Specific SSR Molecular Markers in the Promoter Region of Rice Salt Tolerance Gene OsHAK21 and Their Application

Abstract

The present invention discloses a specific SSR molecular marker of the promoter region of the rice salt tolerance gene OsHAK21 and its application, belonging to the technical field of genetic engineering breeding. In order to quickly identify or assist in identifying the salt tolerance of rice, the present invention provides an SSR molecular marker specific to the promoter region of OsHAK21 or a substance for detecting the haplotype of the SSR molecular marker for assisting in identifying the salt tolerance of rice: the SSR molecular marker is a simple repeat sequence in the rice genome, located between 21066198-21066230bp on chromosome 3 of the rice reference genome (IRGSP-1.0), and its nucleotide sequence is (AGA) n , wherein 9≤n≤12, and n is a natural number. The molecular marker provided by the present invention can be used to quickly and accurately detect the haplotype of the rice OsHAK21 promoter region, which is conducive to the efficient application of the gene in molecular breeding of rice salt tolerance.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering breeding, and in particular relates to a specific SSR molecular marker of a promoter region of a rice salt-tolerant gene OsHAK21 and an application thereof. Background Art

[0002] Soil salinization is one of the main limiting factors for crop growth and production. There are about 100 million mu of saline-alkali arable land in my country, and the damage caused by salinity has caused a large reduction in crop yields. Rice is one of the main food crops in my country and is a salt-sensitive crop. It is most sensitive to salt stress during the seedling stage and heading and flowering stage. However, rice is considered to be the most suitable crop to be grown in saline-alkali soil, and the water environment in which it grows is conducive to the leaching of soil salt. Therefore, discovering rice salt-tolerance-related genes and developing molecular markers are the fastest and most cost-effective means to screen and identify rice salt-tolerant germplasm and accelerate the breeding of new salt-tolerant rice varieties. It is of great significance to food security.

[0003] The damage of salt stress to rice mainly comes from osmotic stress, membrane system peroxidation and ion toxicity. + and K + The dynamic balance of Na is an important way for rice to cope with salt stress, which is mainly achieved through the long-distance transport of ions in the xylem and phloem, and the accumulation and compartmentalization of ions. Ion transport proteins are important for rice to maintain Na under salt stress. + and K + OsHAK21 regulates rice's response to K + and Na + The absorption of ABA increased the biosynthesis of ABA and activated the ABA signaling response, regulating the salt tolerance of rice during the germination and seedling stages.

[0004] Rice salt tolerance is a quantitative trait regulated by multiple genes. Natural variation at multiple gene loci can lead to enhanced or weakened gene functions. Screening for excellent variations of rice salt tolerance-related genes and developing molecular markers can evaluate and screen rice salt-tolerant varieties with high throughput. However, the development and utilization of molecular markers for rice salt tolerance genes is far from enough. Summary of the invention

[0005] The technical problem to be solved by the present invention is: how to quickly identify or assist in identifying the salt tolerance of rice.

[0006] To solve the technical problem, in a first aspect, the present invention provides an application of an SSR molecular marker specific to the OsHAK21 promoter region or a substance for detecting the haplotype of the SSR molecular marker in any of the following:

[0007] A1) Identify or assist in identifying salt tolerance of rice;

[0008] A2) screening or assisting in screening rice plants, strains, lines or varieties with strong salt tolerance;

[0009] A3) Rice assisted breeding;

[0010] The SSR molecular marker is a simple repeat sequence in the rice genome, located between 21066198-21066230bp on chromosome 3 of the rice reference genome (IRGSP-1.0), and its nucleotide sequence is (AGA) n , wherein 9≤n≤12, n is a natural number; the OsHAK21 promoter region specific SSR molecular markers are divided into four haplotypes, namely Hap1 / Hap1, Hap2 / Hap2, Hap3 / Hap3 and Hap4 / Hap4;

[0011] The nucleotide sequence of Hap1 / Hap1, a specific SSR molecular marker of the OsHAK21 promoter region, is (AGA) 9 The nucleotide sequence of the Hap2 / Hap2 SSR molecular marker is (AGA) 10 The nucleotide sequence of Hap3 / Hap3 as the SSR molecular marker is (AGA) 11 The nucleotide sequence of the Hap4 / Hap4 SSR molecular marker is (AGA) 12 Homozygous type.

[0012] The OsHAK21 promoter region-specific SSR is located in the region from -1262 bp to -1229 bp upstream of the translation start site of the OsHAK21 gene.

[0013] Furthermore, in the application, the nucleotide sequence of the upstream sequence of the SSR molecular marker is SEQ ID No.3, and the nucleotide sequence of the downstream sequence is SEQ ID No.4.

[0014] Furthermore, in the application, the substance is any one of the following:

[0015] B1) the substance is a PCR primer composition for amplifying a rice genomic DNA fragment including the SSR molecular marker;

[0016] B2) a PCR reagent containing the PCR primer combination described in B1);

[0017] B3) A kit containing the PCR primer composition described in B1) or the PCR reagent described in B2).

[0018] Furthermore, in the application, the PCR primer composition includes: a single-stranded DNA whose nucleotide sequence is SEQ ID No.1, and a single-stranded DNA whose nucleotide sequence is SEQ ID No.2.

[0019] In the above application, the purpose of the breeding is to cultivate rice with strong salt tolerance.

[0020] In a second aspect, the present invention provides the PCR primer composition described in the above application.

[0021] In a third aspect, the present invention provides a kit containing the above-mentioned PCR primer composition.

[0022] In a fourth aspect, the present invention provides a method for identifying or assisting in identifying the salt tolerance trait of rice, the method comprising detecting the haplotype of the SSR molecular marker in the rice to be tested, and identifying or assisting in identifying the salt tolerance of the rice according to the haplotype, wherein the salt tolerance of the rice to be tested whose haplotype of the SSR molecular marker is Hap1 / Hap1 or Hap2 / Hap2 is higher than or has a candidate higher salt tolerance than the rice to be tested whose haplotype of the SSR molecular marker is Hap3 / Hap3 or Hap4 / Hap4.

[0023] Furthermore, in the method described above, the method for detecting the haplotype of the SSR molecular marker in the rice to be tested includes using the genomic DNA of the rice to be tested as a template, amplifying a PCR product using the PCR primer combination, and determining the haplotype according to the fragment size of the PCR product; the rice with a fragment size of 267 or 270 bp has a higher salt tolerance than or a candidate higher salt tolerance than the rice with a fragment size of 273 or 276 bp.

[0024] In a fifth aspect, the present invention provides a method for rice breeding, comprising selecting rice whose haplotype of the SSR molecular marker is Hap1 / Hap1 or Hap2 / Hap2 as a parent for breeding.

[0025] Furthermore, in the method, the method includes the following steps of detecting whether the haplotype of the SSR molecular marker in the rice to be tested is the Hap1 / Hap1 or the Hap2 / Hap2: using the genomic DNA of the rice to be identified as a template, amplifying using the PCR primer combination to obtain a PCR product, and determining the haplotype according to the fragment size of the PCR product, and the rice haplotype with a fragment size of 267 or 270 bp is the Hap1 / Hap1 or the Hap2 / Hap2, respectively.

[0026] Furthermore, the rice described in the present invention may be rice germplasm resources, varieties or strains.

[0027] In the above method, the purpose of rice breeding is to cultivate salt-tolerant rice varieties.

[0028] In the present invention, the salt tolerance of rice refers to the salt tolerance of rice seedlings. The evaluation method is based on the reported comprehensive evaluation D value (D ST ) and salt tolerance level (STS). ST The value represents the D value of comprehensive evaluation of salt tolerance of japonica rice germplasm resources at the seedling stage. Principal component analysis was performed using 10 morphological indices and 2 physiological indices related to salt tolerance, and the extracted 5 principal components were calculated using the membership function and standard deviation coefficient weighting method; the STS is the salt tolerance level at the seedling stage, which is an evaluation standard divided according to the green leaf area of ​​rice under salt stress.

[0029] The beneficial technical effects achieved by the present invention are as follows:

[0030] The specific SSR molecular markers of the promoter region of the rice salt tolerance gene OsHAK21 provided by the present invention can effectively identify four SSR locus haplotypes Hap1, Hap2, Hap3 and Hap4 in japonica rice germplasm resources, which are significantly associated with rice salt tolerance (STS). BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 This is an analysis of differential loci in the promoter region of OsHAK21 in four japonica rice germplasms.

[0032] Figure 2 This is a haplotype analysis of differential loci in the promoter region of OsHAK21 in 29 japonica rice germplasms.

[0033] Figure 3 Haplotype analysis of SSR loci in the promoter region of OsHAK21 in 162 japonica rice accessions was performed.

[0034] Figure 4 This is the peak diagram of SSR loci in the promoter region of OsHAK21 in 162 japonica rice germplasms detected by capillary electrophoresis. Figure 4 AD are the lengths of the amplified fragments of haplotypes Hap1 / Hap1, Hap2 / Hap2, Hap3 / Hap3 and Hap4 / Hap4, respectively. DETAILED DESCRIPTION

[0035] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0036] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0037] The rice germplasm involved in the following embodiments is preserved in this laboratory and disclosed in the document "Ma Shuaiguo, Tian Rongrong, Hu Hui, Lü Jiandong, Tian Lei, Luo Chengke, Zhang Yinxia, ​​Li Peifu. Comprehensive evaluation and screening of salt tolerance of japonica rice germplasm resources at the seedling stage. Journal of Plant Genetic Resources, 2020, 21(5): 1089-1101." The public can obtain the above-mentioned biological materials from the applicant. The obtained biological materials can only be used for experiments to verify the present invention and cannot be used for other purposes.

[0038] The quantitative tests in the following examples were repeated three times unless otherwise specified, and the results were averaged.

[0039] In the following implementation, the salt tolerance of rice was determined according to the following method: referring to the comprehensive evaluation of salt tolerance of 165 japonica rice germplasm resources at the seedling stage by Ma Shuaiguo et al. of the Crop Genetics and Breeding Laboratory of the College of Agriculture of Ningxia University [1] , based on the reported comprehensive evaluation D value (D ST ) and salt tolerance level (STS). The evaluation method of salt tolerance level (STS) can be found in Tian et al. [2] The identification is carried out according to the salt tolerance level at the seedling stage revised by the International Rice Research Institute's Standard Evaluation System (SES).

[0040] The following examples were processed using SPSS 19.0 statistical software. The experimental results were expressed as mean ± standard deviation and tested using One-way ANOVA. Different lowercase letters in the same column indicated significant differences (P < 0.05).

[0041] Example 1: Discovery of loci associated with salt tolerance in rice seedlings

[0042] The comprehensive evaluation of salt tolerance of 165 japonica rice germplasm resources at the seedling stage by Ma Shuaiguo et al. from the Crop Genetics and Breeding Laboratory of the College of Agriculture of Ningxia University was referred to. [1] , based on the reported comprehensive evaluation D value (D ST ) and the salt tolerance level (STS) reported by Wang Na et al. [3] Two salt-tolerant japonica rice germplasms (Huangluo and Bertone) and two salt-sensitive japonica rice germplasms (Sanfuya and Nipponbare) were selected as experimental materials (Table 1). [4] The full-length sequences were subjected to first-generation sequencing analysis, and the sequencing primers are shown in Table 2.

[0043] Table 1 Name, origin, salt tolerance type, and D of four japonica rice germplasms with different salt toleranceST Value and STS

[0044]

[0045] D ST Value: D value for comprehensive evaluation of salt tolerance of japonica rice germplasm resources at seedling stage [1] , principal component analysis was performed using 10 morphological indicators and 2 physiological indicators related to salt tolerance, and the extracted 5 principal components were calculated using the membership function and standard deviation coefficient weighting method; STS: salt tolerance level at seedling stage [2] , based on the evaluation criteria for green leaf area division under salt stress of rice.

[0046] Table 2 Sequencing primers for rice seedling salt tolerance gene OsHAK21

[0047]

[0048] The sequencing results showed that there was one SSR difference site in the promoter region of OsHAK21 at -1262 bp to -1229 bp upstream of the translation start site in the four germplasms ( Figure 1 ). Since the haplotypes of two salt-tolerant japonica rice germplasms (Huangluo and Bertone) are (AGA) 9 , while the haplotypes of two salt-sensitive japonica rice germplasms (Sanfuya and Nipponbare) were (AGA) 11 , so it is speculated that this locus may be related to salt tolerance in rice seedlings.

[0049] To verify the accuracy of the SSR locus and its correlation with salt tolerance, 29 japonica rice germplasms were selected and combined with salt tolerance level (STS) to perform significant difference analysis between different haplotypes. The results of haplotype analysis showed that 4 haplotypes were detected in 29 japonica rice germplasms. Among them, the STS of Hap1 and Hap2 were significantly higher than those of Hap3 and Hap4 (P<0.05) ( Figure 2 ). Hap1 includes salt-tolerant germplasms such as Huangluo and Bertone, which are typical salt-tolerant haplotypes, while Hap3 and Hap4 are salt-sensitive haplotypes. The nucleotide sequences of haplotypes Hap1, Hap2, Hap3 and Hap4 are shown in Table 3. The names, sources and salt tolerance levels (STS) of 29 japonica rice germplasm resources are shown in Table 4.

[0050] Table 3 Nucleotide sequences of Hap1-Hap4 haplotypes

[0051]

[0052]

[0053] Note: In SEQ ID No.1-SEQ ID No.4 in Table 3, the wavy lines indicate the sequencing primer sequences of 29 germplasm populations (OsHAK21.aF and OsHAK21.aR, see Table 2); the dotted lines indicate the SSR fluorescent marker primer sequences (OsHAK21.F, SEQ ID No.1 and OsHAK21.R, SEQ ID No.2); the single underline indicates the SSR difference sites of the four haplotypes.

[0054] Table 4 Name, source, salt tolerance level and haplotype of 29 japonica rice germplasms with different salt tolerance

[0055]

[0056]

[0057] Example 2: Development of SSR molecular markers specific to the promoter region of the rice salt tolerance gene OsHAK21

[0058] In order to use this locus to identify salt tolerance of japonica rice germplasm at the seedling stage, we screened salt-tolerant japonica rice germplasm at the seedling stage. Taking advantage of the different numbers of SSR tandem repeat units between different haplotypes, we designed FAM fluorescent-labeled primers at both ends of the SSR sequence, amplified the SSR fragment by PCR, and subjected the amplified product to capillary electrophoresis to determine its haplotype based on the size of the separated fragment. The primer sequences are as follows:

[0059] OsHAK21.F:5'ATCGGAATTTTTCATTAAAAAGGTA 3' (SEQ ID No. 1);

[0060] OsHAK21.R:5'GTATGTAACATTTATGGGCATAACG 3' (SEQ ID No. 2).

[0061] The molecular marker was used to analyze the haplotype of OsHAK21 in 162 japonica rice germplasm resources (Table 5), and the haplotype was verified by combining the salt tolerance level (STS) ( Figure 3). The results showed that 162 japonica rice germplasms also had 4 haplotypes, and the STS of Hap1 and Hap2 were significantly higher than those of Hap3 and Hap4 (P<0.05). Hap1 and Hap2 contained 26 and 18 germplasms, respectively, and their STS were both greater than 4.0, which were salt-tolerant germplasms. Therefore, Hap1 and Hap2 were salt-tolerant haplotypes. Hap3 contained 113 japonica rice germplasms, most of which were salt-sensitive germplasms; Hap4 contained 5 salt-sensitive germplasms, which were salt-sensitive haplotypes. The average STS of the four haplotypes was generally Hap1>Hap2>Hap3>Hap4, and with the increase of simple repeat sequences (AGA), the salt tolerance of the haplotypes gradually decreased. The OsHAK21.F and OsHAK21.R primer pairs can be used for the molecular identification of salt tolerance of rice germplasm resources at the seedling stage.

[0062] Table 5 Name, source, fragment size, salt tolerance level and haplotype of 162 japonica rice germplasm resources

[0063]

[0064]

[0065]

[0066]

[0067]

[0068]

[0069] Note: All 162 japonica rice accessions in Table 5 are rice germplasm resources.

[0070] Note: The amplified products of the marker fragments of 162 japonica rice germplasms were sent to Shanghai Sangon Biotechnology Co., Ltd. for capillary electrophoresis. TM 500LIZ TM The electrophoresis results showed that there were also 4 haplotypes in 162 japonica rice germplasm resources (Table 5), indicating that the SSR region in the OsHAK21 promoter objectively existed, but the size of the electrophoresis fragment was generally 2bp smaller than the theoretical fragment of the corresponding haplotype. In response to this problem, no other differential sites were found after the capillary electrophoresis fragment gene sequence was detected by first-generation Sanger sequencing, and the first-generation sequencing fragment size results were consistent with the haplotype theoretical fragment size. Therefore, it is shown that the difference between the capillary electrophoresis fragment and the theoretical fragment size is mainly due to the error of the experimental instrument, which has nothing to do with the actual haplotype and will not affect the haplotype analysis and application of the specific SSR molecular markers in the promoter region of the rice salt tolerance gene OsHAK21.

[0071] Test methods

[0072] 1. DNA Extraction and PCR Amplification

[0073] The modified 1.5% CTAB method was used to extract genomic DNA from leaves of various germplasm resources. The primer pairs OsHAK21.F and OsHAK21.R were used to amplify the DNA of various germplasm resources by PCR. Taq DNA polymerase from Beijing TransGen Biotech Co., Ltd. was selected, and a 25 μL amplification system was used: 10× Taq Buffer (with MgCl 2 ) 2.5 μL, 5 μM dNTPs 0.5 μL, Primer F and R (10 μM) 0.5 μL each, Taq DNA polymerase (5 U / μL) 0.2 μL, DNA (20-50 ng / μL) 1 μL, ddHO 2 O 19.8 μL (Table 6). The 10-step Touch down PCR reaction procedure was as follows: 1. Pre-denaturation at 95°C for 5 min;

[0074] OsHAK21.F:5'ATCGGAATTTTTCATTAAAAAGGTA 3';

[0075] OsHAK21.R:5'GTATGTAACATTTATGGGCATAACG 3';

[0076] 2. Denaturation at 94°C for 30 s; 3. Annealing at 60°C for 30 s, decreasing by 0.5°C per cycle; 4. Extension at 72°C for 30 s; 5. Steps 2-4, 10 cycles; 6. Denaturation at 94°C for 30 s; 7. Annealing at 55°C for 30 s; 8. 72°C for 30 s; 9. Steps 6-8, 30 cycles; 10. Post-extension at 72°C for 10 min (Table 7).

[0077] Table 6 SSR marker PCR reaction system

[0078]

[0079] Table 7 SSR marker PCR reaction conditions

[0080]

[0081] 2. SSR detection and haplotype analysis

[0082] The fluorescently labeled PCR products were analyzed for amplified fragment size using the 3730XL sequencer from ABI, USA. Figure 4 As shown, the length of the amplified fragment of the rice to be tested with the SSR molecular marker haplotype of Hap1 / Hap1 is 265 bp ( Figure 4 A), the length of the amplified fragment of the rice to be tested with the SSR molecular marker haplotype Hap2 / Hap2 is 268 bp ( Figure 4 B), the length of the amplified fragment of the rice to be tested with the SSR molecular marker haplotype Hap3 / Hap3 is 270bp-271bp ( Figure 4 C), the length of the amplified fragment of the rice to be tested with the SSR molecular marker haplotype Hap4 / Hap4 is 273-274bp ( Figure 4 (middle D).

[0083] Genemapper software was used to analyze SSR data and obtain the SSR molecular marker haplotype of each germplasm resource. Figure 3 As shown, the salt tolerance of rice with haplotype of SSR molecular marker Hap1 / Hap1 or Hap2 / Hap2 is significantly higher than that of rice with haplotype of SSR molecular marker Hap3 or Hap4. According to the correspondence between the electrophoretic fragments and the theoretical fragments in Table 5, that is, the haplotype of the specific SSR locus of the OsHAK21 promoter region of the rice to be tested with the theoretical fragment size of PCR product of 267bp and 270bp is Hap1 / Hap1 or Hap2 / Hap2, and the rice to be tested is salt-tolerant rice or candidate salt-tolerant rice; the haplotype of the specific SSR locus of the OsHAK21 promoter region of the rice to be tested with the theoretical fragment size of PCR product of 273bp and 276bp is Hap3 / Hap3 or Hap4 / Hap4, and the rice to be tested is salt-sensitive rice or candidate salt-sensitive rice.

[0084] The present invention has been described in detail above. For those skilled in the art, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the purpose and scope of the present invention and without the need for unnecessary experiments. Although the present invention provides specific embodiments, it should be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes that are out of the scope of the disclosure in this application and are made with conventional techniques known in the art. The four references involved in the embodiments are as follows:

[0085] [1] Ma Shuaiguo, Tian Rongrong, Hu Hui, Lü Jiandong, Tian Lei, Luo Chengke, Zhang Yinxia, ​​Li Peifu. Comprehensive evaluation and screening of salt tolerance of japonica rice germplasm resources at the seedling stage. Journal of Plant Genetic Resources, 2020, 21(5): 1089-1101.

[0086] [2]Tian L,Tan LB,Liu FX,Cai HW,Sun C Q.Identification ofquantitative trait loci associated with salt tolerance at seedling stage fromOryza Rufipogon[J].Journal of Genetics and Genomics,2011,38(12):593-601.

[0087] [3] Wang Na, Chen Yaping, Tian Lei, Zhang Dewen, Wang Ruizhi, Yang Miao, Li Peifu. Correlation analysis between root morphological characteristics and salt tolerance of japonica rice germplasm resources at seedling stage. Guangdong Agricultural Sciences, 2015, 42(10): 1-10.

[0088] [4]He YQ, Yang B, Zhan CF, Cheng YH, Zhang JH, Zhang HS, Cheng JP, Wang Z F. Aquantitative trait locus, qSE3, promotes seed germination and seedling establishment under salinity stress in rice [J]. The Plant Journal, 2019, 97(6): 1089-1104.

Claims

1. Detection OsHAK21 Application of promoter region specific SSR molecular marker haplotype material in any of the following: A1) Assist in identifying rice salt tolerance; A2) assisting in the screening of salt-tolerant rice plants, strains, lines or varieties; A3) assisted rice breeding, the purpose of which is to cultivate salt-tolerant rice; The SSR molecular marker is a simple repeat sequence in the rice genome, located between 21066198-21066230bp on chromosome 3 of the rice reference genome IRGSP-1.0, and its nucleotide sequence is (AGA) n , where 9≤n≤12, n is a natural number; OsHAK21 The promoter region-specific SSR molecular markers were divided into four haplotypes, namely Hap1 / Hap1, Hap2 / Hap2, Hap3 / Hap3, and Hap4 / Hap4; The Hap1 / Hap1 is OsHAK21 The nucleotide sequence of the promoter region specific SSR molecular marker is the homozygous type of (AGA) 9, and the nucleotide sequence of the Hap2 / Hap2 SSR molecular marker is (AGA) 10 The nucleotide sequence of Hap3 / Hap3 as the SSR molecular marker is (AGA) 11 The nucleotide sequence of the Hap4 / Hap4 SSR molecular marker is (AGA) 12 Homozygous type; The substance is any of the following: B1) the substance is a PCR primer composition for amplifying a rice genomic DNA fragment including the SSR molecular marker; B2) a PCR reagent containing the PCR primer combination described in B1); B3) A kit containing the PCR primer composition described in B1) or the PCR reagent described in B2).

2. The use according to claim 1, characterized in that: The PCR primer composition comprises: a single-stranded DNA whose nucleotide sequence is SEQ ID No.1 and a single-stranded DNA whose nucleotide sequence is SEQ ID No.

2.

3. A method for assisting the identification of salt tolerance traits of rice, the method comprising detecting the haplotype of the SSR molecular marker described in claim 1 of the rice to be tested, and assisting in the identification of the salt tolerance of the rice based on the haplotype, wherein the salt tolerance of the rice to be tested whose haplotype of the SSR molecular marker is the Hap1 / Hap1 or the Hap2 / Hap2 is higher than or has a candidate higher salt tolerance than the rice to be tested whose haplotype of the SSR molecular marker is the Hap3 / Hap3 or the Hap4 / Hap4.

4. The method according to claim 3, characterized in that: The method for detecting the haplotype of the SSR molecular marker of the rice to be tested in claim 1 comprises taking the genomic DNA of the rice to be tested as a template, amplifying a PCR product using the PCR primer combination described in claim 2, and determining the haplotype according to the fragment size of the PCR product; the rice with a fragment size of 267bp or 270bp has a higher salt tolerance than or a candidate higher salt tolerance than the rice with a fragment size of 273bp or 276bp.

5. A rice breeding method, characterized in that: The method comprises selecting rice whose haplotype of the SSR molecular marker in claim 1 is Hap1 / Hap1 or Hap2 / Hap2 as a parent for breeding, wherein the purpose of the breeding is to cultivate salt-tolerant rice.

6. The method according to claim 5, characterized in that: The method comprises the following steps of detecting whether the haplotype of the SSR molecular marker of the rice to be tested in claim 1 is the Hap1 / Hap1 or the Hap2 / Hap2: using the genomic DNA of the rice to be tested as a template, amplifying using the PCR primer combination described in claim 2 to obtain a PCR product, and determining the haplotype according to the fragment size of the PCR product; the haplotype of rice with a fragment size of 267 bp or 270 bp is the Hap1 / Hap1 or the Hap2 / Hap2, respectively.

Images