequence 2 of the Sequence Listing, as follows:
[0091] MGNASGKEGE ENGHVAAGAA AGVAGSAGAA ARAPPPLMPP DAVMRELPPP VPYVFTPQVP 60
[0092] VAPLHIPTEF SPVFNNSWIN ESDESTNNHP QEKGIPTLIS WSQGGNEVFV EGSWDNWTSR 120
[0093] RVLEKSGKDH TILLVLPSGV YHYRIIVDGE PKYVPELPHV ADEGGQVANL LDVHDYIPES 180
[0094] LGSVAGFDSP PSPEHSYDLQ LPGDEEFAKE PPILPPQLVM SVLGDTDNSE EQTLKPKHVV 240
[0095] LNHLYIEKGW GSQSLLALGV THRFQSKYVS FVLYKPLRRS STAKRTKNGG 290
[0096] The coding sequence of SnRK1β1B is as shown in Sequence 3 in the Sequence Listing, specifically as follows:
[0097] atgggcaacgcgagcggcaggctggacgacatcgccgacgccgaaatggatgacggcggc 60
[0098] ggaggcggcaaccgcgccggcgctggggactactcctcctcgctgcgccccatggaccgt 120
[0099] gctggcctcccgccgtacggcggcgccgggggaagcggcggactggtgcggcccccgtcg 180
[0100] tcggcagcggggtactccggcggcggagggtcgtcgtccccgccggggacccccccgcgg 240
[0101] ccgcactccccgcgcatgttcgtgccgcagagtcctgtaactccattgcatagagctgta 300
[0102] gatggacctcctccagtatttaaccagatattaacgagtgaacaagaggaggatcacgat 360
[0103] ggtccccctgacaagctgattcctactctgcttgtgtggactcttggagggaagaatgtc 420
[0104] tatatagaaggatcatgggataactggaaatcaaagcaactcgtccataaatgtggaaag 480
[0105] gatcactgcgtcatgttagggcttgcatctggagtttaccgttatagattcattgttgat 540
[0106] ggagaaagaagatttcagcctgatcgtccccgtgaagctgacattatgggcaccatttca 600
[0107] aatcttattgatgttcatgattatgtcccggatagcgtggacagtgtgtcagagctgatg 660
[0108] gctcctccatcgccggactccagctacggtttcctggctcctgacgacaaggagttcacc 720
[0109] aaggagcctcccgctctgccgccgcagctccacctgggcgtgctcaactcgcgaggaggc 780
[0110] tccggcgggaaggagggagagtgcgccatgcccaagcacaacgtcctcggccatgtcttc 840
[0111] atcggcaagggcaccccacccatggtcgctgccctcggcaccaccttcaggttccagtcc 900
[0112] aagtttgtcaccaaagtcctctacaaggccatccaaagagaggacagata g 951
[0113] The protein sequence of SnRK1β1B is shown in Sequence 4 of the Sequence Listing, specifically as follows:
[0114] MGNASGRLDD IADAEMDDGG GGGNRAGAGD YSSSLRPMDR AGLPPYGGAG GSGGLVRPPS 60
[0115] SAAGYSGGGG SSSPPGTPPR PHSPRMFVPQ SPVTPLHRAV DGPPPVFNQI LTSEQEEDHD 120
[0116] GPPDKLIPTL LVWTLGGKNV YIEGSWDNWK SKQLVHKCGK DHCVMLGLAS GVYRYRFIVD 180
[0117] GERRFQPDRP READIMGTIS NLIDVHDYVP DSVDSVSELM APPSPDSSYG FLAPDDKEFT 240
[0118] KEPPALPPQL HLGVLNSRGG SGGKEGECAM PKHNVLGHVF IGKGTPPMVA ALGTTFRFQS 300
[0119] KFVTKVLYKA IQREDR 316
[0120] The coding sequence of SnRK1β1C is as shown in Sequence 5 in the Sequence Listing, specifically as follows:
[0121] atggggaacgcgagcgggcgggaggaggaccccgcggcggcggccggggagggggacgtc 60
[0122] gaggactcgtcggtccggtcctcggagcgcggcttcccgccgtacggcggagggggcaac 120
[0123] cacgtgcggcgcgcgtgctcggtgggcgtcgtcgggggcggcgggggcgccggatcgccg 180
[0124] cccgggagccccggccgctccctctcgccgcggatgttcgtgccccagacacctgtgcct 240
[0125] ccactccaaagagcagctgatgtaactccagtgttcaaccggatcttaatgaatgaacaa 300
[0126] gaagaggaatttgatggcccccctcaaaaggaaattcctgtcttgatcgtgtggacgctt 360
[0127] ggaggaaaaaatgtatctgttgaaggatcctgggataactggaaatcaaggaaacccatg 420
[0128] cagaaatctgggaaagatcattcgctcctgttgatacttccatcgggagtttatcgttac 480
[0129] agatttgttgtagatggagaaaggaaatgtcttcctgatcttccttgtgaaactgatatc 540
[0130] atgggcaacgctgttaaccttcttgatgttcatgattttgtccctgaaagtgttgagagt 600
[0131] gtggcagaatttgagcctcccccatccccagattctagctacagtatccaggcacccgag 660
[0132] gaaaaggatttctcaaaagagccaccggttcttccatcccaactccatctgggtgttctc 720
[0133] aactcacagaactctgatgaaagttgtgcacggccccagcacatagtcctcaaccacctc 780
[0134] ttcatcgagaaaggctggggtgcccatccgctggtggcccttggtctaacccacaggttt 840
[0135] gagtccaaatatgtaaccgtcgtcctgtataagcccattgaacgatag 888
[0136] The protein sequence of SnRK1β1C is as shown in Sequence 6 in the Sequence Listing, specifically as follows:
[0137] MGNASGREED PAAAAGEGDV EDSSVRSSER GFPPYGGGGN HVRRACSVGV VGGGGGAGSP 60
[0138] PGSPGRSLSP RMFVPQTPVP PLQRAADVTP VFNRILMNEQ EEEFDGPPQK EIPVLIVWTL 120
[0139] GGKNVSVEGS WDNWKSRKPM QKSGKDHSLL LILPSGVYRY RFVVDGERKC LPDLPCETDI 180
[0140] MGNAVNLLDV HDFVPESVES VAEFEPPPSP DSSYSIQAPE EKDFSKEPPV LPSQLHLGVL 240
[0141] NSQNSDESCA RPQHIVLNHL FIEKGWGAHP LVALGLTHRF ESKYVTVVLY KPIER 295
[0142] The coding sequence of 2×HA-SnRK1β1A is as shown in Sequence 7 in the Sequence Listing, specifically as follows:
[0143] atgtacccatacgatgttcctgactatgcgtacccatacgatgttcctgactatgcgtac 60
[0144] ccatacgatgttcctgactatgcggggaacgcgagcggcaaggaaggggaggagaacggc 120
[0145] cacgtggcggcgggggccgccgccggagtggctggctcggcgggggcagcggcccgggct 180
[0146] ccgccgccgcttatgccgccggacgccgtgatgcgggagctgcctcccccggtgccctac 240
[0147] gtcttcacgccgcaggttccagtagccccactgcatatacctactgaattttctcctgtt 300
[0148] ttcaacaattcatggataaatgaatcggatgaatccaccaataaccatccccaggagaag 360
[0149] ggaattccaactttgatctcatggagtcaaggaggaaatgaggtgtttgtggaaggatca 420
[0150] tgggataactggacatcaaggagggtgttagagaagtctgggaaagaccataccatattg 480
[0151] ctagttctgccatcaggggtataccattacaggatcatcgtcgatggggaaccgaaatat 540
[0152] gtccctgaactacctcatgtggctgatgagggagggcaggttgccaacctcctcgatgtc 600
[0153] catgattatatcccagaaagcctgggcagcgtggcaggattcgactctcctccgtcgcct 660
[0154] gaacacagctatgatctccagctcccaggtgatgaggagtttgccaaggagccacctata 720
[0155] ctgccacctcagcttgtaatgtctgttcttggtgatactgataactctgaagaacaaact 780
[0156] ctgaagccaaagcatgttgtcctcaaccacctgtatatcgagaaaggatggggatcgcag 840
[0157] tcgctgcttgctcttggagtcactcaccggtttcaatccaagtatgtaagcttcgtgctg 900
[0158] tacaagccgctgcgaaggtcatccacggcgaagcgaacaaagaatggtgg t 951
[0159] The protein sequence of 2×HA-SnRK1β1A is shown in Sequence 8 of the Sequence Listing, specifically as follows:
[0160] MYPYDVPDYA YPYDVPDYAY PYDVPDYAGN ASGKEGEENG HVAAGAAAGV AGSAGAAARA 60
[0161] PPPLMPPDAV MRELPPPVPY VFTPQVPVAP LHIPTEFSPV FNNSWINESD ESTNNHPQEK 120
[0162] GIPTLISWSQ GGNEVFVEGS WDNWTSRRVL EKSGKDHTIL LVLPSGVYHY RIIVDGEPKY 180
[0163] VPELPHVADE GGQVANLLDV HDYIPESLGS VAGFDSPPSP EHSYDLQLPG DEEFAKEPP I240
[0164] LPPQLVMSVL GDTDNSEEQT LKPKHVVLNH LYIEKGWGSQ SLLALGVTHR FQSKYVSFVL 300
[0165] YKPLRRSSTA KRTKNGG 317
[0166] Using the CRISPR-Cas9 technology, SnRK1β1A, SnRK1β1B, and SnRK1β1C were knocked out. First, appropriate sgRNA sequences were designed after the ATG in the gene coding region, and the sequences are shown in Table 1:
[0167] Table 1. sgRNA sequences for gene knockout
[0168]
[0169] The sgRNA sequences of the three genes were respectively constructed into the vector. First, Oligo dimers were prepared according to the target sequences of SnRK1β1A, SnRK1β1B, and SnRK1β1C (the OligoUP / LW sequences are shown in Table 1). Add 18 μL of Anneal Buffer, 1 μL of β1A / β1B / β1C-UP (10 μmol / L), and 1 μL of β1A / β1B / β1C-LW (10 μmol / L). First, denature at 95 °C for 3 min, and then slowly cool to 20 °C at about 0.2 °C / s for annealing. The above Oligo dimers were cloned into the CRISPR / Cas vector pBGK032 (Weimi Biotechnology (Jiangsu) Co., Ltd.), that is, add 2 μL of pBGK032 (BsaI-digested linearized vector), 1 μL of Enzyme Mix, 1 μL of Oligo dimer, and ddH 2 O 6 μL, and react at 23 °C for 1 h. Take 5 μL of the above reaction solution, add 20 μL of DH5α competent cells, and transfer them into DH5α by heat shock at 42 °C. The transformants verified by PCR were again verified by sequencing by Tsingke Biotechnology (Beijing) Co., Ltd.
[0170] The constructed CRISPR / Cas vector was introduced into the embryogenic calli of rice variety ZH11 through Agrobacterium tumefaciens EHA105 (Prutin Biotechnology (Beijing) Co., Ltd.). For the specific transformation method, please refer to the literature "Yi Zili, Cao Shouyun, Wang Li, Chu Chengcai, Li Xiang, He Sijie, Tang Zuoshun, Zhou Puhua, Tian Wenzhong, Study on Improving the Transformation Frequency of Agrobacterium tumefaciens-mediated Rice Transformation, Acta Genetica Sinica, 2001, 28(4): 352-358".
[0171] The neomycin phosphotransferase gene (HPTII) fragment in transgenic T0 rice was detected using primers 5’-GCTGCGCCGATGGTTTCTACAA-3’ and 5’-CACGGCCTCCAGAAG AAGATGTTG-3’. PCR amplification products with a 514bp fragment were transgenic positive plants, and all the obtained lines were positive transformation lines.
[0172] DNA was extracted from positive T0 seedlings, and specific primers were designed to amplify the fragment containing the sgRNA target sequence to detect the gene mutation types of SnRK1β1A, SnRK1β1B, and SnRK1β1C.
[0173] Genomic DNA was extracted from T0 seedlings, and PCR amplification was performed separately using the check primers in Table 2. The amplified fragments were sequenced. According to the sequencing results comparison, as shown in Table 2 and Figure 2 as indicated, there were two different types of mutations in the target sequences of SnRK1β1A, SnRK1β1B, and SnRK1β1C. According to the sequencing results, we obtained 2 homozygous mutant lines (Table 2), namely the snrk1β1a mutants snrk1β1a-2 and snrk1β1a-4, the snrk1β1b mutants snrk1β1b-15 and snrk1β1b-19, and the snrk1β1c mutants snrk1β1c-7 and snrk1β1c-12( Figure 2 in b, c, and d).
[0174] Table 2. Mutation types of snrk1β1a, snrk1β1b, and snrk1β1c
[0175]
[0176] 2. Disease resistance phenotype determination of snrk1β1a, snrk1β1b, and snrk1β1c mutants
[0177] 2.1 Blast resistance phenotype determination of snrk1β1a, snrk1β1b, and snrk1β1c mutants
[0178] The wild-type ZH11, snrk1β1a, snrk1β1b, and snrk1β1c mutants were planted in the greenhouse. The leaves of rice at the five-leaf and one-heart stage were scratched and inoculated with the rice blast fungus strain RB22. Photos were taken 4 days after inoculation. The lesion areas of the snrk1β1a, snrk1β1b, and snrk1β1c mutants were all smaller than that of the wild-type ZH11( Figure 3 in a, c, and e). The genomic DNA of the leaves in Figure 3 a, c, and e was extracted respectively, and the expression level of the rice blast fungus gene MoPot2 was used to indicate the biomass of the rice blast fungus in the inoculated leaves. Specifically, the transcriptional level of MoPot2 was detected by fluorescence quantitative PCR method, with the rice gene OsUBQ as the internal reference. The experiment was set with three replicates. Data processing was performed using the comparative Ct method, that is, the Ct value is the number of cycles experienced when the fluorescence signal in the PCR tube reaches the set threshold, ΔCt = Ct(MoPot2) - Ct(OsUBQ), and the 2 -ΔCt value was used to measure the gene transcriptional level. The expression level of the rice blast fungus gene MoPot2 also showed that the relative biomass of the rice blast fungus in the diseased leaves of the snrk1β1a, snrk1β1b, and snrk1β1c mutants was significantly lower than that of the wild-type ZH11( Figure 3 in b, d, and f), indicating that the resistance of the snrk1β1a, snrk1β1b, and snrk1β1c mutants to the rice blast fungus was enhanced.
[0179] In addition, the rice blast fungus disease was investigated in the field using a 9-grade classification method for ZH11 and snrk1β1a. The results showed that the disease index of ZH11 was significantly higher than that of snrk1β1a( Figure 3 in g and h).
[0180] 2.2 Determination of the phenotypes of snrk1β1a, snrk1β1b, and snrk1β1c mutants resistant to bacterial blight
[0181] The wild-type ZH11, snrk1β1a, snrk1β1b, and snrk1β1c mutants were planted in the greenhouse. The leaves of rice growing for about 2 months were inoculated with the bacterial blight pathogen PXO99. After 2 weeks of inoculation, the results were as Figure 4 shown. The lesion lengths and biomass of the mutants snrk1β1a, snrk1β1b, and snrk1β1c were significantly smaller than those of the wild-type ZH11, indicating that the resistance of the snrk1β1a, snrk1β1b, and snrk1β1c mutants to the bacterial blight pathogen was significantly enhanced.
[0182] Example 2. PTI response of snrk1β1a, snrk1β1b, and snrk1β1c mutants after chitin treatment
[0183] The obtained snrk1β1a, snrk1β1b, and snrk1β1c mutants of the present invention showed ROS accumulation, activation of the MAPK pathway, and up-regulated expression of pathogenesis-related genes after treatment with the pathogen-associated molecular pattern Chitin, indicating that SnRK1β1A, SnRK1β1B, and SnRK1β1C negatively regulate the PTI response.
[0184] 1. ROS accumulation in snrk1β1a, snrk1β1b, and snrk1β1c mutants after Chitin treatment
[0185] The wild-type ZH11, snrk1β1a, snrk1β1b, and snrk1β1c mutants were planted in the greenhouse. The rice leaves at the five-leaf and one-heart stage were punched with a 4-mm diameter puncher, and the punched leaves were soaked in sterilized ddH 2 O and left to stand overnight in the dark. A reaction solution of 0.0125 mg / ml Chitin, 0.05 mM luminol, and 25 μg / ml HRP was prepared (in the control, Chitin was replaced with ddH 2 O). First, 50 μl / well of ddH 2 O was added to a transparent Costar 96-well plate, and the overnight-soaked rice leaves were carefully transferred to each well. 50 μl / well of different reaction solutions were added, and at least 8 biological replicates were set for each treatment. The chemiluminescence was detected with a microplate reader at 450 nm. As Figure 5 shown in a, b, and c, the ROS accumulation levels in snrk1β1a, snrk1β1b, and snrk1β1c mutants were higher than those in ZH11 after Chitin treatment.
[0186] 2. The MAPK pathway was activated in snrk1β1a after Chitin treatment
[0187] The hulls of ZH11, snrk1β1a-2, and snrk1β1a-4 mutant seeds were removed, and after sterile disinfection, they were placed on 1 / 2 MS medium and grown aseptically for about 10 days. The ZH11, snrk1β1a-2, and snrk1β1a-4 seedlings with consistent growth were soaked in sterilized ddH 2Let it stand overnight in the dark in O. The next day, prepare a chitin reaction solution with a final concentration of 0.0125 mg / ml in a 90-mm plastic dish, and quickly place the ZH11, snrk1β1a-2, and snrk1β1a-4 seedlings into it. Samples are taken at 0 min, 15 min, 30 min, and 60 min, and immediately frozen in liquid nitrogen for later use. After all samples are taken, extract proteins for Western blot. Add an appropriate extraction buffer according to the weight of the seedlings, which contains 1 / 10 phosphatase inhibitor (PHOS-STOP), 1 / 1000 cocktail, and 1 / 100 PMSF. First, incubate with the primary antibody Phospho-p44 / p42 MAPK (Erk1 / 2) Antibody (9101, CST), 1:1000 (5% BSA), at 4 °C overnight. Then incubate with the secondary antibody Anti-rabbit IgG, HRP-linked Antibody (7074, CST), 1:2000 (5% skim milk) for 1 h. At 15 min and 30 min after chitin treatment, the phosphorylation levels of MPK6 and MPK3 in the snrk1β1a-2 and snrk1β1a-4 mutants were significantly higher than those in the wild type ZH11, indicating that the MAPK signaling pathway in the snrk1β1a-2 and snrk1β1a-4 mutants was activated after chitin treatment.
[0188] 3. Up-regulated expression of defense-related genes after chitin treatment of snrk1β1a
[0189] Extend the sampling of the chitin-treated seedlings in the above step 2 to 6 h, and extract the total RNA of the samples. Use fluorescence quantitative PCR to analyze the expression of defense-related genes PR1a, PR1b, PR4, PR5, PR5-1, PR10, WRKY53, and MAPK1 in the wild type ZH11, snrk1β1a-2, and snrk1β1a-4 mutants, with rice ACTIN1 gene as the internal reference. The primer sequences are shown in Table 3. The experiment is set with three replicates. Data processing uses the comparative Ct method, that is, the Ct value is the number of cycles experienced when the fluorescence signal in the PCR tube reaches the set threshold, ΔCt = Ct (test gene) - Ct (ACTIN1), and the 2 -ΔCt value is used to measure the gene transcription level, and comparative analysis is performed on the measured genes in ZH11, snrk1β1a-2, and snrk1β1a-4 mutants.
[0190] Table 3. Primer sequences of ACTIN1 and defense-related genes
[0191]
[0192]
[0193] The results are as Figure 5 shown in e, and the defense-related genes PR1a, PR1b, PR4, PR5, PR5-1, PR10, WRKY53, and MAPK1 detected were all significantly up-regulated.
[0194] Example 3. Determination of the blast resistance phenotype of SnRK1β1A overexpression lines
[0195] 1. Construction of the pCAMBIA1301-Ubi-3×HA-SnRK1β1A overexpression vector
[0196] 1.1 Obtaining the 3×HA-SnRK1β1A fusion sequence
[0197] The gene sequence involved in this example is shown as Sequence 7 (3×HA-SnRK1β1A fusion gene sequence) in the sequence listing, which consists of 921 nucleotides. The 3×HA-SnRK1β1A fusion sequence was obtained by PCR amplification (primers are SnRK1β1AOE-F:
[0198] 5’-ACGAGCTCTTAATTAAATGTACCCATACGATGTTCCTGACTATGCGTACCCATACGATGTTCCTGACTATGCGTACCCATACGATGTTCCTGACTATGCGGGGAACGCGAGCGGC-3’, SnRK1β1AOE-R: 5’-GGTGATCGGACGCGTACCACCATTCTTTGTTCG-3’, and the template is the cDNA of rice variety Nipponbare).
[0199] 1.2 Construction of the plant expression vector pCAMBIA1301-Ubi
[0200] Using the PCR method, with primers 5’-atagagctcGTGCAGCGTGACCCGGT-3’ (the underlined part is the SacI site) and 5’-ataggatccAAGTAACACCAAACAACAGGGT-3’ (the underlined part is the BamHI site), using the binary vector pUbiGUSPlus (Prutin Biotechnology (Beijing) Co., Ltd.) as a template, the ubiquitin promoter region was amplified. After recovering the amplified product, it was ligated to the pMD18-T simple (TaKaRa) vector and verified by sequencing. The plasmid with correct sequencing verification was double digested with SacI and BamHI, and after recovering the digestion products, they were ligated into the SacI and BamHI double digestion sites of the pCAMBIA1301 vector (Prutin Biotechnology (Beijing) Co., Ltd.) to obtain the plant expression vector pCAMBIA1301-Ubi.
[0201] 1.3 Construction of the overexpression vector pCAMBIA1301-Ubi-3×HA-SnRK1β1A
[0202] The plant expression vector pCAMBIA1301-Ubi was double digested with PacI and MluI. The digested pCAMBIA1301-Ubi and the 3×HA-SnRK1β1A fusion fragment were ligated using CE recombinant ligase (purchased from Nanjing Novozymes). The transformants were verified to be correct by PCR and sequencing, and thus the recombinant expression vector pCAMBIA1301-Ubi-3×HA-SnRK1β1A was obtained.
[0203] The recombinant expression vector pCAMBIA1301-Ubi-3×HA-SnRK1β1A is a vector obtained by inserting the ubiquitin promoter and the 3×HA-SnRK1β1A fusion gene between the PacI and MluI digestion sites of the pCAMBIA1301 vector. In the recombinant expression vector pCAMBIA1301-Ubi-3×HA-SnRK1β1A, the ubiquitin promoter drives the expression of the SnRK1β1A gene. During the construction of the recombinant expression vector pCAMBIA1301-Ubi-3×HA-SnRK1β1A, the 3×HA-SnRK1β1A gene shown in Sequence 7 of the sequence listing can also be artificially synthesized as a template.
[0204] 2. Obtaining and identification of the pCAMBIA1301-Ubi-3×HA-SnRK1β1A overexpression lines
[0205] 2.1 Obtaining of SnRK1β1A overexpressing rice
[0206] The recombinant expression vector pCAMBIA1301-Ubi-3×HA-SnRK1β1A constructed in Step 1 above was introduced into the embryogenic callus of rice variety ZH11 through Agrobacterium tumefaciens EHA105 (Prutin Biotechnology (Beijing) Co., Ltd.). For the specific transformation method, please refer to the literature "YI Zili, CAO Shouyun, WANG Li, CHU Chengcai, LI Xiang, HE Sijie, TANG Zuoshun, ZHOU Puhua, TIAN Wenzhong. Study on improving the transformation frequency of Agrobacterium tumefaciens-mediated rice transformation. Acta Genetica Sinica, 2001, 28(4): 352-358".
[0207] 2.2 Identification of SnRK1β1A overexpressing rice
[0208] The neomycin phosphotransferase gene (HPTII) fragment in transgenic T0 rice was detected using primers 5’-GCTGCGCCGATGGTTTCTACAA-3’ and 5’-CACGGCCTCCAGAAG AAGATGTTG-3’. The transgenic positive plants were those with a 514 bp PCR amplification product. All the obtained lines were positive lines. After the above PCR identification, two transgenic rice lines transformed with pCAMBIA1301-Ubi-3×HA-SnRK1β1A were respectively designated as the T0 generation SnRK1β1A overexpressing rice lines SnRK1β1A OE-3 and SnRK1β1A OE-6.
[0209] 2.3 Transcription level analysis of SnRK1β1A overexpressing rice
[0210] Then, a plant total RNA extraction kit (purchased from Beijing Zhuangmeng Biotechnology) was used to extract total RNA from the leaves of wild-type ZH11 and the SnRK1β1A overexpressing lines (SnRK1β1A OE). The extracted RNA was then reverse transcribed into cDNA using a reverse transcription kit (purchased from Nanjing Novoprotein), and the transcription level of SnRK1β1A was detected by fluorescence quantitative PCR. As shown in a of Figure 6 Figure, compared with wild-type rice ZH11, SnRK1β1A OE-3 and SnRK1β1A OE-6 were both upregulated by about 100-fold. At the same time, total proteins of ZH11, SnRK1β1A OE-3 and SnRK1β1A OE-6 were extracted, and the expression of 3×HA-SnRK1β1A was detected using an anti-HA antibody, indicating that the expression level of SnRK1β1A in SnRK1β1A OE-3 and SnRK1β1A OE-6 was much higher than that in ZH11 ( Figure 6 as shown in b of Figure).
[0211] 3. Determination of the blast resistance phenotype of pCAMBIA1301-Ubi-3×HA-SnRK1β1A
[0212] The T1 generation of SnRK1β1A OE-3 and SnRK1β1A OE-6 were planted in the greenhouse. The leaves of rice at the five-leaf and one-heart stage were scratched and inoculated with the Magnaporthe oryzae RB22 strain. Photos were taken 4 days after inoculation. The lesions of SnRK1β1A OE-3 and SnRK1β1A OE-6 were larger than those of the wild type ZH11. Figure 6 In c). The expression level of the Magnaporthe oryzae gene MoPot2 also showed that the biomass of Magnaporthe oryzae in the diseased leaves of SnRK1β1A OE-3 and SnRK1β1A OE-6 was significantly higher than that of the wild type ZH11. Figure 6 In d), it was shown that the resistance of SnRK1β1A OE-3 and SnRK1β1A OE-6 to Magnaporthe oryzae was weakened, and SnRK1β1A negatively regulated the resistance of rice to Magnaporthe oryzae.
[0213] 4. Determination of the main agronomic traits of the snrk1β1a mutant
[0214] The agronomic traits of the snrk1β1a mutant were detected. The results showed that there were no obvious changes in the main agronomic traits of the mutant snrk1β1a compared with the wild type ZH11. The results were as follows Figure 7 shown. Among them, a is the plant appearance of the wild type ZH11 and snrk1β1a; b is the plant height statistics of the wild type ZH11 and snrk1β1a; c is the tiller number statistics of the wild type ZH11 and snrk1β1a; d is the appearance of the mature rice panicles of the wild type ZH11 and snrk1β1a; e is the grain number per panicle statistics of the wild type ZH11 and snrk1β1a; f is the 1000-grain weight statistics of the grains of the wild type ZH11 and snrk1β1a.
Claims
1. Use of a method for inhibiting the activity of or inactivating the protein shown in SEQ ID NO: 2, 4 or 6 in the receptor rice genome or its coding gene in enhancing the disease resistance of rice; the disease resistance is the resistance to rice blast and / or bacterial blight of rice; The method for inhibiting the activity of or inactivating the protein shown in SEQ ID NO: 2, 4 or 6 in the receptor rice genome or its coding gene is to mutate the coding gene of the protein in the receptor rice genome to reduce the expression level of the coding gene of the protein in the receptor rice genome, and the mutation method is to knockout the coding gene by CRISPR / Cas9; the coding gene is the nucleic acid molecule shown in SEQ ID NO: 1, 3 or 5.
2. A method for cultivating transgenic rice with enhanced disease resistance, comprising the step of inhibiting the activity of the protein shown in SEQ ID NO: 2, 4 or 6 in the receptor rice genome or inactivating it to obtain transgenic rice; the disease resistance of the transgenic rice is higher than that of the receptor rice ; The method for inhibiting the activity of or inactivating the protein in the receptor rice genome includes: Mutating the coding gene of the protein in the receptor rice genome to reduce the expression level of the coding gene of the protein in the receptor rice genome; The mutation method is to knockout the coding gene of the protein by CRISPR / Cas9; the disease resistance is the resistance to rice blast and / or bacterial blight of rice; The nucleotide sequence of the coding gene of the protein is the DNA molecule shown in SEQ ID NO: 1, 3 or 5.