lncRNA43234 gene sequence and cloning method thereof and application in regulating fatty acid anabolism in plants

Abstract

The lncRNA43234 gene sequence and its cloning method and its application in regulating fatty acid anabolism in plants, relate to the field of gene sequence engineering. The present invention screened and successfully cloned the lncRNA43234 gene sequence (SEQ ID NO: 1), constructed the lncRNA43234 overexpression vector plasmid, and genetically transformed Arabidopsis to explore the effect of the lncRNA43234 gene sequence on pathways related to plant fatty acid anabolism. The results showed that Arabidopsis plants showed reduced fat content and increased fat content, respectively, which proved that the lncRNA43234 gene sequence can effectively regulate the fatty acid content of plants; by regulating the expression of the lncRNA43234 gene sequence in plants and then using it to cultivate new plant varieties with regulated fatty acid content, it provides a new idea for plant molecular breeding improvement and increasing plant fatty acid content.

Description

Technical Field

[0001] The present invention relates to the technical field of gene sequence engineering, and in particular to a lncRNA43234 gene sequence and a cloning method thereof, and an application thereof in regulating plant fatty acid anabolism. Background Art

[0002] Fatty acid metabolism is one of the most important metabolic pathways in plants, and fatty acids have important uses in food and industrial production. Research work on improving the fatty acid content and composition in plant seeds to meet food and industrial needs has received more and more attention. Although there are many kinds of plants with high fatty acid content, most of their varieties do not have good agronomic traits, so some scientific and technological means are used to improve their quality. Traditional plant breeding methods are susceptible to the limitations of the inherent natural traits of plants. With the development of molecular biology and genetic engineering technology, the plant fatty acid metabolic pathways have been gradually studied clearly. At the same time, the separation and cloning of key enzyme genes in the process of fatty acid metabolism regulation have made it possible to improve fat quality using genetic engineering methods. Therefore, how to screen a gene sequence that can regulate the fatty acid content of plants and how to cultivate new plant varieties with regulated fatty acid content have become major technical problems that need to be solved in this field.

[0003] Long non-coding RNAs (LncRNAs) are longer than 200 nt and have no protein coding ability. Most of them are present in the chromatin of the nucleus and subnuclear compartments of cells. A large number of lncRNAs have been identified as important regulatory factors in plants, participating in plant growth and development. Summary of the invention

[0004] The purpose of the present invention is to provide a lncRNA43234 gene sequence and a cloning method thereof and application in regulating plant fatty acid anabolism.

[0005] The technical solution adopted by the present invention to solve the technical problem is as follows:

[0006] The present invention provides a lncRNA43234 gene sequence, and the lncRNA43234 gene sequence information is shown in SEQ ID NO: 3.

[0007] The present invention provides a method for cloning a lncRNA43234 gene sequence, which specifically comprises the following steps:

[0008] The wild type soybean JN18 was mutated by chemical mutagen ethyl methanesulfonate to obtain the soybean low linolenic acid mutant MT72; the cDNA of the young pods of the soybean low linolenic acid mutant MT72 after flowering was used as a template, and the specific band of 86 bp was obtained by RT-PCR technology; 3'RACE and 5'RACE gene specific primers were designed, and the 3' terminal sequence of 104 bp in length was obtained by RACE amplification as shown in SEQ ID NO: 1 and the 5' terminal sequence of 1137 bp in length was obtained as shown in SEQ ID NO: 2;

[0009] The 3'RACE and 5'RACE gene-specific primer sequence information is as follows:

[0010] 5′ RACE gene-specific antisense primer (GSP): 5′-GATTACGCCAAGCTTTTCTGGGGGAGGGGTCATTTCGTTTT-3′;

[0011] 3′ RACE gene-specific antisense primer (GSP): 5′-GATTACGCCAAGCTTTTCTAGATCAAAAACGAAATGACCCCTCCC-3′;

[0012] Universal forward primer for RACE: 5′-CTAATACGACTCACTATAGGGC-3′;

[0013] The 3' end sequence and the 5' end sequence were sequenced and spliced ​​to obtain a lncRNA43234 gene sequence with a length of 1100 bp as shown in SEQ ID NO: 3.

[0014] The present invention provides an application of a lncRNA43234 gene sequence in regulating fatty acid anabolism in plants.

[0015] As a preferred embodiment, the plant is Arabidopsis thaliana.

[0016] The present invention provides a lncRNA43234 overexpression vector plasmid, which comprises the lncRNA43234 gene sequence of the present invention.

[0017] The present invention provides a method for constructing a lncRNA43234 overexpression vector plasmid, which specifically comprises the following steps:

[0018] The pCAMBIA3301 vector was double-digested with restriction endonucleases NcoI and BstEII. After gel recovery, RT-PCR technology was used to obtain vector fragments of 11319 bp, 9258 bp, and 2061 bp. The lncRNA43234 gene sequence was seamlessly connected to each vector fragment, and the connection product was transformed into Escherichia coli DH5α competent cells by heat shock method. Positive clones were screened on kanamycin-resistant LB medium, and plasmids were extracted. After successful sequencing, the lncRNA43234 overexpression vector plasmid was obtained, named pCAMBIA3301-35S-lncRNA43234.

[0019] The present invention provides a lncRNA43234 transgenic Arabidopsis plant, which comprises the lncRNA43234 overexpression vector plasmid of the present invention.

[0020] The present invention provides a method for obtaining a lncRNA43234 transgenic Arabidopsis thaliana plant, which specifically comprises the following steps:

[0021] The lncRNA43234 overexpression vector plasmid pCAMBIA3301-35S-lncRNA43234 was transformed into Agrobacterium EHA105 competent cells by freeze-thaw method to obtain bacterial solution; the bacterial solution was resuspended in infection solution to OD 600 The value is 0.8-1.0; soak the Arabidopsis fluff in a beaker filled with infection solution, seal the infected Arabidopsis, place it in a light-proof environment at 26-30℃ for 20-28h, and then place it in an artificial climate chamber for cultivation; after harvesting the Arabidopsis seeds, use a pipette to absorb the infected Arabidopsis seeds and spot them in a culture pot; after the seedlings grow out, spray them with herbicides until some plants turn dry and yellow; the plants that have been sprayed with herbicides but can still grow healthily are identified as T1 generation Arabidopsis positive plants, and transplanted to a slightly larger culture pot. When they reach the rosette stage, the Arabidopsis genome is extracted and PCR positive plants are tested to obtain T2 generation lncRNA43234 transgenic Arabidopsis plants.

[0022] As a preferred embodiment, the infection solution is: 2.2 g MS powder, 50 g sucrose, 1000×1 mL B5 vitamins, 10 μl 100 mg / μl 6BA, 90 μl 1 mol / L NaOH, and 200 μl surfactant Silwet L-77.

[0023] The present invention provides a method for regulating fatty acid anabolism in plants, which is achieved by regulating the expression of the lncRNA43234 gene sequence in plants.

[0024] The beneficial effects of the present invention are:

[0025] The present invention uses wild-type soybean "JN18" (Jishendou 2006) and soybean low-linolenic acid mutant "MT72" as materials, takes the cDNA of young pods of soybean low-linolenic acid mutant "MT72" 30 days after flowering as a template for transcriptome sequencing, combines bioinformatics analysis, screens and successfully clones the differentially expressed fatty acid anabolism-related lncRNA43234 full-length cDNA sequence (SEQ ID NO: 3), constructs an lncRNA43234 overexpression vector plasmid, and through Arabidopsis genetic transformation, explores the effect of the lncRNA43234 gene sequence on plant fatty acid anabolism-related pathways, and expands the report of plant fatty acid anabolism-related lncRNAs. Through research, it was found that by using the lncRNA43234 overexpression vector plasmid to introduce the lncRNA43234 gene sequence into Arabidopsis plants, the gene sequence was overexpressed and interfered with respectively, and the expression level and function of the obtained plants related to fatty acids were analyzed. The results showed that the Arabidopsis plants showed reduced fat content and increased fat content respectively, which proved that the lncRNA43234 gene sequence can effectively regulate the fatty acid content of the plant; the present invention can be used to cultivate new plant varieties with regulatable fatty acid content by regulating the expression of the lncRNA43234 gene sequence in the plant, which provides a new idea for plant molecular breeding improvement and increasing the fatty acid content of the plant. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 It is the 86 bp specific band obtained in Example 1.

[0027] Figure 2 This is the electrophoresis diagram of the amplified product of lncRNA43234 gene in Example 1. In the figure, M: DL2000 DNA marker; 1-6: target gene.

[0028] Figure 3 This is the electrophoresis diagram of the double enzyme digestion product of pCAMBIA3301 vector in Example 2. In the figure, M: DL10000 DNA marker; 1: single enzyme digestion result; 2: double enzyme digestion result.

[0029] Figure 4 This is the effect of overexpression of lncRNA43234 gene sequence on the expression of key enzyme genes related to fatty acid synthesis. In the figure, * indicates a statistical difference of p<0.05, ** indicates a statistical difference of p<0.01, and *** indicates a statistical difference of p<0.001.

[0030] Figure 5 The fatty acid detection profile of Arabidopsis seeds. In the figure, a is the fatty acid detection profile of wild-type Arabidopsis seeds, and b is the fatty acid detection profile of T2 generation lncRNA43234 transgenic Arabidopsis seeds. DETAILED DESCRIPTION

[0031] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0032] The experimental methods used in the following examples are conventional methods unless otherwise specified, and the reagents and materials used are commercially available unless otherwise specified. Among them, Escherichia coli DH5α competent cells were purchased from Quanshijin Biological Company; Agrobacterium EHA105 competent cells were purchased from Beijing Zhuangmeng International Biological Company; pCAMBIA3301 vector was preserved by this laboratory (Jilin Agricultural University Oil Crops Molecular Breeding Laboratory), and various pharmaceutical reagents were purchased from Kangwei Jiangsu Reagent Biotechnology Co., Ltd. unless otherwise specified.

[0033] Example 1 Cloning of lncRNA43234 gene sequence

[0034] Materials: Wild soybean "JN18" (Jishendou 2006) (a high-oil and high-yield soybean variety bred by the Biotechnology Center of Jilin Agricultural University, and the main soybean variety currently promoted in Jilin Province) and soybean low linolenic acid mutant "MT72"; wild soybean "JN18" (Jishendou 2006) was induced with 0.5% chemical mutagen ethyl methanesulfonate (EMS) for 6 hours to obtain the M5 stable strain, namely soybean low linolenic acid mutant "MT72". Using the cDNA of young pods of soybean low linolenic acid mutant "MT72" 30 days after flowering as a template, RT-PCR technology (reagents are Kangwei Century's 2xTaq MasterMix (Dye), item number CW0682, reaction program is pre-94℃2min; denaturation at 94℃30sec, annealing at 58℃30sec, extension at 72℃30sec, 30 cycles; final extension at 72℃2min) to obtain a specific band of 86bp in size ( Figure 1 ).

[0035] 3'RACE and 5'RACE gene-specific primers were designed and amplified by RACE (the reagent was Takara's SMARTerRACE 5' / 3'Kit, catalog number 634858, and the reaction program was 94℃ 30sec, 72℃ 3min, 5 cycles; 94℃ 30sec, 70℃ 30sec, 72℃ 3min, 5 cycles; 94℃ 30s, 68℃ 30s, 72℃ 3min, 25 cycles), and finally a 3' terminal sequence with a length of 107bp (SEQ ID NO: 1) and a 5' terminal sequence with a length of 1137bp (SEQ ID NO: 2) were obtained.

[0036] The sequence information of 3'RACE and 5'RACE gene-specific primers is as follows:

[0037] 5′ RACE gene-specific antisense primer (GSP): 5′-GATTACGCCAAGCTTTTCTGGGGGAGGGGTCATTTCGTTTT-3′;

[0038] 3′ RACE gene-specific antisense primer (GSP): 5′-GATTACGCCAAGCTTTTCTAGATCAAAAACGAAATGACCCCTCCC-3′;

[0039] RACE universal forward primer: 5'-CTAATACGACTCACTATAGGGC-3'.

[0040] Subsequently, the 3' and 5' end sequences were sequenced and spliced ​​(forward primer F: 5'-CCAACCCATTCCTTCTCC-3'; reverse primer R: 5'-TTTGTTTGCCTCCTGTGA-3') to obtain the CDS coding sequence of the lncRNA43234 gene sequence. The electrophoresis detection results of the lncRNA43234 gene amplification product are as follows Figure 1 As shown, the CDS coding sequence (SEQ ID NO: 3) of the lncRNA43234 gene sequence is 1100 bp in length.

[0041] Example 2 Construction of lncRNA43234 overexpression vector plasmid

[0042] The pCAMBIA3301 vector was double-digested with restriction endonucleases NcoI and BstEII. After gel recovery, an agarose gel recovery kit (Company: Kangwei Century, Catalog No. 9762) was used to recover the pCAMBIA3301 basic vector fragment detected by 1.0% agarose gel electrophoresis to obtain vector fragments of 11319 bp, 9258 bp, and 2061 bp in size ( Figure 3 ).

[0043] The CDS coding sequence of the lncRNA43234 gene sequence was seamlessly connected to the vector fragments obtained above, and the connection product was transformed into Escherichia coli DH5α competent cells by the heat shock method. Positive clones were screened on kanamycin-resistant LB medium, and then plasmid extraction was performed. After successful sequencing, the lncRNA43234 overexpression vector plasmid was obtained and named pCAMBIA3301-35S-lncRNA43234.

[0044] Example 3 Obtaining lncRNA43234 transgenic Arabidopsis plants

[0045] The lncRNA43234 overexpression vector plasmid pCAMBIA3301-35S-lncRNA43234 was transformed into Agrobacterium EHA105 competent cells by freeze-thaw method to obtain bacterial solution; the infection solution was prepared: MS powder 2.2g, sucrose 50g, B5 vitamin 1000×1mL, 100mg / μl 6BA 10μl, 1mol / LNaOH 90μl, surfactant SilwetL-77200μl; resuspend the bacterial solution with the prepared infection solution to an OD value of 0.8-1.0; soak the Arabidopsis fluff in a beaker filled with the infection solution, seal the infected Arabidopsis, place it in a dark environment at 28℃ for 24h, and then place it in an artificial climate chamber for cultivation; after harvesting the Arabidopsis seeds, use a pipette to absorb the infected Arabidopsis seeds and point them in a culture pot; after the seedlings grow out, spray them with 150ng / ml herbicide (Basta) every 2d until some plants turn dry and yellow; the plants that have been sprayed with herbicides but can still grow healthily are temporarily identified as T1 generation Arabidopsis positive plants, and transplanted to a slightly larger culture pot. When they reach the rosette stage, the Arabidopsis genome is extracted and PCR positive plants are tested; T2 generation lncRNA43234 transgenic Arabidopsis plants are obtained.

[0046] Example 4 Effect of overexpression of lncRNA43234 gene sequence on the expression of key enzyme genes related to fatty acid synthesis

[0047] qRT-PCR technology (reagents are TB Premix Ex Taq TMThe company is TaKaRa, the product number is RR420, and the reaction program is 95℃30sec; 95℃5sec, 60℃30sec, 72℃30s, 40 cycles; 95℃15sec, 60℃1min, 95℃15sec) to detect the relative expression of the transcription factor WRINKLED1 (WRI1) and four key enzyme genes (β-ketoacyl-ACP synthase III (KASⅢ), fatty acid dehydrogenase (FAD2), 3-phosphoglycerate acyltransferase (GPAT) and lysophosphatidic acid acyltransferase (LPAAT)) related to fatty acid synthesis in T2 generation lncRNA43234 transgenic Arabidopsis thaliana and wild-type Arabidopsis thaliana plants.

[0048] Based on the qRT-PCR primer design principles, Primer 6.0 software was used to design specific primers. The sequence information of the designed specific primers is as follows:

[0049]

[0050]

[0051] The expression levels of key enzyme genes (β-ketoacyl-ACP synthase III (KASⅢ), fatty acid dehydrogenase (FAD2), 3-phosphoglycerate acyltransferase (GPAT) and lysophosphatidic acid acyltransferase (LPAAT)) in T2 generation lncRNA43234 transgenic Arabidopsis and wild-type Arabidopsis were detected by qRT-PCR.

[0052] The results are as follows Figure 4 As shown in the figure, the expression levels of AtWRI1, AtKASIII, AtFAD2 and AtLPAAT in the T2 generation lncRNA43234 transgenic Arabidopsis plants were significantly higher than those in the wild-type Arabidopsis plants; while the expression levels of AtGPAT in the T2 generation lncRNA43234 transgenic Arabidopsis plants and wild-type Arabidopsis plants were opposite. This indicates that the lncRNA43234 gene sequence directly or indirectly affects the expression of AtWRI1, AtKASIII, AtFAD2 and AtLPAAT, and then confirms that the lncRNA43234 gene sequence can participate in the anabolism of Arabidopsis fat.

[0053] Example 5 Effect of overexpression of lncRNA43234 gene sequence on fatty acid content

[0054] The fatty acid content in the seeds of T2 generation lncRNA43234 transgenic Arabidopsis thaliana plants and the seeds of wild-type Arabidopsis thaliana plants was detected by GB 5009.168-2016S National Food Safety Standard Determination of Fatty Acids in Food (Third Method).

[0055] The results are as follows Figure 5 As shown in a and b in the figure, the oleic acid content in the seeds of the T2 generation lncRNA43234 transgenic Arabidopsis plants is significantly lower than that in the seeds of the wild-type Arabidopsis plants, which is consistent with the conclusion in Example 4 that the expression level of fatty acid dehydrogenase (FAD2) in the T2 generation lncRNA43234 transgenic Arabidopsis plants is significantly higher than that in the wild-type Arabidopsis plants, thereby confirming that the lncRNA43234 gene sequence can participate in the regulation of Arabidopsis fatty acids.

[0056] The present invention discloses a lncRNA43234 gene sequence and a cloning method thereof and its application in regulating plant fatty acid anabolism. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters for implementation. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The products of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the products described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0057] Sequence Listing

[0058] <110> Jilin Agricultural University

[0059] <120> lncRNA43234 gene sequence and cloning method thereof and application in regulating plant fatty acid anabolism

[0060] <160> 3

[0061] <210> 1

[0062] <211> 107

[0063] <212> DNA

[0064] <213> Artificial sequence

[0065] <400> 1

[0066] aatgtgcccgacaatccgaaagaattctgggggaggggtcatttcgtttttgatctagaaaagcttgagcgtaatcaaatgg

[0067] gcaattccagcacactggcggccgt

[0068] <210> 2

[0069] <211> 1137

[0070] <212>DNA

[0071] <213>Artificial sequence(人工序列)

[0072] <400>2

[0073] cttatacgactcactatagggcaagcagtggtatcaacgcagagtacaggggagctacagagattaatgcagtcaattatg

[0074] tttctcctagaagttggttagctacttctcattttgttctaggattcttcctatttgtaggccatttatggcacgcgggaagagctc

[0075] gcgcagctgccgcaggatttgaaaaaggaattgatcgagattttgaaccagttctttccatgactcctcttaattgagacatga

[0076] gatcctatgaagtagaaatcacttttattttactataaatattactataaatattgggttgaattgagcgggtcgtatttaaataag

[0077] aatttcttttccttttttcttagtttctatcgaaaaaaaaaaagattcgatagaaactaagaaagtaaacaaattgattcgccgag

[0078] aaagaggagagagagggattcgaaccctcgatagttctttgttccgaactataccggttttcaagaccggggctatcaacc

[0079] actcagccatctctccaaaagctaatttatattttatctttattccactgaatagaacatgagcatataaatggataccctttatatt

[0080] atctatctttatattatctataaagggtaaagatatccgatgtgaatctatttgtttagttttctatcggtatgtatataggtgaataat

[0081] ccaacatgcctttttgtgaagtaaaaaaactaccctcgatccatgcctcaaaagggttgataataagtaaaaaaaatcaatga

[0082] attcatgataaaacccttctgcgttttttattataaatttttttgtcaataaagggatcaaggggttgggggatcaaatggtaaagt

[0083] tcttttgttggtaaattggaggattagaaacatgactattgctttccaattagctgtttttgcattaattgctatttcatttattttattga

[0084] ttagtgtacctgttgtatttgcttctcctgaaggttggtcgaataacaaaaatgttgtattttccggtacatcattatggattggatt

[0085] agtgtttctcgtgggtattcttaattctctcatttcttgaagctctatttattctagatcaaaaacgaaatgacccctcccccagaa

[0086] aagcttggcgtaatca

[0087] <210>3

[0088] <211>1100

[0089] <212>DNA

[0090] <213>Artificial sequence(人工序列)

[0091] <400>3

[0092] acaggggagctacagagattaatgcagtcaattatgtttctcctagaagttggttagctacttctcattttgttctaggattcttcc

[0093] tatttgtaggccatttatggcacgcgggaagagctcgcgcagctgccgcaggatttgaaaaaggaattgatcgagattttga

[0094] accagttctttccatgactcctcttaattgagacatgagatcctatgaagtagaaatcacttttattttactataaatattactataa

[0095] atttgggttgaattgagcgggtcgtatttaaataagaatttcttttccttttttcttagtttctatcgaaaaaaaaaaagattcgata

[0096] gaaactaagaaagtaaacaaattgattcgccgagaaagaggagagagagggattcgaaccctcgatagttctttgttccga

[0097] actataccggttttcaagaccggggctatcaaccactcagccatctctccaaaagctaatttatattttatctttattccactgaat

[0098] agaacatgagcatataaatggataccctttatattatctatctttatattatctataaagggtaaagatatccgatgtgaatctattt

[0099] gtttagttttctatcggtatgtatataggtgaataatccaacatgcctttttgtgaagtaaaaaaactaccctcgatccatgcctc

[0100] aaaaagggttgataataagtaaaaaaaaatcaatgaattcatgataaaacccttctgcgttttttattataaatttttttgtcaataaag

[0101] ggatcaaggggttgggggatcaaatggtaaagttcttttgttggtaaattggaggattagaaacatgactattgctttccaatt

[0102] agctgtttttgcattaattgctatttcatttattttattgattagtgtacctgttgtatttgcttctcctgaaggttggtcgaataacaaa

[0103] aatgttgtattttccggtacatcattatggattggattagtgtttctcgtgggtattcttaattctctcatttcttgaagctctatttatt

[0104] ctagatcaaaaacgaaatgacccctcccccagaattctttcggattgtcgggcacatt

Claims

1. Application of overexpressing lncRNA43234 gene sequence in reducing oleic acid content in Arabidopsis seeds, characterized in that: The lncRNA43234 gene sequence information is SEQ ID NO:

3.

2. A lncRNA43234 overexpression vector plasmid comprising a lncRNA43234 gene sequence, characterized in that: The lncRNA43234 gene sequence information is SEQ ID NO:

3.

3. The method for constructing the lncRNA43234 overexpression vector plasmid according to claim 2, characterized in that: The following steps are involved: The pCAMBIA3301 vector was double-digested with restriction endonucleases NcoI and BstEII. After gel recovery, RT-PCR technology was used to obtain vector fragments of 11319 bp, 9258 bp, and 2061 bp. The lncRNA43234 gene sequence was seamlessly connected to each vector fragment, and the connection product was transformed into Escherichia coli DH5α competent cells by heat shock method. Positive clones were screened on kanamycin-resistant LB medium, and plasmids were extracted. After successful sequencing, the lncRNA43234 overexpression vector plasmid was obtained, named pCAMBIA3301-35S-lncRNA43234.

4. A method for obtaining a lncRNA43234 transgenic Arabidopsis plant comprising the lncRNA43234 overexpression vector plasmid according to claim 2, characterized in that: The following steps are involved: The pCAMBIA3301 vector was double-digested with restriction endonucleases NcoI and BstEII. After gel recovery, RT-PCR was used to obtain vector fragments of 11319 bp, 9258 bp, and 2061 bp. The lncRNA43234 gene sequence was seamlessly connected to each vector fragment, and the connection product was transformed into Escherichia coli DH5α competent cells by heat shock method. Positive clones were screened on kanamycin-resistant LB medium, and plasmids were extracted. After successful sequencing, the lncRNA43234 overexpression vector plasmid was obtained, named pCAMBIA3301-35S-lncRNA43234. The lncRNA43234 overexpression vector plasmid pCAMBIA3301-35S-lncR NA43234 was used to transform competent cells of Agrobacterium EHA105 to obtain bacterial liquid; the bacterial liquid was resuspended with infection liquid to an OD value of 0.8-1.0; Arabidopsis fluff was immersed in a beaker filled with infection liquid, the infected Arabidopsis was sealed, and placed in a light-proof environment at 26-30°C for 20-28 hours before being placed in an artificial climate chamber for cultivation; after harvesting Arabidopsis seeds, the infected Arabidopsis seeds were sucked with a pipette and dotted in a culture pot; after the seedlings grew out, they were sprayed with herbicides until some plants turned dry and yellow; the plants that were sprayed with herbicides but still grew healthily were identified as T1 generation Arabidopsis positive plants, and the seedlings were transplanted to a slightly larger culture pot. When they reached the rosette stage, the Arabidopsis genome was extracted, and PCR positive plants were tested, thereby obtaining T2 generation lncRNA43234 transgenic Arabidopsis plants.

Images