Bacillus subtilis capable of fermenting to produce surfactin by utilizing ammonium salt and application thereof

Abstract

This invention discloses a Bacillus subtilis strain capable of producing surfactant through ammonium salt fermentation and its applications. This Bacillus subtilis strain is classified as... Bacillus subtilis LJ-33, with accession number CCTCC NO: M 20222078, is a strain that can produce surfactantin by fermentation using inexpensive inorganic nitrogen NH4Cl as the sole nitrogen source. It boasts advantages such as uncontrolled fermentation feedstock, low cost, high yield, and high production rate, demonstrating significant application potential.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to a strain of Bacillus subtilis that can efficiently utilize NH4Cl as a nitrogen source and its applications. Background Technology

[0002] In most industrial microbial production processes, carbon and nitrogen sources often account for 50-90% of the main raw material costs. Nitrogen sources can be divided into organic and inorganic sources, with significant price differences. Generally, organic nitrogen sources are more expensive, mainly peptone and yeast extract, ranging from 10,000-40,000 yuan / ton; while inorganic nitrogen sources are cheaper, mainly ammonium salts and nitrates, with ammonium chloride being the cheapest, typically priced at 600-1000 yuan / ton. Nitrates such as sodium nitrate and ammonium nitrate are easily explosive chemicals, subject to strict regulations in procurement, storage, and use, inevitably leading to higher management costs when used as fermentation nitrogen sources. Therefore, production strains that efficiently utilize ammonium chloride as a nitrogen source have a significant low-cost advantage. Currently, most lipopeptide production strains isolated from nature are Bacillus, but optimized fermentation nitrogen sources are usually ammonium nitrate, sodium nitrate, or organic nitrogen sources. Genetic engineering of the model strain Bacillus subtilis strain 168 can also yield a high-yield strain of the lipopeptide surfactantin; its fermentation nitrogen source is also ammonium nitrate, sodium nitrate or organic nitrogen source.

[0003] The assimilation of inorganic nitrogen by microbial cells involves the combined reaction of glutamine synthase and glutamate synthase, converting NH4+ into nitrogen. + Nitrogen is converted into glutamine and glutamate, becoming amino acid donors for the production of other amino acids. However, each microorganism has its own specific nitrogen assimilation system, which involves many regulatory proteins. For example, the global regulatory proteins GlnR, TnrA, and CodY are all involved in the transcriptional regulation of related enzymes, mediating nitrogen assimilation. Therefore, nitrogen assimilation is a complex metabolic regulatory system, and it is difficult to improve nitrogen assimilation capacity by modifying one or a few genes. Summary of the Invention

[0004] The primary objective of this invention is to provide a Bacillus subtilis strain capable of producing surfactant through fermentation using ammonium salts.

[0005] To achieve the above technical objectives, the present invention adopts the following technical solution:

[0006] A strain of Bacillus subtilis that can produce surfactant through fermentation using ammonium salts has been classified as Bacillus subtilis LJ-33 and its accession number is CCTCC NO: M 20222078.

[0007] Another object of the present invention is to provide the application of the above-mentioned Bacillus subtilis in the fermentation production of surfactantin.

[0008] In a preferred embodiment, the nitrogen source for fermentation is ammonium salt.

[0009] As a preferred embodiment, Bacillus subtilis is fermented using ammonium chloride as the sole nitrogen source to produce surfactantin.

[0010] In a preferred embodiment, metal ions are added to the fermentation culture medium; the metal ions are Fe. 2+ Mn 2+ or Mg 2+ One or more of the following; preferably, three metal ions are added simultaneously.

[0011] In a preferred embodiment, the concentration of added metal ions is: Fe 2+ : 0.25-1.25mM; Mn 2+ 0.002-0.500mM; Mg 2+ : 0.5-4mM.

[0012] As a preferred embodiment, L-leucine is added to the fermentation culture medium.

[0013] In a preferred embodiment, the fermentation culture medium consists of the following components: sucrose, NH4Cl, L-leucine, dipotassium hydrogen phosphate, and Fe. 2+ Mn 2+ Mg 2+ Defoamer.

[0014] In a preferred embodiment, after seed culture of Bacillus subtilis, the culture is inoculated again into seed culture medium and cultured until the cell density reaches a predetermined value. The seed culture after two cultures is then inoculated into a fermenter for fermentation.

[0015] In a preferred embodiment, the seed culture of Bacillus subtilis is inoculated into a fermenter and fermented under the conditions of 0.02 vvm aeration, 300 rpm stirring speed, 37°C, and pH 6.5.

[0016] This invention uses Bacillus subtilis 168 as the starting strain and NH4Cl as the sole nitrogen source. Based on adaptive laboratory evolution techniques, a dominant strain capable of efficiently utilizing NH4Cl was screened, designated LJ-3. The optimal culture system was obtained by optimizing the trace metal elements in the fermentation medium. Furthermore, this strain was genetically engineered into a surfactantin-producing strain, specifically by: [the process involving the synthesis of surfactants via a strong promoter P...] vegThe sfp gene, derived from Bacillus velezensis BS-37 (a high-surfactin-producing wild-type bacterium), was integrated into the same site in LJ-3, restoring the strain's ability to synthesize surfactantin, resulting in recombinant strain LJ-31; subsequently, P... veg The long-chain fatty acid-CoA ligase encoding gene lcfA from Bacillus velezensis BS-37 was integrated into the cydBC (encoding cytochrome quinone alcohol oxidase) site in Bacillus subtilis LJ-31, resulting in a recombinant strain, denoted as LJ-32; finally, the P... veg The leucine permease encoding gene yvbW from B. subtilis 168 was integrated into the amylase encoding gene amyE in Bacillus subtilis LJ-32 to obtain recombinant strain LJ-33. The greatest advantage of the lipopeptide-producing strain LJ-33 obtained in this invention is that it can utilize the inexpensive nitrogen source NH4Cl to produce the lipopeptide surfactantin, significantly reducing the cost of fermentation raw materials. It also boasts advantages such as high yield and high production rate, showing great application potential. Attached Figure Description

[0017] Figure 1 The growth of the chassis strain Bacillus subtilis LJ-3 and the starting strain Bacillus subtilis 168 using NH4Cl as the sole nitrogen source.

[0018] Figure 2 The growth of the chassis strain Bacillus subtilis LJ-3 and the starting strain Bacillus subtilis 168 in the optimized culture system.

[0019] Figure 3 This is a reverse selection marker method used in the genetic engineering operations of this invention, wherein LF represents the upstream fragment of the replacement gene (up to 1000 bp), RF represents the replacement gene itself (up to 800 bp), DR represents the downstream fragment of the gene (up to 400 bp), IG represents the target fragment to be inserted into the genome, and PC cassette is amplified from plasmid pTPC.

[0020] Figure 4 The fermentation effect of genetically engineered bacteria LJ-31, LJ-32, and LJ-33 on the production of the lipopeptide surfactantin.

[0021] Figure 5 HLPC map of surfactantin produced by fermentation in genetically engineered LJ-33.

[0022] The biological material described in this invention, classified as Bacillus subtilis LJ-33, was deposited on December 23, 2022, at the China Center for Type Culture Collection (CCTCC), with accession number CCTCC NO: M 20222078, and deposit address: Wuhan, China. Detailed Implementation

[0023] Unless otherwise specified, the experimental methods used in the embodiments are conventional methods, which can be referred to the specific methods listed in J. Sambrook's "Synthetic Cloning Laboratory Manual" (3rd Edition), or according to the kit and product instructions; the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0024] Gene insertion

[0025] The gene insertion method is reverse selection marker method, and the process is as follows: Figure 3 As shown. The basic principle is to utilize the lethality of p-chlorophenylalanine (p-Cl-Phe) in the culture medium of Bacillus subtilis containing the mutant phenylalanine transfer tRNA synthetase α subunit gene (pheS*) to prepare a reverse selection box (containing the chloramphenicol cat gene and pheS* gene, named the PC fragment). PCR was used to amplify the following fragments: upstream of the substitution gene (LF), downstream of the substitution gene (DR), the insertion gene (IG), the substitution gene (RF), and the reverse selection box (PC). Subsequently, the fragments were fused by PCR in the order LF-IG-DR-PC-RF. The fused fragments were then introduced into competent cells for gene insertion. Positive clones were selected using chloramphenicol and p-chlorophenylalanine.

[0026] Recombinant bacterial construction methods

[0027] Amplification system:

[0028] ddH2O 20μL, high-fidelity enzyme mixture 25μL, primers 1-2μL, primers 2-2μL, template 1μL.

[0029] PCR procedure:

[0030] Pre-denaturation at 95℃ for 5 min, followed by 30 cycles of (denaturation at 95℃ for 15 s, annealing at Tm temperature for 15 s, extension at 72℃ for 30 s / kb), and finally 72℃ for 5 min.

[0031] Preparation of competent cells of Bacillus subtilis:

[0032] Competent cells were prepared using the GM I-GM II transfer culture method. The specific steps were as follows: (1) The cryovials were taken out of the -80℃ ultra-low temperature freezer and streaked in three zones to isolate single colonies. (2) A single colony was picked and inoculated into 5 mL of GM I solution and cultured overnight (12 h) at 30℃ and 150 rpm with shaking. (3) The next day, 2 mL of bacterial culture was transferred into 18 mL of GM I medium and cultured at 37℃ and 200 rpm with shaking for 3.5 h. (4) 10 mL of bacterial culture was transferred into 90 mL of GM II medium and cultured at 37℃ and 100 rpm with shaking for 2 h. Then, the bacterial cells were collected by centrifugation at 6000 rpm and 4℃ for 10 min. (5) Suspend the bacterial cells in 5 mL of supernatant and add 2.5 mL of 30% sterile glycerol to reduce the glycerol concentration to 10%. Then dispense 0.5 mL into 2 mL sterile centrifuge tubes and store them in an ultra-low temperature freezer at -80℃ for use during conversion.

[0033] Transformation process of strains:

[0034] (1) Add 1 μg of DNA fragment to 0.5 mL of prepared competent cells and incubate at 37°C and 100 rpm for 1 h to perform the first homologous recombination. (2) Spread the culture on chloramphenicol-resistant plates and incubate at 37°C for 12 h. Then, verify the transformants by colony PCR. Pick positive clones and inoculate them onto LB agar plates without antibiotics and incubate for 4 h to perform the second homologous recombination. (3) Dilute the culture to an appropriate concentration, take 200 μL and spread it on MGY-Cl plates containing p-chlorophenylalanine, incubate at 37°C for 12 h, and verify the positive clones that have integrated the target fragment by colony PCR. Sequencing confirmed the positive clones.

[0035] 10× Low-salt solution: Dipotassium hydrogen phosphate 140g / L, potassium dihydrogen phosphate 60g / L, ammonium sulfate 20g / L, trisodium citrate 10g / L, magnesium sulfate 2g / L.

[0036] GM I solution formulation (100mL): 10× low-salt solution, 10mL; 10% glucose solution, 5mL; 0.2% L-trp, 2.5mL; 5% acid-hydrolyzed casein, 0.5mL; 10% yeast extract, 1mL; sterile water, 81mL.

[0037] GM II solution formulation (100mL): 10× low-salt solution, 10mL; 10% glucose solution, 5mL; 0.2% L-Trp, 0.5mL; 5M CaCl2, 0.5mL; 5M MgCl2, 0.5mL; 5% acid-hydrolyzed casein, 0.8mL; 10% yeast extract, 0.4mL; sterile water, 83mL.

[0038] MGY-Cl medium formula: glucose 5g / L, yeast extract 4g / L, ammonium nitrate 1g / L, sodium chloride 0.5g / L, dipotassium hydrogen phosphate 1.5g / L, potassium dihydrogen phosphate 0.5g / L, magnesium sulfate 0.2g / L, DL-4-chloro-phenylalanine 5mM.

[0039] Surfactin detection

[0040] After fermentation, 1 mL of fermentation broth was centrifuged at 10,956 × g for 5 min to remove cells. The supernatant was diluted with anhydrous ethanol to a suitable concentration, centrifuged at 10,956 × g for 5 min, and then filtered through a 0.22 μm organic membrane to prepare the sample for analysis. Quantification was performed using a Shimadzu LC-20 liquid chromatograph with a UV detector for surfactantin. The HPLC parameters were as follows: separation was performed using a Venusll XBP C18 (4.6 × 150 mm, 5 μm) column; the mobile phase was 90% chromatographic grade methanol and 10% formic acid-water (containing 0.05% formic acid); the injection volume was 20 μL; the flow rate was 0.6 mL / min; the column temperature was 35 °C; and the detector was a UV detector with a wavelength of 214 nm.

[0041] Substrate content determination

[0042] Sucrose was determined by HPLC. Quantification was performed using a Shimadzu LC-20 liquid chromatograph with a RID detector. HPLC parameters were as follows: column: Aminex HPX-87H, 300 mm × 7.8 mm column (250 mm × 4.6 mm, 5 μm); mobile phase: 10 mmol / L sulfuric acid; flow rate: 0.5 mL / min; column temperature: 30 °C; injection volume: 10 μL.

[0043] NH4 in the culture medium + The determination of NH4+ was performed using the indophenol blue colorimetric method. In a strongly alkaline medium, NH4+... + It reacts with phenol and sodium hypochlorite to form a stable, water-soluble dye, indigo blue. Weigh 1g of phenol, dissolve it in pure water, add 2.7mL of sodium nitroprusside (1.25%), and dilute to a 100mL volumetric flask to prepare solution A. Accurately weigh 0.5g of NaOH and 0.4g of trisodium citrate solution, dissolve them in pure water, add 5mL of sodium hypochlorite (0.1mol / L), and dilute to a 100mL volumetric flask to prepare solution B. Pipette 500µL of solution A and 100µL of the NH4+ to be tested. + Mix the solution with 500 μL of solution B, vortex to mix, incubate at 37°C for 30 min, then remove and add 200 μL of the sample solution to the microplate. Measure the absorbance at 625 nm using a microplate reader. (The absorbance is then measured using NH4+.) + The concentration and absorbance are positively correlated in the determination of NH4. +The concentration.

[0044] Example 1: Obtaining a chassis strain that efficiently utilizes NH4Cl through laboratory adaptive evolution.

[0045] The composition of the adaptive evolution medium is: 20 g / L sucrose, 50 mM NH4Cl, 3 g / L potassium dihydrogen phosphate, 10 g / L dipotassium hydrogen phosphate, 0.5 g / L magnesium sulfate, and 0.05 g / L ferrous sulfate. For solid medium, 20 g / L agar needs to be added.

[0046] Step 1: Prepare the adaptive evolution medium into liquid and solid states respectively.

[0047] Step 2: Remove B. subtilis 168 strain from the -80℃ ultra-low temperature freezer, and use an inoculation loop to streak three zones on a solid adaptive evolution medium plate, and incubate at 37℃ for 24 hours.

[0048] Step 3: Pick several single colonies from the plate and transfer them to 250-mL Erlenmeyer flasks containing 50mL of liquid adaptive evolution medium. Then, incubate at 37℃ and 200rpm for 24 hours. Finally, measure the cell density (OD). 600 Then, select the bacterial culture with the highest cell density for the next experiment.

[0049] Step 4: Dilute the bacterial suspension with the highest cell density from Step 3 appropriately, spread it on a solid adaptive evolution medium plate using a spreader, and incubate at 37°C for 24 hours.

[0050] Step 5: Laboratory adaptive evolution was performed by repeating steps 3 and 4. Each solid-to-liquid culture cycle was defined as one period. After 20 cycles of laboratory adaptive evolution, the culture with the highest growth OD value was diluted and plated on solid adaptive evolution medium to isolate single colonies. The growth performance of these single colonies was then verified on liquid adaptive medium. The strain with the best growth performance was preserved and designated Bacillus subtilis LJ-3. Figure 1 As shown, in a culture medium with NH4Cl as the sole nitrogen source, the growth OD value of Bacillus subtilis LJ-3 was increased by 191.6% compared to the starting strain 168.

[0051] Example 2: Optimizing the types and concentrations of metal ions in the culture medium to promote the growth of strain LJ-3 using inorganic nitrogen.

[0052] A single-factor experiment was conducted to screen for metal ions using the dominant chassis strain LJ-3 obtained in Example 1, selecting from five metal ions (Fe... 2+ ,Mn 2+ Mg 2+Cu 2+ ,Zn 2+ Metal ions that promote LJ-3 growth and inorganic nitrogen absorption were screened out.

[0053] Step 1: Inoculate LJ-3 into seed culture medium and incubate overnight at 37°C for 24 hours.

[0054] Step 2: Inoculate the cultured seed solution into the metal ion screening medium at an inoculation rate of 4% and incubate at 37°C for 30 hours.

[0055] Step 3: Measuring cell density (OD) 600 ), residual NH4 + By adjusting sucrose concentration, beneficial metal ions that promote LJ-3 growth and substrate absorption were screened.

[0056] The seed culture medium consisted of: 10 g / L peptone, 5 g / L yeast extract, and 10 g / L sodium chloride.

[0057] The metal ion screening medium consisted of a basal medium composed of 20 g / L sucrose, 50 mM NH4Cl, 3 g / L potassium dihydrogen phosphate, and 10 g / L dipotassium hydrogen phosphate. Different concentrations of metal ions were added to the basal medium to create the final metal ion screening medium.

[0058] The results are shown in Tables 1-5: Fe 2+ Mn 2+ and Mg 2+ It can promote the growth and substrate uptake of strain LJ-3, with an effect degree of Fe. 2+ >Mn 2+ >Mg 2+ Zn 2+ No significant effect, Cu 2+ It has an inhibitory effect. Therefore, the preferred concentrations for each ion are: 0.5 mM Fe 2+ 0.01mM Mn 2+ 2mM Mg 2+ .

[0059] Table 1. Effects of different concentrations of ferrous ions on LJ-3 growth and substrate uptake.

[0060]

[0061] Table 2. Effects of different concentrations of manganese ions on LJ-3 growth and substrate uptake.

[0062]

[0063] Table 3. Effects of different magnesium ion concentrations on LJ-3 growth and substrate uptake.

[0064]

[0065] Table 4. Effects of different zinc ion concentrations on LJ-3 growth and substrate uptake.

[0066]

[0067]

[0068] Table 5. Effects of different concentrations of copper ions on LJ-3 growth and substrate uptake.

[0069]

[0070] Selected trace metal elements and their concentrations were added to the basal culture medium components, and the sucrose concentration was increased to 50 g / L. The growth effect of LJ-3 on this fermentation medium was then investigated.

[0071] Step 1: Inoculate LJ-3 into seed culture medium and incubate overnight at 37°C for 24 hours.

[0072] Step 2: Inoculate the cultured seed solution into the fermentation medium at an inoculation rate of 4% and incubate at 37°C.

[0073] Step 3: Determine cell density and substrate content.

[0074] Seed culture medium components: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride.

[0075] Fermentation medium components: sucrose 50 g / L, 50 mM NH4Cl, potassium dihydrogen phosphate 3 g / L, dipotassium hydrogen phosphate 10 g / L, FeSO4 0.5 mM, MnSO4 0.01 mM, MgSO4 2 mM.

[0076] The results are as follows Figure 2 As shown: After culturing with a complex of metal ions (FeSO4 0.5mM, MnSO4 0.01mM, MgSO4 2mM) for 24 h, B. subtilis LJ-3 showed improved performance on the substrate NH4+. + Sugar and sucrose intake were 50.1% and 84.4% respectively, and cell density (OD) 600 The substrate uptake reached 9.36; compared with the starting strain B. subtilis 168, substrate uptake increased by 87.6% and 154.2%, respectively, and cell density (OD) increased. 600 This represents an increase of 291.61%.

[0077] Example 3: Construction method of Bacillus subtilis LJ-31

[0078] Using LJ-3, selected in Example 1, as the starting strain, the sfp gene from B. velezensis BS-37 (a high-surfactin-producing wild-type bacterium) was applied to the P... veg Under the control of the promoter, P veg -sfp was integrated into the same site as LJ-3, restoring the strain's ability to synthesize surfactantin, resulting in recombinant strain LJ-31. A reverse selection marker method was used, such as... Figure 3 As shown, the following examples all use this method for gene construction.

[0079] LF and P were amplified using primer pairs. veg The six fragments, sfp, DR, PC, and RF, were then fused using fusion PCR to construct the targeting fragment LF-P. veg -sfp-DR-PC-RF.

[0080] LF-F:TTTGTGATTTTCAGCTGATTGAAAACCT

[0081] LF-R:CTGTGTAAGATAGATCTCTAGATCCTCCGTCTGCAAAAGATTGT

[0082] P veg -F:AGACGGAGGATCTAGAGATCTATCTTACACAGCATCACACTGG

[0083] P veg -R:ACTCCGTAAATCTTCATGTTTGTCCTCCTTATTAGTTAATCTACATTTA

[0084] sfp-F:AATAAGGAGGACAAACATGAAGATTTACGGAGTATATATGGACCGC

[0085] sfp-R:GCGCACTGAAAAGGAATTATAACAGCTCTTCATACGTTTTCATCTCAATC

[0086] DR-F:GAGATGAAAACGTATGAAGAGCTGTTATAATTCCTTTTCAGTGCGCCTGC

[0087] DR-R:TCATTTGTATACATACTTTAAAAATAGATTATCCGAAAGAAATCTATTA

[0088] PC-F:TAATAGATTTTCTTTCGGATAATCTATTTTTAAAGTATGTATACAAATGA

[0089] PC-R:ATAAATTCCGTAAATCTTCATTTATAAAAGCCAGTCATTAGGCCTATCTG

[0090] RF-F:CCTAATGACTGGCTTTTAAATGAAGATTTACGGAATTTATATGGACCG

[0091] RF-R:TCTCCTTGAGGCGATAGACCG

[0092] Example 4: Construction method of Bacillus subtilis LJ-32

[0093] Using LJ-31 from Example 3 as the starting strain, it was introduced into the promoter P veg The long-chain fatty acid-CoA ligase encoding gene lcfA, P from Bacillus velezensis BS-37, under regulation. veg -lcfA was integrated into the cydBC (encoding cytochrome quinone alcohol oxidase) site in Bacillus subtilis LJ-31 to obtain a recombinant bacterium, denoted as LJ-32.

[0094] LF and P were amplified using primer pairs. veg The six fragments, lcfA, DR, PC, and RF, were then fused using fusion PCR to construct the targeting fragment LF-P. veg -lcfA-DR-PC-RF.

[0095] LF-F:CTCGTATCATTCGGAACGATCATGTCA

[0096] LF-R:CTGTGTAAGATAGATCGGTATACCTCCTGACTAAATGGATCTGTTGA

[0097] Pveg-F:AGTCAGGAGGTATACCGATCTATCTTACACAGCATCACAC

[0098] Pveg-R:GCCATGGCTTTTCAGACTGCATGTTTGTCCTCCTTATTAGTTAA

[0099] lcfA-F:ATAAGGAGGACAAACATGCAGTCTGAAAAGCCATGGC

[0100] lcfA-R:AGGTCTTTCCCATTAAGGCACCTTGTTTTCACGGGAAG

[0101] DR-F:CAAGGTGCCTTAATGGGAAAAGACCTGTTTCGATATAAA

[0102] DR-R:TGTATACATACTTTAAAAATATTTTCGGCAGAAACAG

[0103] PC-F:GAGCTGTTTCTGCCGAAAATATTTTTAAAGTATGTATACAAATGATGAA

[0104] PC-R:CATGAAGAGATGCCATTTATAAAAGCCAGTCATTAGGCCT

[0105] RF-F:TGACTGGCTTTATAAATGGCATCTCTTCATGATCTTTGGTTTATACT

[0106] RF-R:TTAATAAGTCATAGGCTCCTTATGGCTGAC

[0107] Example 5: Construction method of Bacillus subtilis LJ-33

[0108] Using LJ-32 from Example 4 as the starting strain, it was introduced into the promoter P veg The leucine permease encoding gene yvbW, P from B. subtilis168 is regulated. veg -yvbW was integrated into the amyE site of the amylase-encoding gene in Bacillus subtilis LJ-32 to obtain recombinant strain LJ-33.

[0109] LF-F:TATTCCGTATGTCAAGTGGCTG

[0110] LF-R:CTGTGTAAGATAGATCTCTTGACACTCCTTATTTGATTTTTTG

[0111] Pveg-F:TCAAATAAGGAGTGTCAAGAGATCTATCTTACACAGCATCACAC

[0112] Pveg-R:TGTCGTTTTTCATGTTTTGTCCTCCTTATTAGTTAATCTACAT

[0113] yvbw-F:ACTAATAAGGAGGACAAACATGAAAAACGACAATCAAACGT

[0114] yvbw-R:AGCCTTGCCCTTACTGATGCTTGCGTCCT

[0115] DR-F:AAGCATCAGTAAGGGCAAGGCTAGACG

[0116] DR-R:CATCATTTGTATACATACTTTAAAAATTTTGTACGCATCGTTTTTCTC

[0117] PC-F:CGATGCGTACAAAATTTTTAAAGTATGTATACAAATGATGAATAAATTTTAA

[0118] PC-R:CGTTTTGCAAACATTTATAAAAGCCAGTCATTAGGCCT

[0119] RF-F:CTAATGACTGGCTTTTATAAAATGTTTGCAAAACGATTCAAAAC

[0120] RF-R:TCAATGGGGAAGAGAACCG

[0121] Example 6: Effects of recombinant strains LJ-31, LJ-32, and LJ-33 on the production of surfactantin

[0122] The effects of the recombinant bacteria LJ-31, LJ-32 and LJ-33 constructed in Examples 3, 4 and 5 on the production of surfactantin were investigated in a 5L stirred fermenter.

[0123] Step 1: The seeds require two pre-cultures, the process of which is the same as the seed culture process in Example 2. The second pre-culture involves inoculating the first culture into the seed culture medium again at an inoculum of 4%, and culturing until the cell density (OD) reaches... 600 When the concentration reaches approximately 3.5, inoculate it into the fermenter at a rate of 4%.

[0124] Step 2: Fermentation to produce surfactantin. A 5L stirred fermenter was used, with the following engineering parameters: working volume 3.5L, aeration rate (90-95% oxygen) 0.02vvm, stirring speed 300rpm, temperature 37℃, and pH controlled at 6.5 using 1M NaOH or 1M HCl.

[0125] Surfactin fermentation medium formulation: 50 g / L sucrose, 150 mM NH4Cl, 10 mM L-Leu, 1 g / L dipotassium hydrogen phosphate, 0.5 mM FeSO4, 0.01 mM MnSO4, 2 mM MgSO4, with 1‰ (v / v) of antifoaming agent added.

[0126] The results are as follows Figure 4 As shown: the engineered strain LJ-31 synthesized surfactantin at a yield of 3.8 g / L using NH4Cl in a fermenter, with a cell density (OD) of [missing value]. 600 The value was 14.05. In Example 4, the engineered strain LJ-32, obtained by strengthening the long-chain fatty acid CoA ligase, achieved a surfactantin yield of 4.9 g / L, a 28.3% increase compared to LJ-31. After adding 10 mM L-Leu to the fermentation medium, the surfactantin yield of LJ-32 reached 5.3 g / L. In Example 5, the engineered strain LJ-33, obtained by strengthening the leucine permease, achieved a surfactantin yield of 6.2 g / L after adding 10 mM L-Leu to the fermentation medium. The engineered strain LJ-33 obtained in this invention exhibits good production performance, achieving a production rate of 0.248 g / L when fermenting with an inorganic nitrogen source. -1 .h -1 As shown in Table 6, the nitrogen sources for the fermentation of surfactantin by Bacillus that have been reported to date are mostly nitrates and organic nitrogen. This invention provides a strain B. subtilis LJ-33 that can efficiently utilize NH4Cl to synthesize surfactantin and its fermentation system.

[0127] Table 6. Synthesis of surfactantin by different Bacillus subtilis strains in different culture media.

[0128]

[0129] Example 7: Component distribution of surfactantin produced by recombinant strain LJ-33 during fermentation

[0130] The surfactantin component produced by the recombinant strain LJ-33 in Example 6 during fermentation in a 5L stirred fermenter was analyzed using HPLC. The results are as follows: Figure 5As shown, the recombinant strain LJ-33 synthesized a surfactantin product through fermentation. Its main components were the same as those of the surfactantin standard (CAS: 24730-31-2; Sigma), but the abundance of each component differed significantly. Based on literature data analysis, the main components of surfactantin were (a) iso-C 13 -surfactin, (b)iso-C 14 -surfactin,(c)nC 14 -surfactin, (d)iso-C 15 -surfactin. The proportions of the four main components of the lipopeptide surfactantin synthesized by recombinant strain LJ-33 during fermentation are as follows: (a) iso-C 13 -surfactin 13.3±1.5%, (b)iso-C 14 -surfactin20.09±1.4%, (c)nC 14 -surfactin 23.93±1.7%, (d)iso-C 15 -surfactin 32.79±1.6%.

Claims

1. A Bacillus subtilis strain LJ-33 capable of producing surfactant through fermentation using ammonium salts, characterized in that, Its classification is named Bacillus subtilis The accession number is CCTCC NO: M 20222078.

2. The application of Bacillus subtilis as described in claim 1 in the fermentation production of surfactantin.

3. The application according to claim 2, characterized in that, The nitrogen source for fermentation is ammonium salt.

4. The application according to claim 3, characterized in that, Surfactin was produced by fermenting Bacillus subtilis with ammonium chloride as the sole nitrogen source.

5. The application according to claim 2, characterized in that, adding metal ions in the medium of the fermentation culture; the metal ions are one or more of Fe 2+ , Mn 2+ , or Mg 2+ .

6. The application according to claim 5, characterized in that, Simultaneous addition of Fe 2+ , Mn 2+ , Mg 2+ three metal ions in the medium of fermentation culture.

7. The application according to claim 5 or 6, characterized in that, The concentration of added metal ions is: Fe 2+ : 0.25-1.25mM; Mn 2+ 0.002-0.500mM; Mg 2+ : 0.5-4mM.

8. The application according to claim 2, characterized in that, L-leucine was added to the fermentation culture medium.

9. The application according to claim 2, characterized in that, The fermentation medium consisted of the following components: sucrose, NH4Cl, L-leucine, dipotassium hydrogen phosphate, and Fe. 2+ Mn 2+ Mg 2+ Defoamer.

10. The application according to claim 2, characterized in that, After seed culture of Bacillus subtilis, the culture is inoculated into seed culture solution again and cultured until the cell density reaches a predetermined value. The seed solution after two cultures is then inoculated into a fermenter for fermentation.

11. The application according to claim 2 or 10, characterized in that, include: The seed culture of Bacillus subtilis was inoculated into a fermenter and fermented under the conditions of 0.02 vvm aeration, 300 rpm stirring speed, 37°C and pH 6.5.

Images