Dual TB Green real-time fluorescence quantitative PCR universal primer set and kit for identifying avian adenovirus DAdV-3 and FAdV-4

Abstract

The present invention relates to a universal primer set for dual TB Green real-time fluorescence quantitative PCR for identifying fowl adenovirus DAdV-3 and FAdV-4, DAdV-3-F: 5'-ATCGAAGTGTCAGATGAAGGAGTG-3', DAdV-3-R: 5'-CACCATCGGGGTTTAGTCGT-3'; FAdV-4-F: 5'-GGCTCCTTGTTACCTCCCTCTAC-3', FAdV-4-R: 5'-AGATAGGCGGACACCCAAAA-3'. The primer set can simultaneously identify clinically common DAdV-3 and FAdV-4, has good specificity and high sensitivity, can simplify operation time and save costs. At present, there is no research report on the primer set for dual TB Green real-time fluorescence quantitative PCR identification of fowl adenovirus DAdV-3 and FAdV-4, and the present invention can fill the gap in this field.

Description

Technical Field

[0001] The invention relates to a universal primer set for identifying avian adenovirus DAdV-3 and FAdV-4 double TB Green real-time fluorescence quantitative PCR and a kit thereof. Background Art

[0002] Avian adenovirus belongs to the Adenoviridae family and the Avian adenovirus genus. It is a non-enveloped double-stranded DNA virus. According to the ICTV classification (https: / / talk.ictvonline.org), the Adenoviridae family is divided into five genera, of which the Avian adenovirus genus is divided into 15 species, including Avian adenovirus A to E, Avian adenovirus A to B of pigeons, Avian adenovirus B to D of turkeys, Avian adenovirus B to C of parrots, Avian adenovirus A of falcons, Avian adenovirus B of ducks, and Avian adenovirus A of geese. The clinical manifestations include infection with inclusion body hepatitis (IBH), Hepatitises hydropericardium syndrome (HPS), and gizzard erosion. The main pathological changes are pericardial effusion and liver damage, resulting in a large number of liver necrosis and intranuclear inclusions in hepatocytes. Adenovirus can be transmitted both horizontally and vertically, causing huge losses to the breeding industry. Duck adenovirus type 3 (DAdV-3) and fowl adenovirus serotype-4 (FAdV-4) in the genus Adenovirus are the main pathogens prevalent in farms, causing huge economic losses to the poultry industry. Among them, FAdV-4 mainly infects chickens and pigeons, and is highly pathogenic to chickens. There are also reports of geese infected with FAdV-4 in clinical practice. In addition, more and more studies have shown that FAdV-4 can also infect ducks; while DAdV-3 mainly infects ducks and is very harmful to duck flocks. Pathological changes in autopsy show that both pathogens will cause pericardial effusion and hepatitis symptoms. Therefore, establishing a method to distinguish DAdV-3 and FAdV-4 in the genus Adenovirus can lay the foundation for the subsequent development of diagnostic kits and epidemiological surveys of important adenovirus subtypes in poultry. Summary of the invention

[0003] The purpose of the present invention is to provide a dual TB Green real-time fluorescence quantitative PCR universal primer set and a kit for identifying avian adenovirus DAdV-3 and FAdV-4, and establish a dual real-time fluorescence quantitative PCR method for detecting DAdV-3 and FAdV-4, so as to provide a rapid, universal, convenient and quantitative detection method for clinical identification and molecular epidemiological investigation of DAdV-3 and FAdV-4 in poultry (yellow-feathered broilers, river chickens, shell chickens, cherry valley ducks, shell ducks, etc.). At present, there is no universal real-time fluorescence quantitative PCR method that can simultaneously detect and distinguish DAdV-3 and FAdV-4 at home and abroad. The present invention can fill the gap in the relevant research field at home and abroad.

[0004] The purpose of the present invention is achieved by the following technical solution: a universal primer set for dual TBGreen real-time fluorescence quantitative PCR for identifying avian adenovirus DAdV-3 and FAdV-4, comprising the following:

[0005] Primers for DAdV-3:

[0006] DAdV-3-F: 5'-ATCGAAGTGTCAGATGAAGGAGTG-3' (SEQ ID NO. 1),

[0007] DAdV-3-R: 5'-CACCATCGGGGTTTAGTCGT-3' (SEQ ID NO. 2), target fragment size is 115 bp;

[0008] Primers for FAdV-4:

[0009] FAdV-4-F: 5'-GGCTCCTGTTACCTCCCTCTAC-3' (SEQ ID NO.3), FAdV-4-R: 5'-AGATAGGCGGACACCCAAAA-3' (SEQ ID NO.4),

[0010] The target fragment size is 115 bp.

[0011] A dual TB Green real-time fluorescence quantitative PCR detection method for identifying avian adenovirus DAdV-3 and FAdV-4 using the primer set, the method is not for diagnosis, the PCR reaction system of the method is: the following components are contained in a 20 μL system: reaction system TB Green Premix Dimer Eraser (2×) 10 μL, 10 μmol·L -1 DAdV-3-F 0.3 μL, 10 μmol·L -1 DAdV-3-R 0.3 μL, 10 μmol·L -1FAdV-4-F 0.3 μL, 10 μmol·L -1 0.3 μL of FAdV-4-R, 0.5 μL each of DAdV-3 template and FAdV-4 template or 1 μL of nucleic acid template to be tested, 7.8 μL of ddH2O;

[0012] The PCR reaction conditions were: 95°C for 30 s; 95°C for 5 s, 55°C for 30 s, 72°C for 30 s, for 40 cycles; after the cycles were completed, a corresponding melting curve was drawn.

[0013] Result judgment:

[0014] After the TB Green real-time fluorescence quantitative PCR reaction is completed, the melting curve peak (Tm value) is observed to analyze the test results: if a single peak appears at the Tm value of 79.80±0.07℃, it is judged as a positive test for DAdV-3; if a single peak appears at the Tm value of 84.95±0.09℃, it is judged as a positive test for FAdV-4; if these two Tm values ​​appear at the same time, it is judged as a mixed infection of DAdV-3 and FAdV-4.

[0015] The present invention also provides a kit for double TB Green real-time fluorescence quantitative PCR detection of avian adenoviruses DAdV-3 and FAdV-4, and the kit comprises the primer set.

[0016] The present invention provides a dual TB Green real-time fluorescence quantitative PCR universal primer set and a kit for identifying avian adenovirus DAdV-3 and FAdV-4, and establishes a dual real-time fluorescence quantitative PCR method for detecting DAdV-3 and FAdV-4, which has the following advantages:

[0017] 1. Based on the conserved regions of the Fiber2 gene sequences of avian adenoviruses DAdV-3 and FAdV-4, the present invention designs a set of universal primer sets for clinically detecting and distinguishing avian adenoviruses DAdV-3 and FAdV-4 by real-time fluorescence quantitative PCR differential diagnosis, and establishes a dual real-time fluorescence quantitative PCR method for detecting DAdV-3 and FAdV-4, providing a rapid, universal, convenient, and quantitative detection method for clinical identification and molecular epidemiological investigation of DAdV-3 and FAdV-4 in almost all poultry (such as yellow-feathered broilers, river chickens, hemp chickens, cherry valley ducks, hemp ducks, etc.). At present, there is no universal real-time fluorescence quantitative PCR method that can simultaneously detect and distinguish DAdV-3 and FAdV-4 at home and abroad, and the present invention can fill the gap in related research fields at home and abroad.

[0018] 2. It can simultaneously detect the two viral pathogens of avian adenovirus DAdV-3 and FAdV-4 in poultry flocks, simplifying operation time and saving costs.

[0019] 3. The results are intuitive and reliable. Infection with DAdV-3 and FAdV-4 is determined by the difference in Tm values. It only takes 2 hours from nucleic acid extraction to result determination, and 96 samples can be tested at one time.

[0020] 4. Accurate quantification: The viral load of the sample can be calculated based on the fluorescence quantitative Ct value.

[0021] 5. High sensitivity: The minimum detectable amount of DAdV-3 is 45.1 copies / μL and the minimum detectable amount of FAdV-4 is 17.4 copies / μL.

[0022] 6. Strong specificity: Common pathogens in poultry such as infectious bursal virus, avian influenza virus, goose astrovirus, Muscovy duck parvovirus, and Newcastle disease virus have no amplification curves and have specific Tm. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 It is the standard curve detected by the dual real-time fluorescence quantitative PCR method.

[0024] Figure 2 It is the melting curve detected by the dual real-time fluorescence quantitative PCR method.

[0025] Figure 3 This is the sensitivity analysis diagram of the dual real-time fluorescence quantitative PCR method for detecting pcDNA-DAdV3, where 1. The concentration of the standard is 4.51×10 8 copies / μL; 2. The concentration of the standard is 4.51×10 7 copies / μL; 3. The concentration of the standard is 4.51×10 6 copies / μL; 4. The concentration of the standard is 4.51×10 5 copies / μL; 5. The concentration of the standard is 4.51×10 4 copies / μL; 6. The concentration of the standard is 4.51×10 3 copies / μL; 7. The concentration of the standard is 4.51×10 2 copies / μL; 8. The concentration of the standard is 4.51×10 1 copies / μL.

[0026] Figure 4 The sensitivity analysis diagram of the dual real-time fluorescence quantitative PCR method for detecting pcDNA-FAdV4, where 1. The concentration of the standard is 1.74×10 8 copies / μL; 2. The concentration of the standard is 1.74×10 7 copies / μL; 3. The concentration of the standard is 1.74×10 6 copies / μL; 4. The concentration of the standard is 1.74×10 5 copies / μL; 5. The concentration of the standard is 1.74×104 copies / μL; 6. The concentration of the standard is 1.74×10 3 copies / μL; 7. The concentration of the standard is 1.74×10 2 copies / μL; 8. The concentration of the standard is 1.74×10 1 copies / μL.

[0027] Figure 5 This is a graph of the specific detection results of the dual real-time fluorescence quantitative PCR method; among them, 1, DAdV-3 sample; 2, FAdV-4 sample; 3, DAdV-3 and FAdV-4 mixed sample; 4-9, control samples DPV, IBDV, AIV, GAstV, MPV, NDV and normal chicken and duck liver tissues. DETAILED DESCRIPTION

[0028] The present invention is described in detail below with reference to the accompanying drawings and embodiments:

[0029] Embodiment 1:

[0030] 1 Materials and methods

[0031] 1.1 Viruses and clinical samples

[0032] Fowl adenovirus serotype 4 (FAdV-4), duck adenovirus type 3 (DAdV-3), duck plague virus (DPV), infectious bursal disease virus (IBDV), avian influenza virus (AIV), goose astrovirus (GAstV), Muscovy Duck Parvovirus (MDPV), and Newcastle disease virus (NDV) were identified, isolated, and preserved by the Institute of Animal Husbandry and Veterinary Medicine, Fujian Academy of Agricultural Sciences.

[0033] 1.2 Primer design

[0034] The complete gene sequences of FAdV-4 strain (GenBank No. MG856954.1) and DAdV-3 strain (GenBank No. MH777398.1) were downloaded from GenBank (sequenced in our laboratory and submitted to GenBank), and two pairs of specific fluorescence quantitative PCR primers were designed based on the conserved region of the Fiber2 gene sequence and synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0035] Table 1 Fluorescence quantitative PCR primers

[0036]

[0037] 1.3. Establishment of fluorescence quantitative PCR method

[0038] 1.3.1 Preparation of standards

[0039] Take 200 μL of purified DAdV-3 and FAdV-4 virus cell culture fluid, and extract viral DNA as template using Biospin virus DNA extraction kit of Hangzhou Bioflux. Adenovirus Fiber2 gene fragment was amplified by PCR, where DAdV-3 virus upstream primer DAdV3-F: ATGAAACGGACCAACAGATC, downstream primer DAdV3-R: CTAATTAACATTTGATGGGTTGC, and the amplified fragment was 1443 bp; FAdV-4 virus upstream primer FAdV4-F: ATGCTCCGAGCCCCTAAAAGAAG, downstream primer FAdV4-R: TTACGGGACGGAGGCCGCT, and the amplified fragment was 1425 bp. The PCR amplification system was 50 μL, including 25 μL of 2×PCR Master Mix, 2 μL of upstream and downstream primers, 1 μL of template, and 20 μL of ddH2O. The PCR reaction conditions were 94℃5min, 94℃ denaturation for 30s, 60℃30s, 72℃90s, for a total of 30 cycles; and finally 72℃ extension for 10min. The PCR amplification product was identified by 1% agarose nucleic acid electrophoresis and recovered by gel cutting. After BamHI and XhoI digestion, it was connected to the pcDNA3.1 vector backbone, including 1μL of 10×T4DNA Ligase Buffer, 1μL of vector backbone, 1μL of T4 DNA Ligase, 7μL of gene, and connected at 16℃ overnight. The ligation product was then transferred to Top10 competent cells, and a single colony was picked for PCR verification and sent to TaKaRa for sequencing verification. The positive recombinant plasmids pcDNA-DAdV3 and pcDNA-FAdV4 were sequenced correctly. The nucleic acid concentration of the positive recombinant plasmid was determined by Nanodrop, where the concentration of pcDNA-DAdV3 was 340ng / μL, and the recombinant plasmid copy number converted by the formula was 4.51×10 10 copies / μL; the concentration of pcDNA-FAdV4 was 131 ng / μL, and the recombinant plasmid copy number calculated by the formula was 1.74×10 10 copies / μL.

[0040] 1.3.2 Optimization of Dual TB Green Real-time Fluorescence Quantitative PCR Reaction Conditions

[0041] According to the TB Green instruction manual, 20 μL of real-time fluorescence quantitative PCR reaction system was prepared, and different reaction conditions were optimized at different final primer concentrations to determine the optimal reaction conditions for the established real-time fluorescence quantitative PCR method.

[0042] The optimized dual TB Green real-time fluorescence quantitative PCR optimal reaction system (20 μL) is as follows: reaction system TBGreen Premix Dimer Eraser (2×) 10 μL, 10 μmol·L -1 Primer DAdV-3-F 0.3 μL, 10 μmol·L -1 Primer DAdV-3-R 0.3 μL, 10 μmol·L -1 Primer FAdV-4-F 0.3 μL, 10 μmol·L -1 Primer FAdV-4-R 0.3 μL, DAdV-3 template, FAdV-4 template 0.5 μL each or nucleic acid template to be tested 1 μL, ddH2O 7.8 μL;

[0043] The optimal reaction conditions of the optimized dual TB Green real-time fluorescence quantitative PCR method are: 95℃30s; 95℃5s, 55℃30s, 72℃30s, 40 cycles; after the cycle, the corresponding melting curve is drawn.

[0044] 1.3.3 Single fluorescence quantitative PCR reaction

[0045] The prepared pcDNA-DAdV3 and pcDNA-FAdV4 plasmid standards were diluted 10 times in a gradient and used as templates. The fluorescent quantitative PCR amplification was performed using the optimized dual TB Green real-time fluorescent quantitative PCR reaction conditions (i.e., in the PCR reaction system, the nucleic acid template was pcDNA-DAdV3 1 μL or pcDNA-FAdV4 1 μL). Each gradient was repeated three times, and the amplification results were analyzed. At the same time, the melting curve was analyzed to exclude the interference of primer dimers and non-specific amplification. The reaction system was configured according to the TB Green manual, and the uninfected tissue sample was set as a negative control.

[0046] 1.3.4 Multiplex fluorescence quantitative PCR reaction

[0047] Real-time fluorescence quantitative PCR amplification reaction was carried out using the gradient diluted standard as a template according to the optimized dual TB Green real-time fluorescence quantitative PCR optimal reaction system and reaction conditions. At the same time, the uninfected tissue sample was set as the negative control, and the standard curve was established. At the same time, its melting curve was analyzed.

[0048] The specific results of 1.3.3 and 1.3.4 are as follows:

[0049] The prepared standard samples were diluted 10 times in series and then amplified by fluorescence quantitative PCR. The standard curve of fluorescence quantitative PCR with the logarithm of the copy number as the horizontal axis and the Ct value as the vertical axis was obtained by analysis with the system automatic analysis software ( Figure 1 ).Depend on Figure 1 It can be seen that in 10 1 ~10 8 In the range of copies / μL, the standard curves of the two standards constructed showed a good linear relationship. Among them, the amplification efficiency of DAdV-3 plasmid was 103%, the slope of the curve was -3.1007, the Y-axis intercept was 35.51, and the correlation coefficient R 2 is 0.99, the amplification efficiency of FAdV-4 plasmid is 94%, the slope of the curve is -3.0411, the Y-axis intercept is 36.32, and the correlation coefficient R 2 The value was 1.00, indicating that the established TB-Green dual real-time fluorescence quantitative PCR method for DAdV-3 and FAdV-4 had a good linear relationship.

[0050] Melting curve analysis:

[0051] The melting curve Tm of each dilution of the standard pcDNA-DAdV3 or pcDNA-FAdV4 plasmid has only one specific peak, and no mixed peaks appear. The melting temperature of the pcDNA-DAdV3 Fiber2 gene is 79.80±0.07℃, and the melting temperature of the pcDNA-FAdV4 Fiber2 gene is 84.95±0.09℃ (e.g. Figure 2 The dual fluorescence quantitative melting curve is shown in Figure 2 As shown in the figure, the melting curve has two specific peaks, which are 79.80±0.07℃ and 84.95±0.09℃. Therefore, the test results of clinical samples can be directly determined by observing the Tm peak of the melting curve. If the Tm value is 79.80±0.07℃ and a single peak appears, it is determined to be a positive test for DAdV-3; if the Tm value is 84.95±0.09℃ and a single peak appears, it is determined to be a positive test for FAdV-4; if these two Tm values ​​appear at the same time, it is determined to be a mixed infection of DAdV-3 and FAdV-4.

[0052] 1.3.5 Sensitivity test

[0053] Diluted by 10 times (10 1 -10 8 The pcDNA-DAdV3 and pcDNA-FAdV4 plasmid mixture with 100 copies / μL was used as a template, and the optimized DAdV3 and FAdV4 dual TB Green fluorescence quantitative method was established according to the present invention for amplification, and each dilution was repeated 3 times. The sensitivity of TB Green dual fluorescence quantitative PCR was determined, and uninoculated tissue samples were set as negative controls. The specific results are as follows:

[0054] The standard was diluted 10 times in series and amplified by fluorescence quantitative PCR according to the established conditions. The results showed that the double fluorescence quantitative PCR could detect a minimum of 45.1 copies / μL of DAdV3 samples ( Figure 3 ) and 17.4 copies / μL of FAdV4 sample ( Figure 4 ), indicating that the method established by the present invention has good sensitivity.

[0055] 1.3.6 Specificity test

[0056] The nucleic acids of viruses AIV, MPV, NDV, IBDV, DPV, and GAstV were extracted and the RNA was reverse transcribed to generate cDNA, which was amplified according to the detection method established in this experiment. At the same time, normal chicken liver tissue and duck liver tissue were set as negative controls, and DAdV-3 and FAdV-4 plasmid mixed nucleic acids were set as positive controls to detect the specificity of the method.

[0057] The established fluorescence quantitative PCR method was used to specifically detect DPV, IBDV, AIV, GAstV, MPV, and NDV. A mixed sample of DAdV-3 and FAdV-4 was selected as a positive control, and liver tissues of uninfected chickens and ducks were used as negative controls. The results are as follows: Figure 5 As shown, except for the positive control, no specific amplification curves appeared for other viruses and negative controls, indicating that the established dual fluorescence quantitative differential diagnosis method for DAdV-3 and FAdV-4 has good specificity.

[0058] 1.3.7 Repeatability test

[0059] The same batch of standards with different dilutions were repeated three times according to the established method for intra-group repeated tests, and the same concentration of standards diluted three times at different time periods were repeated between groups. The test results were statistically analyzed to analyze the repeatability of this method. At the same time, uninoculated tissue samples were set as negative controls.

[0060] Repeatability analysis:

[0061] To verify the repeatability of the established detection method, the standard plasmids of DAdV3 and FAdV4 were respectively 2 , 10 4 , 10 6 The dilution was repeated three times according to the established method for intra-group repeated tests, and inter-group repeated tests were performed on the standard of the same concentration diluted three times at different times. The results showed that the coefficient of variation of the intra-group test and the coefficient of variation of the inter-group test were ≤0.79% and ≤1.46%, respectively, indicating that the method has high repeatability.

[0062] Table 2 Real-time fluorescence quantitative PCR repeated experiments

[0063]

[0064] 1.4 Testing of clinical samples

[0065] For 28 clinical samples sent for inspection from farms (chickens, ducks, geese, and pigeons) in different regions of Fujian Province in 2022, all clinically showed symptoms of pericardial effusion and hepatitis. The diseased tissues were processed according to conventional methods, and viral nucleic acids were extracted by the EasyPure Viral DNA / RNA Kit, wherein the RNA samples were reverse transcribed by the PrimeScriptRT reagent kit to generate cDNA templates for standby use. Synchronous detection was performed using the TB Green fluorescent quantitative PCR detection method established by the present invention. After the real-time fluorescent quantitative PCR reaction was completed, the clinical sample test results were determined by observing the Tm peak of the melting curve.

[0066] The dual fluorescence quantitative PCR method for DAdV-3 and FAdV-4 established by the present invention was used to detect the above 28 clinical suspected samples, of which 8 samples were detected as positive, with a positive rate of 28.57%, while only 6 samples were detected as positive by the conventional PCR detection method, with a positive detection rate of 21.43%, indicating that the dual fluorescence quantitative PCR detection method established by the present invention is more sensitive. Among the positive samples detected, a total of 6 samples were infected with DAdV-3, with a positive rate of 21.43%; 2 samples were infected with FAdV-4, with a positive rate of 7.14%; the melting curve Tm of 1 sample had a double peak, that is, there was a mixed infection of DAdV-3 and FAdV-4, and the positive rate was 3.57%. The specific results are shown in Table 3, where the primers used for conventional PCR are:

[0067] The upstream primer of DAdV-3 virus is DAdV3-F: ATGAAACGGACCAACAGATC, and the downstream primer is DAdV3-R: CTAATTAACATTTGATGGGTTGC. The amplified fragment is 1443 bp.

[0068] The upstream primer of FAdV-4 virus is FAdV4-F: ATGCTCCGAGCCCCTAAAAGAAG, and the downstream primer is FAdV4-R: TTACGGGACGGAGGCCGCT. The amplified fragment is 1425bp.

[0069] Table 3 Test results of suspected samples collected from clinical sites

[0070]

[0071] The above-mentioned embodiments are intended to illustrate that the present invention can be implemented or used by professionals in the field. Modifications to the above-mentioned embodiments will be obvious to professionals in the field. Therefore, the present invention includes but is not limited to the above-mentioned embodiments. Any method, process, or product that complies with the claims or description of the specification and complies with the principles and novelty and creative features disclosed herein falls within the scope of protection of the present invention.

Claims

1. A universal primer set for dual TB Green real-time fluorescence quantitative PCR for identifying avian adenovirus DAdV-3 and FAdV-4, characterized in that: The primer set comprises: Primers for DAdV-3: DAdV-3-F: 5'-ATCGAAGTGTCAGATGAAGGAGTG-3', DAdV-3-R: 5'-CACCATCGGGGTTTAGTCGT-3', The target fragment size is 115 bp; Primers for FAdV-4: FAdV-4-F: 5'-GGCTCCTGTTACCTCCCTCTAC-3', FAdV-4-R: 5'-AGATAGGCGGACACCCAAAA-3', The target fragment size is 115 bp.

2. A dual TB Green real-time fluorescence quantitative PCR detection method for identifying avian adenovirus DAdV-3 and FAdV-4 using the primer set of claim 1, wherein the method is not for diagnosis and is characterized in that: The PCR reaction system contained the following components in a 20 μL system: 10 μL of TB Green Premix DimerEraser (2×), 10 μmol·L -1 Primer DAdV-3-F 0.3 μL, 10 μmol·L -1 Primer DAdV-3-R 0.3 μL, 10 μmol·L -1 Primer FAdV-4-F 0.3 μL, 10 μmol·L -1 Primer FAdV-4-R 0.3 μL, DAdV-3 template, FAdV-4 template 0.5 μL each or nucleic acid template to be tested 1 μL, ddH2O 7.8 μL; The PCR reaction conditions were: 95°C for 30 s; 95°C for 5 s, 55°C for 30 s, 72°C for 30 s, for 40 cycles; after the cycles were completed, a corresponding melting curve was drawn.

3. A kit for dual TB Green real-time fluorescence quantitative PCR detection of DAdV-3 and FAdV-4, characterized in that: The kit comprises the primer set according to claim 1.

Images