A novel circular RNA loop sequence for constructing CAR-T cells and its application in the treatment of small cell lung cancer

Abstract

The present invention discloses a novel circular RNA looping sequence for constructing CAR-T cells and its application in the treatment of small cell lung cancer. The present invention provides a method for preparing DLL3-CAR-T cells, comprising the following steps: 1) preparing a DLL3-CAR-structured circular RNA; 2) encapsulating the DLL3 circular RNA in a lipid material to obtain a LNP encapsulating the DLL3 circRNA; and 3) transfecting the LNP encapsulating the DLL3 circRNA into T cells to obtain DLL3-CAR-T cells. Experiments in the present invention have demonstrated that the present invention provides a novel RNA looping sequence and a method for preparing the same for constructing CAR-T cells. Using this method to construct a CAR-T targeting the DLL3 target is expected to provide an innovative and effective treatment technology for SCLC treatment, and to revolutionize the application of CAR-T in tumor treatment.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and relates to a novel circular RNA looping sequence for constructing CAR-T cells and its application in the treatment of small cell lung cancer. Background Art

[0002] Delta-Like Ligand 3 (DLL3) is a single-pass transmembrane protein highly expressed on the surface of tumor cells, including small cell lung cancer (SCLC). It is a member of the Notch ligand family. DLL3 binds to the Notch receptor, inhibiting the Notch signaling pathway and enhancing the proliferation, cloning, and invasion of SCLC cells, thereby promoting SCLC progression. Given its high expression in SCLC cells and its absence or low expression in normal tissues, DLL3 offers great potential for targeted therapy.

[0003] Chimeric antigen receptor T cell therapy (CAR-T) is an immunotherapy that uses genetic engineering technology to modify T cells so that they are activated and equipped with a receptor targeting tumor cells, and then re-infused back into the patient's body after large-scale amplification to kill the tumor. However, at this stage, personalized CAR-T preparation is expensive and time-consuming, and patients may face risks such as "lymph clearance" during treatment. In early 2022, Science magazine reported the first study using messenger RNA (mRNA) for in vivo CAR-T modification. The team used lipid nanoparticles (LNP) to deliver mRNA to T cells, causing T cells to express a CAR structure that specifically targets fibroblast activation protein and specifically enriches in the heart to achieve the purpose of reversing damaged myocardial fibrosis and repairing heart damage. However, there are currently no clinical studies on in vivo editing of CAR-T cells for tumor treatment.

[0004] Circular RNA (circRNA) is a type of single-stranded RNA molecule with a closed circular structure. Compared to mRNA, circRNA offers simpler synthesis (no capping or tailing required), greater stability (the circular structure is more resistant to exonucleases), and longer protein translation capacity and duration. Therefore, circRNA is expected to become the 2.0 version of mRNA technology. Summary of the Invention

[0005] The purpose of the present invention is to provide a novel RNA loop sequence and a method for preparing the same for constructing CAR-T cells.

[0006] In a first aspect, the present invention provides a method for preparing CAR-T cells targeting DLL3 (hereinafter referred to as DLL3-CAR-T), comprising the following steps:

[0007] 1) Preparation of circular RNA targeting the DLL3 CAR structure (hereinafter referred to as DLL3-CAR), recorded as DLL3 circRNA;

[0008] The DLL3 circRNA was prepared as follows:

[0009] 1)-1. Prepare a plasmid expressing DLL3 circRNA, which contains the type I intron ribozyme sequence backbone fragment of the DLL3-CAR structural coding sequence;

[0010] The plasmid expressing DLL3 circRNA was specifically synthesized by a company, and in the embodiment of the present invention, it was specifically pUC57-DLL3, which was specifically obtained by cloning the type I intron ribozyme sequence backbone of the DLL3-CAR structural coding sequence into the pUC57 plasmid vector;

[0011] The type I intron ribozyme sequence backbone fragment of the DLL3-CAR structural coding sequence includes, in sequence: a 5' homology arm, a 3' end of the Anabaena T4 intron, CVB3_IRES_1, a DLL3-CAR structural coding sequence, CVB3_IRES_2, a 5' end of the Anabaena T4 intron and a 3' homology arm;

[0012] The nucleotide sequence of CVB3_IRES_1 is SEQ ID NO: 185-934;

[0013] The nucleotide sequence of CVB3_IRES_2 is positions 2528-2570 of sequence 2;

[0014] 1)-2, linearizing the plasmid of the DLL3 circRNA to obtain a linearized plasmid;

[0015] The restriction enzyme cleavage site of the linearization enzyme is present in the region excluding the type I intron ribozyme sequence backbone fragment of the DLL3-CAR structural coding sequence in the plasmid;

[0016] 1)-3, amplifying the type I intron ribozyme sequence backbone fragment of the DLL3-CAR structural coding sequence from the linearized plasmid to obtain a type I intron ribozyme sequence backbone fragment amplification product;

[0017] 1)-4, in vitro transcribing the amplified product of the group I intron ribozyme sequence backbone fragment to obtain a transcription product;

[0018] 1)-5, adding GTP to the transcription product for incubation to achieve cyclization and obtain DLL3-CAR structured circular RNA;

[0019] 2) encapsulating the DLL3 circRNA in a lipid material to obtain LNP encapsulating the DLL3 circRNA;

[0020] 3) Transfecting the LNPs encapsulating DLL3 circRNA into T cells to obtain DLL3-CAR-T cells, i.e., CAR-T cells targeting the DLL3 target.

[0021] The lipid material is obtained by mixing lipid material SM-102, distearoylphosphatidylcholine, cholesterol and DMG-PEG2000 in anhydrous ethanol at a molar ratio of 50:10:38.5:1.5.

[0022] The ratio of each substance in the LNP encapsulating DLL3 circRNA was 20 μg RNA / 1 ml lipid material; the specific encapsulation method was as follows: lipid materials SM-102 (ruixibio, R-SM-072), distearoylphosphatidylcholine (ruixibio, LR-R4-076), cholesterol (ruixibio, RH-100001) and DMG-PEG2000 (ruixibio, R-PEG-0021) were used in a molar ratio of 50:10:38.5:1.5, and were thoroughly mixed with 100 ml of anhydrous ethanol (TIANJIN YONGDA CHEMICAL REAGENT CMPANY LIMITED, 20230102) to form a new ionizable lipid solution (the total concentration of the four components was configured to 12 mM, approximately 7.5 mg / ml, named ethanol phase); 20 μg DLL3 circRNA was dissolved in 1 ml of 25 mM sodium acetate (pH 5.0, aladdin, S118648-100g) solution to obtain an RNA acidification buffer solution (designated as the buffer phase). Using a microfluidic lipid nanoparticle (LNP) preparation instrument (NexstarBio, NEXSTAR nano1), 1 ml of the ionizable lipid solution and 3 ml of the mRNA acidification buffer solution were each taken and mixed using a NEXSTAR C2 chip. The two phases were mixed at a ratio of 1 (ethanol phase): 3 (buffer phase) at a rate of 1 ml / min:3 ml / min to obtain LNPs encapsulating DLL3 circRNA (20 μg RNA / 1 ml lipid material).

[0023] In the above-mentioned method,

[0024] The nucleotide sequence of the 5' homology arm is positions 24-53 of SEQ ID NO: 2;

[0025] The nucleotide sequence at the 3' end of the Anabaena T4 intron is positions 54-184 of sequence 2;

[0026] The nucleotide sequence of the exogenous gene replaces the positions 935-2527 of sequence 2;

[0027] The nucleotide sequence at the 5' end of the Anabaena T4 intron is positions 2571-2686 of sequence 2;

[0028] The nucleotide sequence of the 3' homology arm is SEQ ID NO: 2687-2721;

[0029] The 5' homology arm upstream of the type I intron ribozyme sequence backbone fragment of the DLL3-CAR structural coding sequence also includes a transcription promoter, and further the transcription promoter is a T7 promoter;

[0030] The nucleotide sequence of the T7 promoter is positions 1-23 of sequence 2.

[0031] In the above-mentioned method,

[0032] The nucleotide sequence of the type I intron ribozyme sequence backbone fragment of the DLL3-CAR structural coding sequence is sequence 2.

[0033] In the above method, the T cells are CD3+ T cells.

[0034] In a second aspect, the present invention provides DLL3-CAR-T prepared by the method described in the first aspect.

[0035] In a third aspect, the present invention provides any of the following substances:

[0036] A1) a group I intron ribozyme sequence backbone fragment of the DLL3-CAR structural coding sequence described in the first aspect;

[0037] A2) The plasmid expressing the DLL3-CAR structural circular RNA as described in the first aspect.

[0038] In a fourth aspect, the present invention provides use of any of the following substances in the preparation of DLL3-CAR-T;

[0039] B1), a group I intron ribozyme sequence backbone fragment of the DLL3-CAR structural coding sequence described in the first aspect;

[0040] B2) the plasmid expressing the DLL3-CAR structure circular RNA described in the first aspect;

[0041] B3), the plasmid expressing the DLL3-CAR structure circular RNA in the first aspect, the enzyme used for linearization, the primers used for amplification, the instruments or reagents required for in vitro transcription, the GTP and the lipid material.

[0042] In a fifth aspect, the present invention provides the use of the DLL3-CAR-T described in the second aspect or the substance described in the third aspect in the preparation of a product for treating small cell lung cancer (SCLC) or killing small cell lung cancer.

[0043] In a sixth aspect, the present invention provides a product for treating SCLC or killing small cell lung cancer, which includes the DLL3-CAR-T of the second aspect or the substance described in the third aspect.

[0044] The present invention provides a novel RNA looping sequence and a method for preparing the same for constructing CAR-T cells. Using this method to construct CAR-T targeting the DLL3 target is expected to provide an innovative and effective treatment technology for SCLC treatment and bring about a revolutionary breakthrough in the application of CAR-T in tumor treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 Diagram of the ring-forming strategy of type I catalytic ribozymes; (A) Schematic diagram of the currently common ring-forming strategy; (B) Schematic diagram of the modified ring-forming system.

[0046] Figure 2 Identification of circularization; (A) Schematic diagram of RNA gel electrophoresis; (B) Schematic diagram of PCR gel electrophoresis; (C) Schematic diagram of linker sites; (D) Western detection of EGFP expression; Among them, IVT represents the product after in vitro transcription; circRNA represents the purified product; circRNA+Rnase R represents the product after Rnase R enzyme treatment.

[0047] Figure 3 GFP-expressing 293T cells were constructed; (A) GFP expression in 293T cells was observed by fluorescence microscopy; (B) The proportion of GFP-expressing 293T cells was analyzed by flow cytometry.

[0048] Figure 4 Flow cytometry analysis was used to determine the proportion of GFP-expressing CD3+ T cells.

[0049] Figure 5 Flow cytometry was used to detect the expression efficiency of DLL3-CAR in T cells.

[0050] Figure 6 Flow cytometry was used to analyze the effect of DLL3-CAR-T cells with different effector-target ratios in killing SCLC. DETAILED DESCRIPTION

[0051] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0052] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0053] The methods for extracting and culturing human CD3+ T cells in the following examples are as follows:

[0054] 1. Human CD3+ T cell extraction

[0055] 1) Take 10 ml of human peripheral blood, dilute with an equal volume of D-PBS (ServiceBio, Cat. G4200-500 ML), and mix well.

[0056] 2) 4.5 ml of lymphocyte separation solution (STEMCELL, Cat#07851 / 07861) was injected into a SepTube tube (Precision BioMedicals Co., Ltd, Cat#601115).

[0057] 3) Add 5 ml of diluted peripheral blood into the SepTube tube along the tube wall and incubate at 1200 g / 10 min at room temperature.

[0058] 4) Directly pour the upper layer of dilution containing peripheral blood mononuclear cells into a 15 ml centrifuge tube, add an equal volume of D-PBS to wash, and centrifuge at 300g / 8 minutes at room temperature; then resuspend in 1 ml of D-PBS and transfer to a flow cytometry tube.

[0059] 5) Add 100 μl of EasySep Human CD3 Positive Selection Cocktail II (STEMCELL, Cat#17851) and incubate at room temperature for 3 min. Then add 60 μl of EasySep Dextran RapidSpheres 50100 (STEMCELL, Cat#17851) and incubate at room temperature for 3 min.

[0060] 6) Place the flow cytometry tube in EasySep Violet Magnet (STEMCELL, Cat#18000) and incubate at room temperature for 3 minutes, then remove the supernatant.

[0061] 7) Add 1 ml of D-PBS to resuspend, repeat step 6), and then resuspend in 1 ml of D-PBS to obtain magnetic bead-sorted human CD3+ T cells.

[0062] 2. Human CD3+ T cell culture

[0063] 1) Prepare CD3+ T cell culture medium: X-VIVO 15 medium (Lonza, Cat#04-418Q) + 10% (volume percentage) FBS + 1% (mass volume ratio, g:ml) PS + 300 IU / ml IL-2.

[0064] 2) Add the human CD3+ T cells separated by magnetic beads obtained in step 1 above to the prepared culture medium.

[0065] 3) Add the required amount of Dynabeads Human T-Activator CD3 / CD28 (Gibco, Cat#11131D, 1 μl / 10 μl) 4 The cells were resuspended in 1 ml D-PBS in a flow cytometry tube and placed in EasySep Violet Magnet at room temperature for 1 min. After removing the supernatant, the cells were resuspended in 1 ml D-PBS and added to the culture medium.

[0066] 4) On day 5, remove the Dynabeads using EasySep Violet Magnet.

[0067] Example 1: Preparation of plasmids expressing circular RNA

[0068] 1. Construction of the group I intron ribozyme sequence backbone and cEGFP circularization template plasmid

[0069] The invention adopts an improved strategy of type I intron ribozyme based on Anabaena tRNA to construct a cEGFP circularization template plasmid.

[0070] The improved Anabaena tRNA-based group I intron ribozyme is based on previously reported sequences. The present invention addresses the inherent deficiencies of the reported group I intron synthase self-splicing by thorough consideration and redesign. Based on the existing sequence, the present invention fully recognizes the importance of exon E1 and exon E2 in group I intron synthase self-splicing, and accurately splits the internal ribosome entry site (IRES) element that promotes translation (the present invention uses the coxsackievirus internal ribosome entry site, hereinafter referred to as CVB3 IRES), mimicking the sequences of E1 and E2 (e.g., Figure 1 B). The present invention does not change the self-splicing characteristics of the type I intron ribozyme and does not introduce additional exogenous sequences (ie: ( Figure 1 The sequences E2, 5' internal homologous sequence, 5' separator sequence, 3' internal homologous sequence, 3' separator sequence and E1 in A (also known as "scar sequence") are used to reduce the inherent immune response of the body's cells to foreign RNA.

[0071] The redesigned Anabaena tRNA-based type I intronic ribozyme sequence backbone containing an exogenous gene of the present invention includes the following elements from 5' to 3': a 5' homology arm, the 3' end of the Anabaena T4 intron, CVB3_IRES_1, the exogenous gene, CVB3_IRES_2, the 5' end of the Anabaena T4 intron, and the 3' homology arm; a transcription promoter such as a T7 promoter can also be connected upstream of the 5' homology arm.

[0072] When the exogenous gene is an EGFP encoding gene, the nucleotide sequence of the type I intron ribozyme sequence skeleton of the EGFP encoding gene is sequence 1.

[0073] Among them, positions 1-23 of sequence 1 are the T7 promoter, positions 24-53 of sequence 1 are the 5' homology arm, positions 54-184 of sequence 1 are the 3' end of the Anabaena T4 intron, positions 185-934 of sequence 1 are CVB3_IRES_1, positions 935-1654 of sequence 1 are the location of the exogenous gene (here is the EGFP encoding gene), positions 1655-1697 of sequence 1 are CVB3_IRES_2, positions 1698-1813 of sequence 1 are the 5' end of the Anabaena T4 intron, and positions 1814-1848 of sequence 1 are the 3' homology arm.

[0074] Nanjing GenScript Technology Co., Ltd. was commissioned to synthesize the plasmid pUC57-cEGFP, which contains the type I intron ribozyme sequence backbone of the EGFP encoding gene. Specifically, the type I intron ribozyme sequence backbone of the EGFP encoding gene was cloned into the pUC57 expression vector, and the type I intron ribozyme sequence backbone fragment was transcribed using its own transcription promoter.

[0075] The pUC57-cEGFP plasmid was then introduced into Escherichia coli to obtain recombinant bacteria. After culture, the plasmid of the recombinant bacteria was extracted to obtain the cEGFP circularization template plasmid.

[0076] 2. Template amplification and purification recovery

[0077] 1) Linearization

[0078] The cEGFP circularized template plasmid was cut into a linearized plasmid by endonuclease NdeI (this enzyme does not exist in the type I intron ribozyme sequence backbone of the EGFP coding gene, but is located on the pUC57 plasmid).

[0079] 2) Amplify the I-type intron ribozyme sequence backbone of the EGFP encoding gene

[0080] Primers were designed to amplify the group I intron ribozyme sequence backbone of the EGFP encoding gene, and the linearized plasmid was used as a template for high-fidelity PCR amplification using KOD-Plus-Neo (KOD-401, TOYOBO, JAPAN).

[0081] Forward primer: TGCATCTAGATTAATACGACTCACT

[0082] Reverse primer: CTAGATATGCTGTTATCCGTCGATT

[0083] After the PCR reaction was completed, the amplified product was passed through a DNA template purification recovery column (DP214, TIANGEN, China) to obtain purified template DNA (with T7 promoter).

[0084] 3. In vitro transcription and circularization

[0085] The purified template DNA was transcribed in vitro using an RNA synthesis kit (E2040S, NEB, USA) with a T7 promoter sequence primer, and the excess template DNA was digested with DNase I and purified and recovered (T2030S, NEB, USA) to obtain a purified linear RNA precursor (IVT product after in vitro transcription, concentration of 2000 ng / ul).

[0086] A final concentration of 2 mM GTP was added to the purified linear RNA precursor, and the mixture was incubated at 55°C for 15 min to form a circular RNA in vitro to obtain an incubated RNA product. The incubated RNA product was purified again by column purification to obtain a circularized product (denoted as circRNA).

[0087] 4. Identification of Ringing

[0088] Based on the characteristics of circRNA's tolerance to RNase R, the cyclized product obtained in step 3 above was treated with RNase R to remove the remaining linear RNA precursor in the cyclization reaction, and then another column purification was performed to obtain the RNase R enzyme-treated product (denoted as circRNA+RNase R).

[0089] 1) Agarose gel electrophoresis

[0090] The cyclized product obtained in 3 above, the in vitro transcription product obtained in 3 above, and the product treated with RNase R were subjected to agarose gel electrophoresis.

[0091] The results are as follows Figure 2As shown in A, IVT is the product of in vitro transcription; circRNA is the circularized product; circRNA+RNase R is the product of RNase R enzyme treatment, and the linear control is a linear RNA obtained by in vitro transcription of a DNA molecule consisting of the CVB3_IRES sequence and the EGFP coding gene sequence (positions 935-1654 of SEQ ID NO: 1) (these two sequences are closely spliced ​​together) and then tailed with PolyA.

[0092] The above CVB3_IRES sequence is the original unsplit sequence. For details, please see the reference: Wesselhoeft RA, Kowalski PS, Anderson DG. Engineering circular RNA for potent and stable translation in eukaryotic cells. Nat Commun. 2018; 9(1): 2629. Published 2018 Jul 6. doi: 10.1038 / s41467-018-05096-6).

[0093] As can be seen from the figure, compared with the linear control, the products after in vitro transcription and the circularized products after RNase R enzyme treatment are both circular, indicating that the RNA is obviously circularized.

[0094] 2) Verification after reverse transcription

[0095] The in vitro transcription product (IVT) obtained in 3 above and the product after RNase R enzyme treatment (denoted as circRNA+RNase R in the figure) were reverse transcribed according to the following system and procedure to obtain the reverse transcription product.

[0096] The reverse transcription system is as follows: Table 1 (PrimeScript TM RT Master Mix, Takara, RR036A).

[0097] Table 1

[0098]

[0099] The reverse transcription procedure is as follows:

[0100] 37℃15min (reverse transcription reaction)

[0101] 85℃5sec (inactivation reaction of reverse transcriptase)

[0102] 4℃

[0103] Then, each reverse transcription product is used as a template, and PCR amplification is performed by using primers designed for the linker site to obtain a PCR amplification product.

[0104] The primers for the above-mentioned linker sites are as follows:

[0105] Forward primer: GGATCACTCTCGGCATGGAC

[0106] Reverse primer: GCTAGCGCCCAATGGTAAGA

[0107] The results are as follows Figure 2 As shown in B, it can be seen that a clear single-band PCR product was obtained.

[0108] The above PCR products were subjected to Sanger sequencing, and the results were as follows. Figure 2 As shown in C, the looping site (the linker site indicated by the arrow, where the head and tail are connected) can be seen.

[0109] 3) Exogenous gene expression protein

[0110] A linear control (a DNA molecule consisting of the CVB3_IRES sequence and the EGFP encoding gene sequence (positions 935-1654 of SEQ ID NO: 1) (these two sequences were spliced ​​closely together) was used to generate linear RNA obtained by in vitro transcription and then tailed with a poly A tail), the in vitro transcription product (IVT) obtained in 3) above, the circularized product (circRNA) obtained in 3) above, and the product treated with RNase R (circRNA+RNase R) were separately transfected into the lung adenocarcinoma cell line H1299 cells. Twenty-four hours after transfection, the cells were harvested and centrifuged at 12,000 g for 20 minutes, and the precipitate was collected.

[0111] The precipitated protein was extracted and the expression of EGFP was detected by western blot.

[0112] The results are as follows Figure 2 As shown in D, it can be seen that EGFP is significantly expressed in the IVT, circRNA, and circRNA+Rnase R groups.

[0113] Therefore, the circularized product obtained in step 3 above (denoted as circRNA) is EGFP circRNA.

[0114] Example 2: Feasibility Verification of circRNA Editing T Cells

[0115] 1. LNP-encapsulated EGFP circRNA

[0116] Lipid materials SM-102 (ruixibio, R-SM-072), distearoylphosphatidylcholine (ruixibio, LR-R4-076), cholesterol (ruixibio, RH-100001) and DMG-PEG2000 (ruixibio, R-PEG-0021) were used in a molar ratio of 50:10:38.5:1.5 and thoroughly mixed with 100 ml of anhydrous ethanol (TIANJIN YONGDA CHEMICAL REAGENT CMPANY LIMITED, 20230102) to form a new ionizable lipid solution (the total concentration of the four components was configured to 12 mM, approximately 7.5 mg / ml, named ethanol phase); 20 ug EGFP circRNA was dissolved in 1 ml of 25 mM sodium acetate (pH 5.0, aladdin, S118648-100 g) solution to obtain an mRNA acidification buffer solution (named buffer phase). Using a microfluidic lipid nanoparticle (LNP) preparation instrument (NexstarBio, NEXSTAR nano1), 1 ml of ionizable lipid solution and 3 ml of mRNA acidification buffer solution were taken respectively, and mixed using the NEXSTARC2 chip. The two phases were mixed at a ratio of 1 (ethanol phase): 3 (buffer phase) at 1 ml / min: 3 ml / min, and finally LNPs encapsulating EGFP circRNA were obtained (20 ug RNA / 1 ml lipid material).

[0117] 2. Construction of GFP 293T cells

[0118] 293T control group (blank): 293T cells, cultured for 48 h;

[0119] 293T experimental group (EGFP): The EGFP circRNA-encapsulated LNPs obtained in step 1 above were added to 293T cells (5 μg LNP / million cells), mixed thoroughly, and cultured for 48 h.

[0120] The cells in each group were cultured for 48 h and the expression of GFP in 293T cells was observed under a fluorescence microscope (OLYMPUS, CKX53). The proportion of GFP-expressing 293T cells was detected using the FITC channel using a flow cytometer (BD FACSVERSE, Cat#651154).

[0121] The results are as follows Figure 3 As shown, Figure 3 A shows the expression of GFP in 293T cells observed with a fluorescence microscope. It can be seen that the cells in the 293T control group do not express GFP, while the cells in the 293T experimental group clearly express GFP. Figure 3B is the proportion of 293T cells expressing GFP analyzed by flow cytometry. The data showed that the proportion of 293T cells expressing GFP in the 293T experimental group was 87.8%, which was much higher than that in the 293T control group.

[0122] 3. Construction of GFP CD3+ T cells

[0123] Control group (blank): CD3+T cells, cultured for 48 h;

[0124] Experimental group (EGFP): The EGFP circRNA-encapsulated LNPs obtained in step 1 above were added to CD3+ T cells (5 μg LNP / million cells), mixed thoroughly, and cultured for 48 h.

[0125] The cells cultured for 48 h in the above groups were analyzed by flow cytometry, and the FITC channel was used to detect the proportion of CD3+ T cells expressing GFP.

[0126] The results are as follows Figure 4 As shown, the flow cytometry graph showed that the proportion of CD3+T cells expressing GFP in the control group was 0.369%, and the proportion of CD3+T cells expressing GFP in the experimental group was 9.19%. The number of CD3+T cells expressing GFP in the experimental group was much higher than that in the control group.

[0127] Example 3. Construction and application of DLL3-CAR-T

[0128] 1. Preparation of circular RNA expressing DLL3-CAR structure

[0129] 1. Preparation of plasmids expressing DLL3-CAR circular RNA

[0130] The plasmid pUC57-DLL3 was prepared and commissioned to Nanjing GenScript Technology Co., Ltd. according to the method of Example 1. The plasmid contained a type I intron ribozyme sequence backbone of the CAR structure coding sequence for the DLL3 protein. Specifically, the type I intron ribozyme sequence backbone of the DLL3-CAR structure coding sequence was cloned into the pUC57 plasmid vector.

[0131] The nucleotide sequence of the group I intron ribozyme sequence of the DLL3-CAR structural coding sequence is sequence 2.

[0132] The type I intron ribozyme sequence skeleton of the DLL3-CAR structural coding sequence is compared with the type I intron ribozyme sequence skeleton of the EGFP coding gene, in which the EGFP coding gene in the type I intron ribozyme sequence skeleton of the EGFP coding gene shown in sequence 1 in Example 1 is replaced with the DLL3-CAR structural coding sequence.

[0133] Among them, positions 1-23 of sequence 2 are the T7 promoter, positions 24-53 of sequence 2 are the 5' homology arm, positions 54-184 of sequence 2 are the 3' end of the Anabaena T4 intron, positions 185-934 of sequence 2 are CVB3_IRES_1, positions 935-2527 of sequence 2 are the exogenous gene (DLL3-CAR structure coding sequence), positions 2528-2570 of sequence 2 are CVB3_IRES_2, positions 2571-2686 of sequence 2 are the 5' end of the Anabaena T4 intron, and positions 2687-2721 of sequence 2 are the 3' homology arm.

[0134] The pUC57-DLL3 plasmid was then introduced into Escherichia coli to obtain recombinant bacteria. After culture, the plasmid of the recombinant bacteria was extracted to obtain a plasmid expressing the DLL3-CAR structural circular RNA.

[0135] 2. Template amplification and purification recovery

[0136] 1) Linearization

[0137] The same as Example 1, except that the nuclease NdeI is not present in the type I intron ribozyme sequence backbone of the DLL3-CAR structural coding sequence, but is located on the pUC57 plasmid. A linearized plasmid is obtained.

[0138] 2) Amplify the type I intron ribozyme sequence backbone of the DLL3-CAR structural coding sequence (amplification primers are the same as EGFP)

[0139] Purified template DNA (with T7 promoter) was prepared according to the method of Example 1.

[0140] 3. In vitro transcription and circularization

[0141] According to the method of Example 1, the above-purified template DNA (with T7 promoter) was transcribed in vitro to obtain a purified linear RNA precursor (IVT product after in vitro transcription, concentration of 2000 ng / ul).

[0142] According to the method of Example 1, the in vitro transcription product IVT was circularized in vitro to obtain a circularized product (denoted as DLL3 circRNA).

[0143] 4. Identification of Ringing

[0144] The cyclized product obtained in step 3 above was treated with RNase R to remove the remaining linear RNA precursor in the cyclization reaction, and then subjected to another column purification to obtain the RNase R enzyme-treated product.

[0145] The in vitro transcription product, cyclization product, and RNase R-treated cyclization product obtained in step 3 above were subjected to agarose gel electrophoresis. The linear control was a linear RNA obtained by in vitro transcription of a DNA molecule consisting of the CVB3_IRES sequence and the DLL3-CAR structure coding sequence (these two sequences were spliced ​​closely together) and tailed with a poly A tail.

[0146] The above CVB3_IRES sequence is the original unsplit sequence. For details, please see the reference: Wesselhoeft RA, Kowalski PS, Anderson DG. Engineering circular RNA for potent and stable translation in eukaryotic cells. Nat Commun. 2018; 9(1): 2629. Published 2018 Jul 6. doi: 10.1038 / s41467-018-05096-6).

[0147] The electrophoresis results showed that compared with the linear control, the products of in vitro transcription and the circularized products after RNase R treatment were both circular, and compared with the group not treated with RNase R, the target circularized bands in the RNase R treatment group were significantly enriched and the miscellaneous bands were significantly reduced.

[0148] Subsequently, the in vitro transcription product obtained in 3 and the product after RNase R enzyme treatment were subjected to reverse transcription reaction according to the reverse transcription system used in Example 1 to obtain reverse transcription products. Using each reverse transcription product as a template, PCR amplification was performed by designing primers for the linker site (same as the EGFP linker site primers in Example 1) to obtain PCR amplification products. The amplified products were then subjected to agarose electrophoresis, and the results showed a single band PCR product. Finally, the above-mentioned PCR products were subjected to Sanger sequencing, and the result prompted a visible looping site.

[0149] 2. DLL3-CAR-T Construction

[0150] 1. LNP encapsulation of DLL3 circRNA

[0151] Lipid materials SM-102 (ruixibio, R-SM-072), distearoylphosphatidylcholine (ruixibio, LR-R4-076), cholesterol (ruixibio, RH-100001) and DMG-PEG2000 (ruixibio, R-PEG-0021) were used in a molar ratio of 50:10:38.5:1.5 and thoroughly mixed with 100 ml of anhydrous ethanol (TIANJIN YONGDA CHEMICAL REAGENT CMPANY LIMITED, 20230102) to form a new ionizable lipid solution (the total concentration of the four components was configured to 12 mM, approximately 7.5 mg / ml, named ethanol phase); 20 μg of DLL3 circRNA was dissolved in 1 ml of 25 mM sodium acetate (pH 5.0, aladdin, S118648-100 g) solution to obtain an mRNA acidification buffer solution (named buffer phase). Using a microfluidic lipid nanoparticle (LNP) preparation instrument (NexstarBio, NEXSTAR nano1), 1 ml of ionizable lipid solution and 3 ml of mRNA acidification buffer solution were taken respectively, and mixed using the NEXSTARC2 chip. The two phases were mixed at a ratio of 1 (ethanol phase): 3 (buffer phase) at 1 ml / min: 3 ml / min, and finally LNPs encapsulating DLL3 circRNA were obtained (20 ug RNA / 1 ml lipid material).

[0152] 2. Construction of DLL3-CAR-T cells

[0153] Set up 4 groups of CD3+ T cells:

[0154] Control group (blank): CD3+T cells, cultured for 48 h;

[0155] Experimental group: The LNPs encapsulating DLL3 circRNA obtained in step 1 above were added to CD3+ T cells (5 μg LNP / million cells), mixed thoroughly, and cultured for 48 h.

[0156] The cells in the above groups were cultured for 48 hours and the PE channel was used to detect the proportion of CART cells in each group. Specifically, the experimental groups were further divided into 3 groups for flow cytometric analysis: Group 1 (denoted as DLL3 protein with only biomarker added in the figure) the antibody was biotin-labeled human DLL3 protein (Acro BIOSYSTEMS, Cat#DL3-H82E4), Group 2 (denoted as PE-labeled anti-biotin secondary antibody with only PE added in the figure) the antibody was PE-labeled anti-biotin antibody (Biolegend, Cat#409004), Group 3 (denoted as DLL3 protein + secondary antibody in the figure) the antibodies were biotin-labeled human DLL3 protein and PE-labeled anti-biotin antibody.

[0157] The results are as follows Figure 5 As shown, compared with the blank control group, the DLL3 protein experimental group with only biomarkers, and the PE-labeled anti-biotin secondary antibody experimental group, the CAR-T ratio in the DLL3 protein + secondary antibody experimental group was 6.61%, much higher than that in other control groups.

[0158] The cells cultured in the above experimental group for 48 hours were recorded as DLL3-CAR-T cells.

[0159] The experiment also conducted controls for different culture times, and the results showed that the T cell transfection efficiency was highest after 48 hours of culture. III. DLL3-CAR-T killing experiment

[0160] GFP-expressing SHP77 (GFP-SHP77) SCLC. This cell line is based on the common SHP77 (ATCC, CRL 2195) cell line. The GFP encoding gene (SEQ ID NO: 935-1654) is introduced into SHP77 cells using a lentivirus. The cells stably express GFP. For details, see the following literature: Zhang Y, Tacheva-Grigorova SK, Sutton J, et al. Allogeneic CAR T Cells Targeting DLL3 Are Efficacious and Safe in Preclinical Models of Small Cell Lung Cancer [published online ahead of print, 2023 Jan 23]. Clin Cancer Res. 2023; OF1-OF15. doi: 10.1158 / 1078-0432. CCR-22-2293.

[0161] Experimental group: In RPMI 1640 complete medium (10% fetal bovine serum + 1% penicillin-streptomycin, Gibco, 8122630), with a seeding number of 10,000 GFP-SHP77 cells as the benchmark, the above two obtained DLL3-CAR-T and GFP-SHP 77 were co-cultured for 24 hours according to different effector-target ratios of CAR-T: GFP-SHP77 (10:1; 8:1; 6:1 and 2:1) (denoted as CART+SCLC2:1, CART+SCLC6:1, CART+SCLC8:1, CART+SCLC10:1 in the figure).

[0162] Control group (SCLC): GFP-SHP77 cells were cultured alone for 24 h.

[0163] The changes in the amount of GFP-SHP 77 were detected using the FITC channel using a flow cytometer.

[0164] The results are as follows Figure 6 As shown: Compared with the control group, in the experimental group, as the proportion of DLL3-CAR-T increased, the proportion of GFP-SHP77 continued to decrease, indicating that DLL3-CAR-T has a killing effect on SCLC.

Claims

1. A method for preparing CAR-T cells targeting DLL3, comprising the following steps: 1) Preparation of circular RNA targeting the DLL3 CAR structure, referred to as DLL3 circRNA; The DLL3 circRNA was prepared as follows: 1)-1. Prepare a plasmid expressing DLL3 circRNA, which contains the group I intron ribozyme sequence backbone fragment of the DLL3-CAR structural coding sequence; The group I intron ribozyme sequence backbone fragment of the DLL3-CAR structural coding sequence includes: 5' homology arm, 3' end of Anabaena T4 intron, CVB3_IRES_1, DLL3-CAR construct coding sequence, CVB3_IRES_2, 5' end and 3' homology arm of Anabaena T4 intron; The nucleotide sequence of CVB3_IRES_1 is SEQ ID NO: 185-934; The nucleotide sequence of CVB3_IRES_2 is positions 2528-2570 of sequence 2; 1)-2, linearizing the plasmid expressing DLL3 circRNA to obtain a linearized plasmid; The restriction enzyme cleavage site of the linearization enzyme is present in the region excluding the type I intron ribozyme sequence backbone fragment of the DLL3-CAR structural coding sequence in the plasmid; 1)-3. Amplifying the type I intron ribozyme sequence backbone fragment of the DLL3-CAR structural coding sequence from the linearized plasmid to obtain a type I intron ribozyme sequence backbone fragment amplification product; 1)-4, in vitro transcribing the amplified product of the group I intron ribozyme sequence backbone fragment to obtain a transcription product; 1)-5, adding GTP to the transcription product for incubation to achieve circularization and obtain DLL3 circRNA; 2) encapsulating the DLL3 circRNA in a lipid material to obtain LNPs encapsulating the DLL3 circRNA; 3) transfecting the LNPs encapsulating DLL3 circRNA into T cells to obtain DLL3-CAR-T cells, i.e., CAR-T cells targeting the DLL3 target; The 5' homology arm upstream of the type I intron ribozyme sequence backbone fragment of the DLL3-CAR structural coding sequence also includes a transcription promoter; Or, the nucleotide sequence of the 5' homology arm is positions 24-53 of SEQ ID NO: 2; Or, the nucleotide sequence at the 3' end of the Anabaena T4 intron is positions 54-184 of SEQ ID NO: 2; Alternatively, the nucleotide sequence of the DLL3-CAR structural coding sequence is positions 935-2527 of SEQ ID NO: 2; Or, the nucleotide sequence at the 5' end of the Anabaena T4 intron is positions 2571-2686 of SEQ ID NO: 2; Or, the nucleotide sequence of the 3' homology arm is SEQ ID NO: 2687-2721; Or, the transcription promoter is a T7 promoter; Or, the nucleotide sequence of the T7 promoter is positions 1-23 of SEQ ID NO: 2; The nucleotide sequence of the type I intron ribozyme sequence backbone fragment of the DLL3-CAR structural coding sequence is sequence 2.

2. The method according to claim 1, wherein: The T cells are CD3+ T cells.

3. DLL3-CAR-T prepared by the method of claim 1 or 2.

4. Any of the following substances: A1) a group I intron ribozyme sequence backbone fragment of the DLL3-CAR structural coding sequence according to any one of claims 1 to 2; A2) The plasmid expressing DLL3 circRNA according to any one of claims 1-2.

5. Use of any of the following substances in the preparation of DLL3-CAR-T; B1), a group I intron ribozyme sequence backbone fragment of the DLL3-CAR structural coding sequence according to any one of claims 1-2; B2), a plasmid expressing DLL3 circRNA according to any one of claims 1-2; B3), the plasmid expressing DLL3 circRNA according to any one of claims 1-2, the enzyme used for linearization, the primers used for amplification, the instrument or reagent required for in vitro transcription, the GTP and the lipid material.

6. Use of the DLL3-CAR-T described in claim 3 or the substance described in claim 4 in the preparation of a product for treating or killing small cell lung cancer.

7. A product for treating or killing small cell lung cancer, comprising the DLL3-CAR-T described in claim 3 or the substance described in claim 4.

Images