2-oxoglutarate-dependent dioxygenases and uses thereof

Abstract

The present application relates to a kind of 2-ketoglutaric acid-dependent dioxygenase and its application.The polypeptide of the present application has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence similarity with the polypeptide of SEQ ID NO:1 or SEQ ID NO:3 or SEQ ID NO:15 or SEQ ID NO:17 or SEQ ID NO:19 or SEQ ID NO:21.Experiments show that the polypeptide of the present application has the function of 2-ketoglutaric acid-dependent dioxygenase, and can catalyze the generation of butylphenylalanine from ligustilide A.The present application has important significance for effectively solving the problem of butylphenylalanine resource scarcity.

Description

TECHNICAL FIELD

[0001] The present application relates to a polypeptide having 2-oxoglutarate-dependent dioxygenase function, a polynucleotide encoding the polypeptide, a nucleic acid construct containing the polynucleotide, a recombinant vector and a host cell. The present application also relates to a method for preparing butylphthalide. BACKGROUND

[0002] Ligusticum chuanxiong Hort. is a plant of the Umbelliferae family, and its root is used as a medicine. Ligusticum chuanxiong Hort. is mainly distributed in Sichuan, China. Ligusticum chuanxiong Hort. is used in traditional Chinese medicine for the treatment of irregular menstruation, amenorrhea, dysmenorrhea, abdominal mass pain, chest and waist pain, sprain and swelling pain, headache, rheumatism and arthralgia, and other related diseases. At present, nearly 60 phthalide compounds have been isolated from Ligusticum chuanxiong Hort., including ligustilide, senkyunolide A, butylidenephthalide, and butylphthalide. They have various pharmacological effects, such as vasodilation, antioxidant, antithrombotic, antibacterial, and anti-inflammatory effects. Among them, butylphthalide is mainly used in clinical practice for the treatment of chronic or acute ischemic stroke. With the improvement of people's living standards, accompanied by the increasing incidence of cardiovascular and cerebrovascular diseases, the clinical demand for medicines containing Ligusticum chuanxiong Hort. is increasing.

[0003] The huge market demand has led many scientists to devote themselves to the synthesis of butylphthalide, and most of the research focuses on the chemical synthesis of butylphthalide. However, many impurities are introduced during the chemical synthesis process and are difficult to remove, affecting the quality of butylphthalide bulk drug. Due to the good application prospect of phthalide compounds, there is an urgent need in the industry for a synthesis method of 3-substituted phthalide compounds that is independent of the natural extraction approach. Therefore, analyzing the synthesis path of butylphthalide can break through the industrial bottleneck faced in chemical synthesis and help to promote the diversity of the source of butylphthalide bulk drug. SUMMARY

[0004] The present application provides a polypeptide having 2-oxoglutarate-dependent dioxygenase activity, which can also be said to belong to the 2-oxoglutarate-dependent dioxygenase family.

[0005] The polypeptide of the present application can be a polypeptide having an amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3 or SEQ ID NO: 15 or SEQ ID NO: 17 or SEQ ID NO: 19 or SEQ ID NO: 21.

[0006] The polypeptide of the present application can also be a polypeptide having an amino acid sequence that is at least 10% or at least 12% or at least 14% or at least 15% or at least 16% or at least 17% or at least 18% or at least 19% or at least 20% or at least 21% or at least 22% or at least 24% or at least 26% or at least 28% or at least 29% or at least 30% or at least 31% or at least 32% or at least 34% or at least 36% or at least 38% or at least 40% or at least 42% or at least 44% or at least 46% or at least 48% or at least 50% or at least 52% or at least 54% or at least 56% or at least 58% or at least 59% or at least 60% or at least 65% or at least 70% or at least 75% or at least 80% or at least 81% or at least 82% or less 83% or at least 84% or at least 85% or at least 86% or at least 87% or at least 88% or at least 89% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or more similar to SEQ ID NO: 1 or SEQ ID NO: 3 or SEQ ID NO: 15 or SEQ ID NO: 17 or SEQ ID NO: 19 or SEQ ID NO: 21, and the polypeptide has 2-oxoglutarate-dependent dioxygenase activity or the polypeptide is a member of the 2-oxoglutarate-dependent dioxygenase family; wherein the 2-oxoglutarate-dependent dioxygenase activity can be the activity of any member of the 2-oxoglutarate-dependent dioxygenase family as referred to in the prior art, and can also be the activity of catalyzing the generation of 3-substituted phthalide compounds from senkyunol A or ligustilide or analogs.

[0007] The polypeptide of the present application can also be a polypeptide having an amino acid sequence with at least 10% or at least 12% or at least 14% or at least 15% or at least 16% or at least 17% or at least 18% or at least 19% or at least 20% or at least 21% or at least 22% or at least 24% or at least 26% or at least 28% or at least 29% or at least 30% or at least 31% or at least 32% or at least 34% or at least 36% or at least 38% or at least 40% or at least 42% or at least 44% or at least 46% or at least 48% or at least 50% or at least 52% or at least 54% or at least 56% or at least 58% or at least 59% or at least 60% or at least 65% or at least 70% or at least 75% or at least 80% or at least 81% or at least 82% or less 83% or at least 84% or at least 85% or at least 86% or at least 87% or at least 88% or at least 89% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or more similarity to SEQ ID NO: 1 or SEQ ID NO: 3 or SEQ ID NO: 15 or SEQ ID NO: 17 or SEQ ID NO: 19 or SEQ ID NO: 21, and the polypeptide is derived from Ligusticum chuanxiong hort., and the polypeptide has 2-oxoglutarate-dependent dioxygenase activity or the polypeptide is a member of the 2-oxoglutarate-dependent dioxygenase family; wherein the 2-oxoglutarate-dependent dioxygenase activity can be the activity of any member of the 2-oxoglutarate-dependent dioxygenase family as indicated in the prior art, and can also be the activity of catalyzing the generation of 3-substituted phthalide compounds from senkyunol A or ligustilide or analogs.

[0008] The polypeptide of the present application can also be a polypeptide encoded by a polynucleotide (a) as set forth in SEQ ID NO: 2 or SEQ ID NO: 4 or SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 12 or SEQ ID NO: 13 or SEQ ID NO: 14 or SEQ ID NO: 16 or SEQ ID NO: 18 or SEQ ID NO: 20; (b) a polynucleotide having more than 60% similarity to the nucleic acid sequence as set forth in SEQ ID NO: 2 or SEQ ID NO: 4 or SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 12 or SEQ ID NO: 13 or SEQ ID NO: 14 or SEQ ID NO: 16 or SEQ ID NO: 18 or SEQ ID NO: 20; (c) a polynucleotide hybridizing to the polynucleotide as set forth in SEQ ID NO: 2 or SEQ ID NO: 4 or SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 12 or SEQ ID NO: 13 or SEQ ID NO: 14 or SEQ ID NO: 16 or SEQ ID NO: 18 or SEQ ID NO: 20 or its complement or its gDNA under stringent conditions, the polypeptide having 2-oxoglutarate-dependent dioxygenase activity or the polypeptide being a member of the 2-oxoglutarate-dependent dioxygenase family; wherein the 2-oxoglutarate-dependent dioxygenase activity can be the activity of any member of the 2-oxoglutarate-dependent dioxygenase family as indicated in the prior art, and can also be the activity of catalyzing the production of 3-substituted phthalide compounds from senkyunol A or ligustilide or analogs thereof.

[0009] The polypeptide of the present application includes any allelic variant of a polypeptide having at least 10% or at least 12% or at least 14% or at least 15% or at least 16% or at least 17% or at least 18% or at least 19% or at least 20% or at least 21% or at least 22% or at least 24% or at least 26% or at least 28% or at least 29% or at least 30% or at least 31% or at least 32% or at least 34% or at least 36% or at least 38% or at least 40% or at least 42% or at least 44% or at least 46% or at least 48% or at least 50% or at least 52% or at least 54% or at least 56% or at least 58% or at least 59% or at least 60% or at least 65% or at least 70% or at least 75% or at least 80% or at least 81% or at least 82% or less 83% or at least 84% or at least 85% or at least 86% or at least 87% or at least 88% or at least 89% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or more similarity to SEQ ID NO: 1 or SEQ ID NO: 3 or SEQ ID NO: 15 or SEQ ID NO: 17 or SEQ ID NO: 19 or SEQ ID NO: 21. The polypeptide has 2-oxoglutarate-dependent dioxygenase activity or the polypeptide is a member of the 2-oxoglutarate-dependent dioxygenase family; wherein the 2-oxoglutarate-dependent dioxygenase activity can be the activity of any member of the 2-oxoglutarate-dependent dioxygenase family as indicated in the prior art, and can also be the activity of catalyzing the production of 3-substituted phthalide compounds from senkyunol A or ligustilide or analogs. The allelic variant of the polypeptide is encoded by an allelic variant. An allelic variant refers to any of two or more variants of a gene at the same locus on a chromosome. Allelic variants are produced by natural mutations that can lead to polymorphisms within a population. The genetic mutations can be silent (not changing its encoded polypeptide) or can result in changes to the amino acid sequence of the encoded polypeptide.

[0010] The polypeptide of the present application also can be a polypeptide mutant obtained by substitution, insertion and / or deletion of one or more amino acid residues at one or more positions of SEQ ID NO: 1 or SEQ ID NO: 3 or SEQ ID NO: 15 or SEQ ID NO: 17 or SEQ ID NO: 19 or SEQ ID NO: 21, which polypeptide mutant has 2-oxoglutarate-dependent dioxygenase activity or the polypeptide mutant is a member of the 2-oxoglutarate-dependent dioxygenase family; wherein the 2-oxoglutarate-dependent dioxygenase activity can be the activity of any member of the 2-oxoglutarate-dependent dioxygenase family as indicated in the prior art, and can also be the activity of catalyzing the production of 3-substituted phthalide compounds from senkyunol A or ligustilide or analogs.

[0011] The number of amino acid substitutions, deletions and / or insertions can be 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. Such substitutions, insertions and / or deletions can be made at non-essential amino acid locations. One skilled in the art can deduce the essential amino acids of the sequence using existing technologies, such as kinetic parameter determination, X-ray crystal structure analysis, site-directed mutagenesis, etc.

[0012] The polypeptide of the present application can also be a polypeptide mutant obtained by substituting, inserting and / or deleting amino acid residues at any one or more of the following positions based on the amino acid sequence shown in SEQ ID NO: 1: the 180th amino acid, the 102nd amino acid, the 76th amino acid, the 165th amino acid, the 66th amino acid from the N-terminus (especially the 180th, the 102nd, the 76th), which has 2-oxoglutarate-dependent dioxygenase activity or is a member of the 2-oxoglutarate-dependent dioxygenase family; wherein the 2-oxoglutarate-dependent dioxygenase activity can be the activity of any member of the 2-oxoglutarate-dependent dioxygenase family as indicated in the prior art, and can also be the activity of catalyzing the generation of 3-substituted phthalides from ligustilide A or ligustilide or analogs.

[0013] The polypeptide of the present application can also be a polypeptide mutant obtained by substituting, inserting and / or deleting amino acid residues at any one or more of the following positions based on the amino acid sequence shown in SEQ ID NO: 3 or SEQ ID NO: 15 or SEQ ID NO: 17 or SEQ ID NO: 19 or SEQ ID NO: 21: the position corresponding to the 180th amino acid, the 102nd amino acid, the 76th amino acid, the 165th amino acid, the 66th amino acid from the N-terminus of SEQ ID NO: 1 (especially the 180th, the 102nd, the 76th); which has 2-oxoglutarate-dependent dioxygenase activity or is a member of the 2-oxoglutarate-dependent dioxygenase family; wherein the 2-oxoglutarate-dependent dioxygenase activity can be the activity of any member of the 2-oxoglutarate-dependent dioxygenase family as indicated in the prior art, and can also be the activity of catalyzing the generation of 3-substituted phthalides from ligustilide A or ligustilide or analogs.

[0014] The polypeptide of the present application can also be a polypeptide mutant obtained by performing any one or any several mutations of W180A, Y102A, Y76F, G165A, Q66A (especially W180A, Y102A, Y76F) on the basis of the amino acid sequence shown in SEQ ID NO: 1; the polypeptide mutant has 2-oxoglutarate-dependent dioxygenase activity or the polypeptide mutant is a member of the 2-oxoglutarate-dependent dioxygenase family; wherein the 2-oxoglutarate-dependent dioxygenase activity can be the activity of any member of the 2-oxoglutarate-dependent dioxygenase family as indicated in the prior art, and can also be the activity of catalyzing 3-substituted phthalide compounds from ligustilide A or ligustilide or analogs.

[0015] The polypeptide of the present application can also be a polypeptide mutant obtained by performing corresponding amino acid mutations on the basis of the amino acid sequence shown in SEQ ID NO: 3 or SEQ ID NO: 15 or SEQ ID NO: 17 or SEQ ID NO: 19 or SEQ ID NO: 21, with reference to SEQ ID NO: 1, at the corresponding positions; wherein the corresponding positions and corresponding amino acid mutation types in SEQ ID NO: 1 are any one or any several of the following: W180A, Y102A, Y76F, G165A, Q66A (especially W180A, Y102A, Y76F); the polypeptide mutant has 2-oxoglutarate-dependent dioxygenase activity or the polypeptide mutant is a member of the 2-oxoglutarate-dependent dioxygenase family; wherein the 2-oxoglutarate-dependent dioxygenase activity can be the activity of any member of the 2-oxoglutarate-dependent dioxygenase family as indicated in the prior art, and can also be the activity of catalyzing 3-substituted phthalide compounds from ligustilide A or ligustilide or analogs.

[0016] The polypeptide of the present application includes a polypeptide encoded by a polynucleotide of: (a) a polynucleotide as set forth in SEQ ID NO: 2 or SEQ ID NO: 4 or SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 12 or SEQ ID NO: 13 or SEQ ID NO: 14 or SEQ ID NO: 16 or SEQ ID NO: 18 or SEQ ID NO: 20; (b) a polynucleotide having 60% or more similarity to the nucleic acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4 or SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 12 or SEQ ID NO: 13 or SEQ ID NO: 14 or SEQ ID NO: 16 or SEQ ID NO: 18 or SEQ ID NO: 20; (c) a polynucleotide hybridizing to the polynucleotide as set forth in SEQ ID NO: 2 or SEQ ID NO: 4 or SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 12 or SEQ ID NO: 13 or SEQ ID NO: 14 or SEQ ID NO: 16 or SEQ ID NO: 18 or SEQ ID NO: 20 or its complement or its gDNA under stringent conditions, the polypeptide having 2-oxoglutarate-dependent dioxygenase activity or the polypeptide being a member of the 2-oxoglutarate-dependent dioxygenase family. The stringent conditions refer to the following: for a probe of at least 100 nucleotides in length, pre-hybridization and hybridization are performed at 42°C in 5X SSPE, 0.3% SDS, 200 μg / mL sheared and denatured salmon sperm DNA and 50% formamide for 12 to 24 hours following standard Southern blotting procedures. Washes are performed using 0.2X SSC, 0.2% SDS at 70°C for 15 minutes each. The complement can be a perfect complement or an imperfect complement.

[0017] The polypeptide of the present application includes the polypeptide as shown in SEQ ID NO: 1 or SEQ ID NO: 3 or SEQ ID NO: 15 or SEQ ID NO: 17 or SEQ ID NO: 19 or SEQ ID NO: 21 or an allelic variant thereof or a mutant thereof or a fusion polypeptide or a cleavable fusion polypeptide formed by the polypeptide encoded by the above polynucleotide and another polypeptide. The other polypeptide is fused at the N-terminus or C-terminus of the polypeptide as shown in SEQ ID NO: 1 or SEQ ID NO: 3 or SEQ ID NO: 15 or SEQ ID NO: 17 or SEQ ID NO: 19 or SEQ ID NO: 21 or an allelic variant thereof or a mutant thereof or a polypeptide encoded by the above polynucleotide. The fusion polypeptide can further comprise a cleavage site between the two polypeptides, which is cleaved when the fusion protein is secreted, thereby releasing the two polypeptides. The other polypeptide includes but is not limited to a purification tag such as histidine, a marker protein such as a fluorescent protein, further such as a red fluorescent protein, a green fluorescent protein, etc., or a signal peptide, etc.

[0018] The polypeptide of the present application also includes a truncation of the above-mentioned polypeptide (the polypeptide as shown in SEQ ID NO: 1 or SEQ ID NO: 3 or SEQ ID NO: 15 or SEQ ID NO: 17 or SEQ ID NO: 19 or SEQ ID NO: 21 or an allelic variant thereof or a mutant thereof or a polypeptide encoded by the above polynucleotide), which has 2-oxoglutarate-dependent dioxygenase activity or which is a member of the 2-oxoglutarate-dependent dioxygenase family; wherein the 2-oxoglutarate-dependent dioxygenase activity can be the activity of any member of the 2-oxoglutarate-dependent dioxygenase family as referred to in the prior art, and can also be the activity of catalyzing the generation of 3-substituted phthalide compounds from senkyunol A or ligustilide or analogs thereof.

[0019] The polynucleotide encoding any of the above-mentioned polypeptides also falls within the protection scope of the present application. The polynucleotide can be DNA, RNA or cDNA.

[0020] The polynucleotide is as follows (1) or (2) or (3):

[0021] (1) a polynucleotide comprising SEQ ID NO: 2 or SEQ ID NO: 4 or SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 12 or SEQ ID NO: 13 or SEQ ID NO: 14 or SEQ ID NO: 16 or SEQ ID NO: 18 or SEQ ID NO: 20;

[0022] (2) a polynucleotide having at least 60% or at least 65% or at least 70% or at least 75% or at least 80% or at least 81% or at least 82% or less 83% or at least 84% or at least 85% or at least 86% or at least 87% or at least 88% or at least 89% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or more sequence similarity with SEQ ID NO: 2 or SEQ ID NO: 4 or SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 12 or SEQ ID NO: 13 or SEQ ID NO: 14 or SEQ ID NO: 16 or SEQ ID NO: 18 or SEQ ID NO: 20, and the polypeptide encoded by the polynucleotide has 2-oxoglutarate-dependent dioxygenase activity or the polypeptide is a member of the 2-oxoglutarate-dependent dioxygenase family; wherein the 2-oxoglutarate-dependent dioxygenase activity can be the activity of any member of the 2-oxoglutarate-dependent dioxygenase family as indicated in the prior art, and can also be the activity of catalyzing the generation of 3-substituted phthalide compounds from senkyunol A or ligustilide or analogs.

[0023] (3) a polynucleotide hybridizing under stringent conditions to a polynucleotide represented by SEQ ID NO: 2 or SEQ ID NO: 4 or SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 12 or SEQ ID NO: 13 or SEQ ID NO: 14 or SEQ ID NO: 16 or SEQ ID NO: 18 or SEQ ID NO: 20 or the complement thereof or the gDNA thereof, and the polypeptide encoded by the polynucleotide has 2-oxoglutarate-dependent dioxygenase activity or the polypeptide is a member of the 2-oxoglutarate-dependent dioxygenase family; wherein the 2-oxoglutarate-dependent dioxygenase activity can be the activity of any member of the 2-oxoglutarate-dependent dioxygenase family as indicated in the prior art, and can also be the activity of catalyzing the generation of 3-substituted phthalide compounds from senkyunol A or ligustilide or analogs.

[0024] Stringent conditions refer to prehybridization and hybridization at 42°C for 12 to 24 hours in 5X SSPE, 0.3% SDS, 200 μg / mL of sheared and denatured salmon sperm DNA, and 50% formamide, following standard Southern blotting procedures, with the support material washed three times in 0.2X SSC, 0.2% SDS at 70°C for 15 minutes each.

[0025] The complementary sequence can be a fully complementary sequence or an incomplete complementary sequence.

[0026] Techniques for isolating or cloning polynucleotides are known in the art and can be performed from either genomic DNA or cDNA. Techniques can be polymerase chain reaction (PCR), antibody library screening, other nucleic acid amplification procedures such as ligase chain reaction (LCR), ligation activated transcription (LAT) and nucleic acid sequence-based amplification (NASBA). The polynucleotide can be an allelic or species variant of the polypeptide coding region of the polynucleotide.

[0027] The polynucleotide of the present application includes any allelic variant of a polynucleotide having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence similarity to the polynucleotide of SEQ ID NO: 2 or SEQ ID NO: 4 or SEQ ID NO: 14 or SEQ ID NO: 16 or SEQ ID NO: 18 or SEQ ID NO: 20, and the polypeptide encoded by any allelic variant of the polynucleotide has 2-oxoglutarate-dependent dioxygenase activity or the polypeptide is a member of the 2-oxoglutarate-dependent dioxygenase family; wherein the 2-oxoglutarate-dependent dioxygenase activity can be the activity of any member of the 2-oxoglutarate-dependent dioxygenase family as referred in the prior art, or the activity of catalyzing the production of 3-substituted phthalide compounds from senkyunol A or ligustilide or analogs. Allelic variant refers to any of two or more genes at the same chromosomal locus. Allelic variants are produced by natural mutation and can result in polymorphism within a population. The genetic mutation can be silent (not changing the encoded polypeptide) or can result in a change in the amino acid sequence of the encoded polypeptide.

[0028] The polynucleotide of the present application includes a polynucleotide derived from the medicinal plant Ligusticum chuanxiong Hort. and having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence similarity to the polynucleotide of SEQ ID NO: 2 or SEQ ID NO: 4 or SEQ ID NO: 14 or SEQ ID NO: 16 or SEQ ID NO: 18 or SEQ ID NO: 20, and the encoded polypeptide has 2-oxoglutarate-dependent dioxygenase activity or the polypeptide is a member of the 2-oxoglutarate-dependent dioxygenase family; wherein the 2-oxoglutarate-dependent dioxygenase activity can be the activity of any member of the 2-oxoglutarate-dependent dioxygenase family as referred to in the prior art, and can also be the activity of catalyzing the generation of 3-substituted phthalide compounds from senkyunol A or ligustilide or analogs thereof.

[0029] The polynucleotide of the present application also includes a polynucleotide obtained by mutating and / or modifying the bases of one or more positions based on SEQ ID NO: 2 or SEQ ID NO: 4 or SEQ ID NO: 14 or SEQ ID NO: 16 or SEQ ID NO: 18 or SEQ ID NO: 20. Such mutations or modifications include codon optimization, degenerate base design, methylation modification, etc. The approaches to achieve such modifications or mutations are well known in the art, including but not limited to: insertion, deletion, error-prone PCR, re-ligation of different sequences, directional evolution of different parts of the sequence with homologous sequences from other sources, chemical reagent mutagenesis.

[0030] The polynucleotide of the present application also includes a polynucleotide encoding any of the above-mentioned fusion polypeptides or truncations.

[0031] The present application also includes a recombinant vector, a nucleic acid construct or a recombinant host cell of the polynucleotide encoding any of the above-mentioned polypeptides.

[0032] The recombinant vectors of the present application include recombinant expression vectors or recombinant cloning vectors. The vectors involved in the recombinant expression vectors can be vectors known in the art for gene expression, including but not limited to pEAQ-HT, pSuper-1300, pET-28a, pET30a, pET24b, pESC-Ura, pESC-Trp, pESC-Leu, pESC-His, pGEX2T, pTAex3, pYMB03, preferably pSuper1300 and pET24b.

[0033] wherein expression refers to any step involved in the production of a polypeptide, including but not limited to: transcription, post-transcriptional modification, translation, post-translational modification, and secretion. An expression vector refers to a linear or circular DNA molecule that comprises a polynucleotide encoding a polypeptide and is operably linked to regulatory sequences that provide for its expression.

[0034] The nucleic acid constructs involved in the present application comprise a polynucleotide of the present application operably linked to one or more control sequences that direct the expression of the coding sequence in a suitable host cell. The control sequences can be homologous or heterologous to the polynucleotide.

[0035] A control sequence refers to a nucleic acid sequence that is necessary for expression of a polynucleotide encoding a polypeptide. The control sequences are operably linked to the polynucleotide encoding the polypeptide, meaning that the polynucleotide is linked to the control sequences in the same manner as it would be in its natural environment. The control sequences that are operably linked to a polynucleotide partial or complete nucleic acid sequence include a promoter, a signal peptide sequence, an enhancer, a transcription terminator, a polyadenylation signal, and the like. At a minimum, the control sequences include a promoter, and transcriptional and translational stop signals. The control sequences can be provided with linkers for the purpose of cloning.

[0036] The present application also relates to recombinant host cells, which comprise a polynucleotide of the present application operably linked to one or more control sequences that regulate the production of a polypeptide of the present application. The construct or vector comprising the polynucleotide is introduced into a host cell, either by integration into the host chromosome or exists extrachromosomally, replicating episomally. The host cell also includes any progeny of the parent cell that have a mutation in the polynucleotide due to errors occurring during replication. The selection of the host cell will depend on the gene encoding the polypeptide and its source.

[0037] The host cell can be any microbial cell that can be used to produce a polypeptide of the present application. Such as prokaryotic or eukaryotic cells. The prokaryotic host cell can be any gram-positive or gram-negative bacteria. The microbial cell includes but is not limited to: Streptomyces, Pseudomonas, Bacillus, yeast cells, Escherichia coli.

[0038] Methods of introducing an expression vector into a host cell are known in the art and include, but are not limited to, electroporation, polyethylene glycol (PEG) transformation, lipofection, heat shock, calcium phosphate precipitation, virus-mediated, and microinjection.

[0039] The present application includes a method of producing a polypeptide of the present application, comprising the step of expressing a recombinant host cell containing a polynucleotide encoding a polypeptide of the present application under conditions conducive to expression of the polypeptide to obtain the polypeptide of the present application.

[0040] The present application includes a method of producing a polypeptide of the present application, comprising culturing a recombinant host cell of the present application under conditions conducive to production of the polypeptide of the present application to obtain the polypeptide of the present application. The method of producing a polypeptide of the present application can further comprise the step of recovering the polypeptide.

[0041] The cells can be cultured by shake flask cultivation, or small- or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermentors under conditions optimal for expression of the polypeptide. The optimum conditions can be determined by fermentation studies in shake flasks or other laboratory fermentation instruments followed by pilot or large-scale fermentation under the same or different conditions. If the polypeptide is secreted into the nutrient medium, the polypeptide can be recovered directly from the medium. If the polypeptide is not secreted, it can be recovered from cell lysates.

[0042] The polypeptide can be detected using methods known in the art for detection of polypeptides. Such detection methods include, but are not limited to, specific antibody detection, enzyme activity detection.

[0043] The polypeptide can be recovered using methods known in the art, including, but not limited to, collection, centrifugation, filtration, extraction, spray-drying, evaporation, or precipitation.

[0044] The polypeptide can be purified using methods known in the art, including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE.

[0045] The present application also includes a method of producing a polypeptide of the present application, comprising the step of cultivating a transgenic plant or a plant cell under conditions conducive to production of the polypeptide, wherein the transgenic plant or plant cell comprises a polynucleotide encoding a polypeptide of the present application. The method of producing a polypeptide of the present application can further comprise the step of recovering the polypeptide.

[0046] The present application also includes a recombinant plant cell or plant comprising a polynucleotide or nucleic acid construct encoding any of the above-mentioned polypeptides of the present application. The plant cell can be a cell of any part of a plant, such as a root, stem, leaf, hair root, etc. The plant can include explants, specifically including but not limited to: cuttings, tissue cultures, cell suspensions, and callus. The plant species includes but is not limited to Ligusticum chuanxiong or tobacco.

[0047] The present application also includes a polypeptide having 2-oxoglutarate-dependent dioxygenase activity or a polypeptide belonging to the 2-oxoglutarate-dependent dioxygenase family, i.e. any of the above-mentioned polypeptides of the present application.

[0048] The present application provides a method for preparing a phthalide compound, comprising the following steps: taking a compound represented by Formula I and / or Formula II as a substrate, contacting it with an enzyme to obtain a phthalide compound represented by Formula III and / or Formula IV, wherein the enzyme is an enzyme in the 2-oxoglutarate-dependent dioxygenase family or the enzyme has 2-oxoglutarate-dependent dioxygenase activity.

[0049] In Formula I, Formula II, Formula III or Formula IV, R is a straight-chain alkane having 1-10 carbon atoms without any substituent, wherein the number of carbon atoms is 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 2-3, 2-4, 2-5, 2-6, 2-7, 2-8, 2-9, 2-10, 3-4, 3-5, 3-6, 3-7, 3-8, 3-9, 3-10, 4-5, 4-6, 4-7, 4-8, 4-9, or 4-10, or specifically 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.

[0050]

[0051] In the above method, the enzyme is any of the above-mentioned polypeptides of the present application or a protein extract described below.

[0052] In the preparation method of the present application, the substrate can be any substrate that can be catalyzed by the polypeptide of the present application to form a phthalide compound, including but not limited to ligustilide A represented by Formula II or ligustilide represented by Formula I.

[0053] In the preparation method of the present application, the product is a phthalide compound, further a 3-substituted phthalide compound, including but not limited to butylphthalide represented by Formula IV or butenylphthalide represented by Formula III.

[0054] When ligustilide A is used as a substrate, butylphthalide can be generated. When ligustilide is used as a substrate, butenylphthalide can be generated.

[0055] The present application also relates to a protein extract, which is a total protein extract of Ligusticum chuanxiong Hort. roots, and the extract has 2-oxoglutarate-dependent dioxygenase activity. Methods for extracting proteins from plants are well known in the art. As a preferred embodiment of the present application, protein extraction is performed using an extraction buffer comprising a final concentration of 20 mM Tris-HCl, pH 7.5, 10 mM DTT (Dithiothreitol), 15% Glycerol, 1% PVPP (cross-linked polyvinylpyrrolidone), 1X Complete Mini Protease Inhibitor (complete TM Mini protease inhibitor cocktail) without EDTA.

[0056] The protein extract of the present application contains any of the polypeptides of the present application having 2-oxoglutarate-dependent dioxygenase activity described above or a polypeptide in the extract that is a member of the 2-oxoglutarate-dependent dioxygenase family. For example, a polypeptide whose amino acid sequence comprises SEQ ID NO: 1 or SEQ ID NO: 3 or SEQ ID NO: 15 or SEQ ID NO: 17 or SEQ ID NO: 19 or SEQ ID NO: 21.

[0057] The 2-oxoglutarate-dependent dioxygenase activity herein can be the activity of any member of the 2-oxoglutarate-dependent dioxygenase family as referred to in the prior art, or it can be the activity of catalyzing the production of a 3-substituted phthalide compound from senkyunolide A or ligustilide or analogs as discovered herein.

[0058] The enzyme can also be referred to herein as: iron(II) / 2-oxoglutarate-dependent dioxygenase OGD [e(II) / 2-oxoglutarate-dependent dioxygenase (OGD)], butylphthalide synthase, senkyunolide A oxidase.

[0059] Senkyunolide A: CAS No. 62006-39-7. The chemical full name is (3S)-3-butyl-4,5-dihydro-1 (3H)- isobenzofuranone. The English name is Senkyunolide A.

[0060] Ligustilide: CAS No. 4431-01-0. The chemical full name is 3-butylidenyl-4,5-dihydro-1 (3H)- isobenzofuranone. The English name is Ligustilide.

[0061] Butylphthalide: CAS NO. 6066-49-5. The chemical full name is 3-Butyl-1(3H)-isobenzofuranone. The English name is 3-Butylphthalide.

[0062] Butylidenephthalide: CAS NO. 551-08-6. The chemical full name is 3-Butyliden-1(3H)-isobenzofuranone. The English name is 3-Butylidenephthalide.

[0063] 3-Substituted phthalides: Butylphthalide and Butylidenephthalide are included in 3-Substituted phthalides.

[0064] Sequence similarity: The correlation between two amino acid sequences or the correlation between two nucleotide sequences is described by the parameter "sequence similarity".

[0065] 3-Substituted phthalides (such as Butylphthalide or Butylidenephthalide) include any type of optical isomer, including but not limited to the levorotatory type.

[0066] Experiments show that the polypeptide of the present application has the function of 2-ketoglutarate-dependent dioxygenase, and can catalyze the generation of Butylphthalide and Butylidenephthalide from senkyunolide A and ligustilide. The present application has important significance for effectively solving the problem of Butylphthalide resource scarcity. BRIEF DESCRIPTION OF DRAWINGS

[0067] Figure 1 Butylphthalide content in different tissues of Chuanxiong.

[0068] Figure 2 Chuanxiong root crude protein catalyzing senkyunolide A to generate Butylphthalide and Butylidenephthalide (a, Butylphthalide; b, Butylidenephthalide; c, senkyunolide A; d, ligustilide).

[0069] Figure 3 PCR identification results of recombinant plasmid Lc2OGD1 / 2.

[0070] Figure 4 GC-MS detects the total ion chromatogram (TIC) of the enzymatic product of Lc2OGD1 / 2. A, Butylphthalide; B, Butylidenephthalide.

[0071] Figure 5 Mass spectrum of the main enzymatic product of Lc2OGD1 / 2. A, Butylphthalide ion fragments; B, Butylidenephthalide ion fragments.

[0072] Figure 6 Protein body expressed by E. coli catalyzes senkyunolide A to generate Butylphthalide.

[0073] Figure 7 After the mutant was expressed in tobacco, the mutant catalyzed the generation of butylphthalide from senkyunolide A.

[0074] Figure 8 The GC-MS detected that Lc2OGD3 / 4 / 5 / 6 catalyzed the generation of butylphthalide from senkyunolide A.

[0075] Figure 9 The GC-MS detected that Lc2OGD3 / 4 / 5 / 6 catalyzed the generation of butylphthalide from senkyunolide A. DETAILED DESCRIPTION

[0076] The present application is further illustrated by the following examples. These examples are intended to be illustrative only and are not intended to limit the scope of the present application. The technical terms described in the examples are all commonly understood in the art unless otherwise specified. In addition, any methods and materials similar or equivalent to those described herein can be used in the practice of the present application. Based on the examples in the present application, all other examples obtained by those of ordinary skill in the art without creative work are within the scope of the present application. The experimental methods used in the following examples are all conventional methods unless otherwise specified. The materials, reagents and consumables used, if not specifically specified, can be obtained from commercial channels.

[0077] The Ligusticum chuanxiong Hort. plant is a commodity Ligusticum chuanxiong, which is purchased by farmers in the military town of Pengzhou City, Sichuan Province, and can be collected by the public or obtained from the online Chinese herbal medicine network.

[0078] OMEGA Plant RNA Kit (Omega), Plus All-in-one 1st Strand cDNA Synthesis SuperMix (gDNA Purge) (Novoprotein), KOD One TM PCR Master Mix-Blue- (Toyobo), Gel & PCR Clean Up Kit (Omega), HiPure PCR Pure Micro Kit (Magen), HiPure Plasmid Micro Kit C (Magen), BamH I (NEB), EocR I (NEB), Xba I (NEB), Kpn I (NEB), Fast DNA Assembly Mix (Cistrome), 2xT5 Super PCR Mix (Colony) (Beijing Qikete), StarMarker D2000 (Genstar), DH5a (Kangti Life), GV3101 (Vidbio), primer synthesis (Beijing Lihe Huada Gene Technology Co., Ltd.), gene sequencing (Beijing Lihe Huada Gene Technology Co., Ltd.).

[0079] GC-MS detection conditions: GC-MS instrument is Agilent 7890B / 7000C (Waldbronn, USA, Agilent Technology), mass spectrometry detector parameters: 70 eV, helium flow rate 1.2 mL·min -1 , chromatographic column Agilent HP-5MS (5% phenyl methyl silica, 30 m x 250 μm inner diameter, 0.25 μm film thickness); temperature program is 50℃ starting, with 4℃ / min to 130℃, then with 2℃ / min to 230℃, holding for 10 min, then with 2℃ / min to 250℃, holding for 5 min; helium flow rate 1.0 mL / min, injection port 250℃; injection mode, pulse without split, injection volume, 1 μL. Mass conditions: standard EI source (bombardment energy 70 eV), ion source temperature 230℃, interface temperature 280℃, scan mass-to-charge ratio (m / z) 40-350, and butylphenylthiophene standard or butenylphenylthiophene standard as control group, qualitative and quantitative analysis of products.

[0080] Example 1, construction of a butylphenylthiophene detection system

[0081] The roots, stems and leaves of Chuanxiong were extracted with machine solvents (such as methanol, ethyl acetate or methyl tert-butyl ether (MTBE)), and the extract was filtered through a 0.22 μm filter. The content of butylphenylthiophene was determined by high performance liquid chromatography and mass spectrometry. The results, as shown in Figure 1 , proved that the content of butylphenylthiophene in the roots of Chuanxiong was higher than that in the stems and leaves of Chuanxiong, which was consistent with the traditional medicinal parts.

[0082] Example 2, extraction and activity experiment of total protein in Ligusticum chuanxiong root

[0083] The growing Ligusticum chuanxiong root was washed, frozen in liquid nitrogen and ground, and then extracted with extraction buffer (final concentration: 20 mM Tris-HCl, pH 7.5, 10 mM DTT, 15% glycerol, 1% PVPP, 1X Complete Mini Protease Inhibitor) on ice, with gentle shaking every 15 min. After 1 h, centrifugation was performed at 13000 rpm for 20 min at 4°C, and the supernatant was collected. The supernatant was precipitated with 40%-80% ammonium sulfate, and centrifugation was performed at 13000 rpm for 20 min at 4°C after overnight incubation. The supernatant was collected. Desalting column was used, and protein concentration was determined by Pirece 660 nm protein assay reagent.

[0084] According to the protein concentration, 10 μg of total protein was taken, and 20 μL of protein solution was prepared. In the experimental group, 100 μM of ligustilide and / or zingiberene lactone was added, and in the control group, no substance was added. The other conditions were the same, and incubation was performed on ice for 1 h, with gentle shaking every 15 min. After 1 h, the reaction was terminated by adding an equal volume of ethyl acetate, and centrifugation was performed at 13000 rpm for 10 min. After filtration with a 0.22 μM filter, GC-MS detection was performed.

[0085] The detection results are shown in Table 1. Figure 2 The results show that there is an enzyme in Ligusticum chuanxiong root, which can catalyze ligustilide and zingiberene lactone to generate butylphenylphthalide and butenylphthalide.

[0086] Example 3, cloning and sequence analysis of Lc2OGD1 and Lc2OGD2 in Ligusticum chuanxiong

[0087] 1) Screening and sequence analysis of Lc2OGD gene

[0088] According to the sequenced genome and transcriptome data of Ligusticum chuanxiong, through annotation and differential expression gene analysis, four oxidase genes with complete open reading frames were found in the root transcriptome database of Ligusticum chuanxiong, which were named as Lc2OGD1, Lc2OGD2, Lc2OGD3 and Lc2OGD4 (Ligusticum chuanxiong Fe(II) / 2-oxoglutarate-dependent dioxygenase) respectively. Through sequence alignment analysis, it was found that the amino acid sequences of Lc2OGD1 and Lc2OGD2 were most similar to prolyl 4-hydroxylase 6 in carrot and DNA oxidative demethylase respectively. The amino acid sequence and nucleotide sequence of the reading frame of Lc2OGD1 and Lc2OGD2 are shown in SEQ ID No. 1, SEQ ID No. 2 and SEQ ID No. 3, SEQ ID No. 4 respectively.

[0089] 2) Synthesis of cDNA of Ligusticum chuanxiong root

[0090] An appropriate amount of Ligusticum chuanxiong root (stored in a -80°C refrigerator) was ground in liquid nitrogen. The total RNA of Ligusticum chuanxiong was extracted by Trizon method, and after extraction, the total RNA was refined by DNase I and RNA purification kit to remove genomic contamination in the RNA.

[0091] According to the first strand cDNA synthesis kit of Novoprotein Plus All-in-one 1stStrand cDNA Synthesis SuperMix(gDNA Purge) instructions, the reverse transcription system is as follows:

[0092] (1) Genomic DNA removal reaction:

[0093]

[0094] Incubate at 42°C for 5 min, and then place on ice after the reaction is completed.

[0095] (2) Reverse transcription reaction:

[0096]

[0097]

[0098] Incubate at 50°C for 30 min, incubate at 75°C for 5 min, and terminate the reaction.

[0099] The cDNA sample is stored at -20°C.

[0100] 3) Cloning of Lc2OGD

[0101] Based on the nucleotide sequence of Lc2OGD gene, synthetic primers of Lc2OGD gene were designed, which contained Xba I and Kpn I restriction enzyme site sequences. The cDNA of Ligusticum chuanxiong was used as a template to amplify Lc2OGD gene by PCR method, and recombined with linear pSuper1300 vector digested by Xba I and Kpn I. The recombined plasmid was obtained by Fast DNA Assembly Mix kit method, and then transformed into E. coli DH5a. The plasmid was extracted and sequenced (Beijing Huada Gene Technology Co., Ltd.), and the positive recombined plasmid was named as pSuper1300-Lc2OGD.

[0102] The sequence of the amplification primer of Lc2OGD is as follows:

[0103] Lc2OGD1-Forward:

[0104] CTCGATACACCAAATCGACTCTAGA ATGGCGACCAAGGCCAA (SEQ ID No. 5, the underlined sequence is the vector sequence)

[0105] Lc2OGD1-Reverse:

[0106] CCCTTGCTCACCATGGTACC CTACGCGGAGCAAGCATTACA (SEQ ID No. 6, the underlined sequence is the vector sequence)

[0107] Lc2OGD2-Forward:

[0108] CTCGATACACCAAATCGACTCTAGA ATGGAGCAATTTGTGAGCAG (SEQ ID No. 7, the underlined sequence is the vector sequence)

[0109] Lc2OGD2-Reverse:

[0110] CCCTTGCTCACCATGGTACC TTACGACAGATAGTAGAACAA (SEQ ID No. 8, the underlined sequence is the vector sequence)

[0111] 4) Gel recovery

[0112] Gel recovery step:

[0113] The PCR product was mixed with DNA loading buffer, and electrophoresed on a 1% agarose gel at 140V for 15 minutes;

[0114] Cut the gel containing DNA fragments with a razor blade as close to the DNA fragments as possible, place the cut gel into a 1.5 mL centrifuge tube that has been weighed and weigh the gel, record the weight of the recovered gel;

[0115] Add an equal volume of Binging buffer (V:m = 1 : 1), incubate in a 50°C water bath for 10 min, invert to mix 2-3 times during incubation to promote gel melting, ensure the gel is completely dissolved, vortex the gel mixture once quickly before loading onto the column;

[0116] Transfer up to 750 μL of the gel mixture to the recovery and purification column, centrifuge at 13,000 rpm for 1 min, discard the flow-through, then place the recovery column back into the same collection tube;

[0117] Add 700 μL of Wash Buffer to the purification column, centrifuge at 13,000 rpm for 1 min, discard the flow-through, then place the purification column back into the collection tube;

[0118] Centrifuge the empty purification column at 13,000 rpm for 1 min to remove any residual Wash Buffer;

[0119] Remove the purification column to a 1.5 mL microcentrifuge tube, add 30-50 μL of ddH2O (pre-warmed at 65°C) to the purification column, let stand for 2 min, centrifuge at 13,000 rpm for 1 min;

[0120] Discard the purification column, store the purified DNA at -80°C.

[0121] Example 4, Tobacco Heterologous Expression of Lc2OGD1 and Lc2OGD2

[0122] The recombinant vector in Example 3 was introduced into Agrobacterium GV3101, and the recombinant Agrobacterium GV3101 was used to infect N. benthamiana leaves. Agrobacterium carrying pSuper1300 vector was used as a control strain to infect N. benthamiana leaves. N. benthamiana was cultured at 25°C under 16 h light conditions, and was used for Agrobacterium infection when it grew to 6 true leaves. The Agrobacterium containing the recombinant plasmid was cultured at 28°C to OD 600 = 1.0, the bacterial cells were resuspended with injection buffer and then detoxified in injection buffer for 2 h at room temperature in the dark. The injection buffer formula (i.e., the following Agrobacterium resuspension solution). Then, 1 mL of sterile syringe was used to inject into the tobacco leaves on the back of the tobacco leaf, and the tobacco was cultured at 25°C under 16 h light conditions for 3 days. Then, 100 μM of the substrate senkyunolide A or ligustilide was injected. One day after the substrate was injected, the tobacco was collected and stored at -80°C for use.

[0123] Agrobacterium resuspension solution

[0124]

[0125] Example 5 Extraction and identification of catalytic products of Lc2OGD1 and Lc2OGD2

[0126] The tobacco was ground into powder by mortar after freeze-drying, and 100 mg of the tobacco was extracted with 2 mL of ethyl acetate. The extract was ultrasonically treated for 30 min, centrifuged at 12,000 rpm for 10 min at 4°C, and the supernatant was collected. The supernatant was filtered into a brown sample bottle with a 0.45 μm nylon filter under vacuum concentration to 0.5 mL. The sample was ready for injection. The content of butylphthalide and butenylphthalide in the transgenic tobacco was detected by GC-MS.

[0127] The PCR identification results of the recombinant plasmid Lc2OGD1 / 2 are shown in Figure 3 , and the catalytic results are shown in Figure 4 and Figure 5 .The results in Figure 4 and 5 show that Lc2OGD1 and Lc2OGD2 can catalyze the synthesis of butylphthalide and butenylphthalide from senkyunolide A.

[0128] Example 6 Detection of catalytic activity of Lc2OGD1 and Lc2OGD2 expressed in E. coli

[0129] The recombinant plasmid in Example 3 was constructed into a pMal vector, and the vector was transformed into Rosetta (DE3). After verification of the transformation, a single colony was selected and cultured overnight at 37°C. The next day, a small amount of the overnight culture was taken and further expanded at 37°C and 200 rpm until the OD 600 value of the bacteria reached about 0.6. After 1 hour of treatment with 0.5 M IPTG, 20 μL of senkyunolide A was added, and the mixture was incubated at 16°C and 180 rpm for 12 hours. An equal volume of ethyl acetate was added, and the mixture was ultrasonically extracted for 30 min. The organic phase was collected, vacuum-concentrated and dried, and 200 μL of ethyl acetate was added to dissolve the residue. The content of butylphthalide was detected by GC-MS. The results show that Lc2OGD1 and Lc2OGD2 can catalyze the synthesis of butylphthalide from senkyunolide A. Figure 6

[0130] Example 7 Construction of a mutant recombinant expression vector

[0131] Sequence analysis, molecular docking and mutation were performed on Lc2OGD1, and five active sites related to the catalytic efficiency of Lc2OGD1 were found, which were the amino acid residues at positions 66, 76, 102, 165 and 180. Different forms of mutation were performed on these five amino acid sites (Table 1), and five Lc2OGD1 protein mutants were obtained (Table 2).

[0132] Double-stranded molecule 1 was inserted into expression vector pSuper1300 to obtain recombinant expression vector pSuper1300-W180A (sequencing verified correct). Double-stranded DNA molecule 1 was obtained by point mutation of Lc2OGD1. Compared with Lc2OGD1 gene SEQ ID No. 2, the difference of double-stranded DNA molecule 1 is only that the sequence from 5' end 538th t is mutated to g, and 539th g is mutated to c. Compared with Lc2OGD1 protein SEQ ID No. 1, the difference of DNA molecule 1 encoded protein is only that the sequence shown in 180th W is mutated to A.

[0133] Double-stranded molecule 2 was inserted into expression vector pSuper1300 to obtain recombinant expression vector pSuper1300-Y102A (sequencing verified correct). Double-stranded DNA molecule 2 was obtained by point mutation of Lc2OGD1. Compared with Lc2OGD1 gene SEQ ID No. 2, the difference of double-stranded DNA molecule 2 is only that the sequence from 5' end 304th t is mutated to g, and 305th a is mutated to c. Compared with Lc2OGD1 protein SEQ ID No. 1, the difference of DNA molecule 2 encoded protein is only that the sequence shown in 102th Y is mutated to A.

[0134] Double-stranded molecule 3 was inserted into expression vector pSuper1300 to obtain recombinant expression vector pSuper1300-Y76F (sequencing verified correct). Double-stranded DNA molecule 3 was obtained by point mutation of Lc2OGD1. Compared with Lc2OGD1 gene SEQ ID No. 2, the difference of double-stranded DNA molecule 3 is only that the sequence from 5' end 227th a is mutated to t. Compared with Lc2OGD1 protein SEQ ID No. 1, the difference of DNA molecule 3 encoded protein is only that the sequence shown in 76th Y is mutated to F.

[0135] Double-stranded molecule 4 was inserted into expression vector pSuper1300 to obtain recombinant expression vector pSuper1300-G165A (sequencing verified correct). Double-stranded DNA molecule 4 was obtained by point mutation of Lc2OGD1. Compared with Lc2OGD1 gene SEQ ID No. 2, the difference of double-stranded DNA molecule 4 is only that the sequence from 5' end 494th g is mutated to c. Compared with Lc2OGD1 protein SEQ ID No. 1, the difference of DNA molecule 4 encoded protein is only that the sequence shown in 165th G is mutated to A.

[0136] The double-stranded molecule 5 was inserted into the expression vector pSuper1300 to obtain the recombinant expression vector pSuper1300-Q66A (verified correct by sequencing). The double-stranded DNA molecule 5 was obtained by point mutation of Lc2OGD1. Compared with the Lc2OGD1 gene SEQ ID No. 2, the double-stranded DNA molecule 5 only differs in that the sequence from the 5' end 196th c is mutated to g, and the 197th a is mutated to c. Compared with the Lc2OGD1 protein SEQ ID No. 1, the difference between the protein encoded by the DNA molecule 5 is only that the 66th Q in the sequence is mutated to A.

[0137] Table 1 Amino acid sites and their mutant forms

[0138]

[0139] Table 2 Mutant information

[0140] Mutant name Amino acid mutant form Nucleotide mutant form LcOGD1 w180A W180A t538g,g539c LcOGD1 Y102A Y102A t304g,a305c LcOGD1 Y76F Y76F a227t LcOGD1 G165A G165A g494c LcOGD1 Q66A Q66A c196g,a197c

[0141] The relevant primers for preparing the mutants are as follows:

[0142] Q66A-F: SEQ ID NO: 22; Q66A-R: SEQ ID NO: 23;

[0143] Y76F-F: SEQ ID NO: 24; Y76F-R: SEQ ID NO: 25;

[0144] Y102A-F: SEQ ID NO: 26; Y102A-R: SEQ ID NO: 27;

[0145] G165A-F: SEQ ID NO: 28; G165A-R: SEQ ID NO: 29;

[0146] W180A-F: SEQ ID NO: 30; W180A-R: SEQ ID NO: 31.

[0147] Example 8, Tobacco heterologous expression of mutants

[0148] The recombinant vector in Example 7 was introduced into Agrobacterium GV3101, and the recombinant Agrobacterium GV3101 was used to infect Nicotiana benthamiana leaf. Agrobacterium carrying the pSuper1300 vector was used as a control strain to infect Nicotiana benthamiana leaf. Nicotiana benthamiana was cultured at 25°C under 16h light conditions, and was used for Agrobacterium infection when it grew to 6 true leaves. The Agrobacterium containing the recombinant plasmid was cultured at 28°C to OD600=0.8, and then diluted to OD600=0.2. The Agrobacterium was used to infect the abaxial surface of the Nicotiana benthamiana leaf, and the leaf was cultured at 25°C under 16h light conditions. After 3 days, the leaf was collected and ground into a powder, and then 200 mg of the powder was added to 1.5 ml of 2x Laemmli buffer, and boiled for 10 min. The supernatant was collected and used for SDS-PAGE analysis. 600= 1.0, the bacterial body was washed once by resuspending with injection buffer, and then detoxified in injection buffer for 2 h at room temperature, avoiding light. The injection buffer formula (Agrobacterium resuspension). Then, 1 mL of sterile syringe was injected into the back of the tobacco leaf, avoiding light overnight, and cultured at 25°C under 16 h light conditions. After 3 days, 100 μM of the substrate senkyunolide A was injected. After 1 day of injecting the substrate senkyunolide A, the tobacco was collected and stored at -80°C for later use.

[0149] Agrobacterium resuspension

[0150]

[0151] Example 9 Extraction and identification of mutant catalyzed products

[0152] After the tobacco was freeze-dried, it was ground into powder with a mortar. Every 100 mg of tobacco was extracted with 2 mL of ethyl acetate. The extract was ultrasonically treated for 30 min, and centrifuged at 12000 rpm for 10 min at 4°C. The supernatant was collected, vacuum concentrated to 0.5 mL, and filtered through a 0.45 μm nylon filter into a brown sample bottle for later injection. The content of butylphthalide in the transgenic tobacco was detected by GC-MS.

[0153] The results are shown in Table 1, which shows that W180A, Y102A and Y76F can enhance the catalytic efficiency of Lc2OGD1, and G165A and Q66A cannot enhance the catalytic efficiency of Lc2OGD1. Figure 7

[0154] Example 10 Cloning and sequence analysis of Lc2OGD3, Lc2OGD4, Lc2OGD5, Lc2OGD6 in Ligusticum chuanxiong

[0155] 1) Screening and sequence analysis of genes

[0156] According to the sequenced Ligusticum chuanxiong genome and transcriptome data, through annotation and differential gene analysis, four oxidase genes with complete open reading frames were found in the root transcriptome database of Ligusticum chuanxiong, which were named Lc2OGD3, Lc2OGD4, Lc2OGD5, Lc2OGD6 (Ligusticum chuanxiong Fe(II) / 2-oxoglutarate-dependent dioxygenase) respectively. Their nucleotide sequences are SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20 in turn; their amino acid sequences are SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 9, SEQ ID NO: 21 in turn.

[0157] The relevant primers are as follows:​

[0158] LcOGD3

[0159] F: GATATCGTCGACGGATCC ATGGAGAGTTCTGAGTGTATTAGG (SEQ ID NO: 32)

[0160] R: AATTACCTGCAGGGAATTC CAGTTTAAGTTGATCTAAGAGGC (SEQ ID NO: 33)

[0161] Lc2OGD4

[0162] F: GATATCGTCGACGGATCC ATGGCTTCTCCAAAAGTTG (SEQ ID NO: 34)

[0163] R: AATTACCTGCAGGGAATTC GTAGATAATTTTCATTTCGTTCA (SEQ ID NO: 35)

[0164] Lc2OGD5

[0165] F: GATATCGTCGACGGATCC ATGGAGAGTATTAGGGGACTAGA (SEQ ID NO: 36)

[0166] R: AATTACCTGCAGGGAATTC CAGTTTAAGTTGATCTAAGAGGC (SEQ ID NO: 37)

[0167] Lc2OGD6

[0168] F: GATATCGTCGACGGATCC ATGGCTCCAAGTTTTGATAA (SEQ ID NO: 38)

[0169] R: AATTACCTGCAGGGAATTC AACTCCTGTATTGCTCTTTTG (SEQ ID NO: 39)

[0170] 2) Synthesis of cDNA of the roots of Chuanxiong

[0171] An appropriate amount of the roots of Chuanxiong (-80 °C refrigerator storage) was ground in liquid nitrogen. The total RNA of Chuanxiong was extracted by the Trizon method, and after extraction, the total RNA was refined by using DNase I and an RNA purification kit to remove genomic contamination in the RNA.

[0172] According to the first strand cDNA synthesis kit of Novoprotein Plus All-in-one 1stStrand cDNA Synthesis SuperMix(gDNA Purge)instruction manual, and the reverse transcription system is as follows:

[0173] (1) Genomic DNA reaction:

[0174]

[0175] Incubate at 42°C for 5 min, and then place on ice after the reaction is completed.

[0176] (2) Reverse transcription reaction:

[0177]

[0178] Incubate at 50°C for 30 min, incubate at 75°C for 5 min, and terminate the reaction.

[0179] The cDNA sample is stored at -20°C.

[0180] 3) Cloning of Lc2OGD

[0181] According to the nucleotide sequence of the Lc2OGD gene, synthetic primers of the Lc2OGD gene are designed, and the primers contain Xba I and Kpn I enzyme digestion site sequences. The cDNA of Ligusticum chuanxiong is used as a template, and the Lc2OGD gene is amplified by PCR, recombined with the linear pSuper1300 vector digested by Xba I and Kpn I, and the recombined plasmid is obtained by using the Fast DNA Assembly Mix kit, and then the plasmid is extracted and sequenced (Beijing Lihe Huada Gene Technology Co., Ltd.) after being transferred into Escherichia coli DH5α, and the positive recombinant plasmid is named pSuper1300-Lc2OGD.

[0182] 4) Gel recovery: same as the previous example.

[0183] Example 11 Detection of catalytic activity of Lc2OGD3, Lc2OGD4, Lc2OGD5, and Lc2OGD6 expressed in Escherichia coli

[0184] The recombinant plasmid in the implementation case 10 is constructed into the pMal vector, and the vector is transferred into Rosetta (DE3), and after verification, a single colony is selected and cultured overnight at 37°C. The next day, a small amount of bacteria is taken from the overnight culture, and the bacteria are further cultured at 37°C and 200 rpm until the OD 600When the pH value reached approximately 0.6, after treatment with 0.5 M IPTG for 1 hour, 20 μL of ligustilide A was added, and the mixture was co-cultured at 16℃ and 180 rpm for 12 hours. An equal volume of ethyl acetate was added, and the mixture was ultrasonically extracted for 30 min. The organic phase was collected, concentrated and dried under vacuum, and reconstituted with 200 μL of ethyl acetate. The content of butylphthalide was determined by GC-MS. The results showed that Lc2OGD3, Lc2OGD4, Lc2OGD5, and Lc2OGD6 could catalyze the formation of butylphthalide from ligustilide A. Figure 8 ).

[0185] Example 12: Detection of catalytic activity of Lc2OGD3, Lc2OGD4, Lc2OGD5, and Lc2OGD6 expressed in Escherichia coli

[0186] The recombinant plasmid from Case 10 was constructed into the pMal vector, which was then transformed into Rosetta(DE3). After verification of the transformation, single clones were selected and cultured overnight at 37°C. The next day, a small amount of the overnight culture was aspirated and cultured at 37°C and 200 rpm to further expand the culture until the bacterial OD value reached its maximum. 600 The pH value reached approximately 0.6. After treatment with 0.5 M IPTG for 1 hour, 50 μM ligustilide was added, and the mixture was co-cultured at 37°C and 180 rpm for 12 hours. An equal volume of ethyl acetate was added, and the mixture was ultrasonically extracted for 30 min. The organic phase was collected, concentrated and dried under vacuum, and reconstituted with 200 μL of ethyl acetate. The content of butenylphthalide was determined by GC-MS. The results showed that Lc2OGD3, Lc2OGD4, Lc2OGD5, and Lc2OGD6 could catalyze the formation of butenylphthalide from ligustilide. Figure 9 ).

[0187] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A polypeptide, which is any one of the following: (1) a polypeptide having an amino acid sequence of SEQ ID NO: 1; (2) a polypeptide mutant obtained by any one of the following mutations on the basis of the amino acid sequence shown in SEQ ID NO: 1: W180A, Y102A, Y76F, G165A, Q66A; (3) a fusion polypeptide formed by fusing a tag to the N-terminus or C-terminus of the polypeptide shown in (1) or (2).

2. A polynucleotide encoding the polypeptide of claim 1.

3. The polynucleotide of claim 2, wherein: The polynucleotide is shown in SEQ ID NO: 2 or SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 12 or SEQ ID NO:

13.

4. A recombinant vector, a nucleic acid construct or a recombinant host cell containing the polynucleotide of claim 2 or 3.

5. A method for preparing a phthalide compound, comprising the following steps: using senkyunolide A as a substrate, contacting it with an enzyme to obtain butylphthalide, or using ligustilide as a substrate, contacting it with an enzyme to obtain butylidenephthalide, wherein the enzyme is any one or several of the polypeptides of claim 1.

6. A method for preparing the polypeptide of claim 1, comprising the following steps: under conditions favorable to the expression of the polypeptide, expressing the recombinant host cell containing the polynucleotide of claim 4 to obtain the polypeptide of claim 1.

7. Use of the polypeptide of claim 1 in catalyzing the generation of butylphthalide from senkyunolide A or the generation of butylidenephthalide from ligustilide.

8. Use of the polynucleotide of claim 2 or 3 in catalyzing the generation of butylphthalide from senkyunolide A or the generation of butylidenephthalide from ligustilide.

9. Use of the recombinant vector, the nucleic acid construct or the recombinant host cell of claim 4 in catalyzing the generation of butylphthalide from senkyunolide A or the generation of butylidenephthalide from ligustilide.

Images