Saccharomyces cerevisiae xtc-y11 and microbial inoculum and application
By using the brewing yeast XTC-y11, which produces a high amount of ester aroma compounds, the problem of poor taste in fermented dough products has been solved, and the aroma and taste of fermented dough products, especially steamed buns, have been improved.
Patent Information
- Application Number
- CN202310333709.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-03-31
- Publication Date
- 2026-03-27
- Estimated Expiration
- 2043-03-31
AI Technical Summary
Fermented dough products made with existing commercial yeast have poor taste, and the taste of sourdough fermented dough varies depending on the region and fermentation process, making it difficult to replace the unique flavor of traditional sourdough fermentation.
A brewing yeast strain XTC-y11 that produces high levels of ester aroma compounds was provided. Through fermentation in malt extract medium, it produces more isoamyl acetate, ethyl acetate, isocyanate, phenylethyl acetate, and acetoacetate, which can be applied to fermented flour products such as bread, steamed buns, steamed cakes, and mantou.
It improves the aroma and texture of fermented flour products, especially significantly enhancing the sensory scores of steamed buns, increasing the content of esters, and enriching the flavor.
Smart Images

Figure CN116555057B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of fermented food, and particularly relates to a Saccharomyces cerevisiae XTC-y11, a bacterial agent and application. BACKGROUND
[0002] Saccharomyces cerevisiae occupies an irreplaceable position in the fermented flour product industry, and plays a crucial role in the generation of ester, alcohol and aldehyde aroma substances in fermented flour products.
[0003] Steamed buns, as a traditional fermented flour product in China, especially in the dietary structure of consumers in northern China, occupy an important position. Old dough is a traditional steamed bun making method that has been used for many years, and the raw materials used are rich in variety (fruits, corn flour, wheat flour, distiller's yeast, etc.), which can give steamed buns unique texture and rich flavor. The fermented flour product prepared from the old dough has a special flavor and taste that cannot be replaced by commercial yeast, so the steamed buns fermented by old dough are more popular with consumers. However, due to the differences in different regions and different fermentation processes, the old dough has a unique microbial flora composition, so the taste of the fermented flour product prepared from the old dough in different regions is unstable, and the commercial yeast used at present cannot produce a good taste of the fermented flour product, therefore, finding a fermentation strain that can produce more aroma substances to replace the old dough for the preparation of fermented flour products is a difficult problem that we need to solve at present. SUMMARY
[0004] The purpose of the present application is to provide a Saccharomyces cerevisiae XTC-y11, which is a high-yield ester aroma substance-producing Saccharomyces cerevisiae, and can produce more aroma substances in the preparation of fermented flour products.
[0005] In order to solve the above technical problems, the present application provides the following technical solutions:
[0006] The present application provides a Saccharomyces cerevisiae XTC-y11 with a preservation number of CGMCC No.25927.
[0007] The present application provides a bacterial agent containing the Saccharomyces cerevisiae XTC-y11 of the above technical solution.
[0008] The present application provides the application of the Saccharomyces cerevisiae XTC-y11 of the above technical solution or the bacterial agent of the above technical solution in the fermentation production of ester substances.
[0009] Preferably, the application comprises the following steps:
[0010] S. cerevisiae XTC-y11 is inoculated into a fermentation medium to perform fermentation culture, and a fermentation liquor containing ester substances is obtained.
[0011] The fermentation medium comprises a wort medium.
[0012] Preferably, the ester substances comprise one or more of ethyl acetate, isocyanate, phenethyl acetate and acetoacetate.
[0013] The application provides application of the S. cerevisiae XTC-y11 or the microbial agent in preparation of fermented flour products and / or increasing the content of ester substances in the fermented flour products.
[0014] Preferably, the viable cell count of the S. cerevisiae XTC-y11 is greater than or equal to 10 8 CFU / g.
[0015] Preferably, the ester substances comprise one or more of ethyl acetate, isocyanate, phenethyl acetate and acetoacetate.
[0016] Preferably, the fermented flour products comprise one or more of bread, steamed buns, sponge cake, steamed buns and sesame seed cake.
[0017] The application provides a S. cerevisiae XTC-y11 with a preservation number of CGMCC No. 25927, which is a S. cerevisiae with high yield of ester aroma substances, and the fermented flour product prepared from the S. cerevisiae XTC-y11 can produce more aroma substances.
[0018] The results of the examples show that the content of isoamyl acetate in the fermentation liquor of the S. cerevisiae XTC-y11 in the wort medium after 24 h of fermentation is 14.4637 μg / L, and the S. cerevisiae XTC-y11 produces more isoamyl acetate to increase the aroma of steamed buns when the S. cerevisiae XTC-y11 is used to ferment the steamed buns, and the sensory score of the steamed buns is high. It can be seen that the S. cerevisiae XTC-y11 has a good application prospect in preparation of fermented flour products.
[0019] Biological preservation instructions
[0020] Saccharomyces cerevisiae XTC-y11 with the preservation number of CGMCC No. 25927 was preserved in China General Microbiological Culture Collection Center (CGMCC) on October 17, 2022, and the address of the preservation center is No. 1, Beichen West Road, Haidian District, Beijing. BRIEF DESCRIPTION OF DRAWINGS
[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced as follows.
[0022] Figure 1 A colony morphology diagram of Saccharomyces cerevisiae XTC-y11 in Example 1 on yeast extract peptone dextrose agar medium (YPD);
[0023] Figure 2 A colony morphology diagram of Saccharomyces cerevisiae CICC-31616 in Comparative Example 1 on yeast extract peptone dextrose agar medium (YPD);
[0024] Figure 3 An agarose gel electrophoresis diagram of the PCR amplification product of Saccharomyces cerevisiae XTC-y11 in Example 1;
[0025] Figure 4 A BLAST analysis diagram of the sequencing results of the 18S rDNA gene sequence of Saccharomyces cerevisiae XTC-y11 in Example 1 in the NCBI database;
[0026] Figure 5 A determination result of the total ester content of the fermentation liquid of Saccharomyces cerevisiae XTC-y11 fermented for 24h in Example 2 and the total ester content of the fermentation liquid of Saccharomyces cerevisiae CICC-31616 fermented for 24h in Comparative Example 2;
[0027] Figure 6 A GC-MS peak diagram of the fermentation liquid prepared by Saccharomyces cerevisiae XTC-y11 in Example 3 and the fermentation liquid of Saccharomyces cerevisiae CICC-31616 in Comparative Example 3.
[0028] Figure 7 A sensory radar chart of the fermented steamed buns prepared by Saccharomyces cerevisiae XTC-y11 in Example 3 and the fermented steamed buns prepared by Saccharomyces cerevisiae CICC-31616 in Comparative Example 3. DETAILED DESCRIPTION
[0029] The application provides a Saccharomyces cerevisiae XTC-y11, and the preservation number is CGMCC No. 25927. The 18S rDNA gene sequence of the Saccharomyces cerevisiae XTC-y11 is shown in SEQ ID NO. 1.
[0030] SEQ ID NO. 1 sequence: TAAAGAAATTTAATAATTTTGAAAATGGATTTTTTT TGTTTTGGCAAGAGCATGAGAGCTTTTACTGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAAACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATTTATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTTCCAAAGAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAACTGCGGCTAATCTTTTTTATACTGAGCGTATTGGAACGTTATCGATAAGAAGAGAGCGTCTAGGCGAACAATGTTCTTAAAGTTGACCTCAAATCAGGTAGGAGTACCCGC.
[0031] The Saccharomyces cerevisiae XTC-y11 is isolated from a naturally fermented old flour sample, and is a Saccharomyces cerevisiae with high yield of ester aroma substances, wherein the total ester yield of the Saccharomyces cerevisiae XTC-y11 in a wort fermentation culture medium reaches 0.97 g / 100 mL after 24 h of fermentation culture, and the content of ester substances in steamed buns can be increased. The Saccharomyces cerevisiae XTC-y11 has excellent abilities of producing isoamyl acetate, ethyl acetate, isocyanate, phenethyl acetate and acetyl acetate, and when the Saccharomyces cerevisiae XTC-y11 is applied to the fermentation production of fermented flour products, more isoamyl acetate, ethyl acetate, isocyanate, phenethyl acetate and acetyl acetate can be produced to increase the aroma of the fermented flour products. The colony morphology of the Saccharomyces cerevisiae XTC-y11 is round, milky white, the surface is moist and smooth, the colony is slightly raised, and the colony is round or oval under a microscope, and the Saccharomyces cerevisiae XTC-y11 has the ability of budding.
[0032] The application provides a microbial agent containing the Saccharomyces cerevisiae XTC-y11.
[0033] The microbial agent preferably comprises a liquid microbial agent, and in the application, the preparation method of the liquid microbial agent of the Saccharomyces cerevisiae XTC-y11 preferably comprises activating culture of the Saccharomyces cerevisiae XTC-y11 seed liquid to obtain the liquid microbial agent of the Saccharomyces cerevisiae XTC-y11. The preparation of the Saccharomyces cerevisiae XTC-y11 seed liquid preferably comprises inoculating the Saccharomyces cerevisiae XTC-y11 preserved on a slope into YPD liquid medium for activation culture to obtain the Saccharomyces cerevisiae XTC-y11 seed liquid. The inoculation amount and inoculation mode during the activation culture are not particularly limited, and a conventional method can be used. The activation culture comprises sequentially performing first activation culture and second activation culture, the temperature of the first activation culture is preferably 25-30 DEG C, and more preferably 28 DEG C, and the time is preferably 24-48 h, and more preferably 36 h. The culture medium of the activation culture is preferably YPD liquid medium.
[0034] The first activation culture obtains the Saccharomyces cerevisiae XTC-y11 seed liquid, and the Saccharomyces cerevisiae XTC-y11 seed liquid is preferably subjected to second activation culture to obtain the liquid microbial agent of the Saccharomyces cerevisiae XTC-y11. The temperature of the fermentation culture of the Saccharomyces cerevisiae XTC-y11 seed liquid is preferably 25-30 DEG C, and more preferably 28 DEG C, the time is preferably 24-48 h, and more preferably 36 h. The culture medium of the second activation culture is preferably YPD liquid medium. The inoculation amount of the Saccharomyces cerevisiae XTC-y11 seed liquid during the second activation culture is preferably 1.5%-3% of the volume of the YPD liquid medium, and more preferably 2%.
[0035] The fermentation culture obtains the fermentation liquor of Saccharomyces cerevisiae XTC-y11, and the fermentation liquor of Saccharomyces cerevisiae XTC-y11 is preferably centrifuged to obtain the bacterial slurry, and the bacterial slurry is sequentially washed and resuspended to obtain the liquid bacterial agent of Saccharomyces cerevisiae XTC-y11. The centrifugal speed of the fermentation liquor of Saccharomyces cerevisiae XTC-y11 is preferably 6500-7500 r / min, and more preferably 7000 r / min; and the centrifugal time is preferably 5-7 min, and more preferably 6 min. The washing is preferably completed by using sterile PBS buffer or sterile NaCl solution. The sterile NaCl solution is preferably a sterile NaCl solution with a mass concentration of 0.85%. The same solution is preferably used for the washing and resuspension. The sterile PBS buffer or the sterile NaCl solution used for the washing and resuspension is not particularly limited, and a conventional method can be used. After resuspension, the OD 600 of the liquid bacterial agent of Saccharomyces cerevisiae XTC-y11 is preferably 0.8-1.2, and more preferably 1. 7 The viable bacterial count of the liquid bacterial agent of Saccharomyces cerevisiae XTC-y11 is preferably 10 8 cfu / mL-10 8 cfu / mL, and more preferably 10
[0036] In the present application, the composition of the YPD liquid medium is preferably 9-11 g of yeast extract, 19-21 g of peptone and 19-21 g of glucose per 1000 mL of distilled water, and more preferably 10 g of yeast extract, 20 g of peptone and 20 g of glucose per 1000 mL of distilled water.
[0037] The present application provides the application of the Saccharomyces cerevisiae XTC-y11 or the bacterial agent in the fermentation production of ester substances.
[0038] The application preferably comprises the following steps: inoculating the Saccharomyces cerevisiae XTC-y11 into a fermentation medium for fermentation culture to obtain a fermentation liquor containing ester substances; and the fermentation medium comprises a wort medium.
[0039] The Saccharomyces cerevisiae XTC-y11 preferably comprises a liquid bacterial agent of Saccharomyces cerevisiae XTC-y11, and the OD 600 of the liquid bacterial agent of Saccharomyces cerevisiae XTC-y11 before inoculation is preferably 0.8-1.2, and more preferably 1. The preparation method of the liquid bacterial agent of Saccharomyces cerevisiae XTC-y11 has been described above, and will not be repeated here.
[0040] The Saccharomyces cerevisiae XTC-y11 liquid inoculum is inoculated into a wort culture medium for fermentation culture, and a fermentation liquor containing ester substances is obtained. The rotation speed of the Saccharomyces cerevisiae XTC-y11 liquid inoculum inoculated into the wort culture medium for fermentation culture is preferably 120-180 r / min, further preferably 140-160 r / min, and more preferably 150 r / min. The inoculation amount of the Saccharomyces cerevisiae XTC-y11 liquid inoculum is preferably 2%-3% of the volume of the wort culture medium, further preferably 2%-2.5%, and more preferably 2%. The temperature of the Saccharomyces cerevisiae XTC-y11 liquid inoculum inoculated into the wort culture medium for fermentation culture is preferably 25-30℃, and more preferably 28℃. The fermentation culture time is preferably 24-48 h, further preferably 24-36 h, and more preferably 24 h.
[0041] The purpose of inoculating the Saccharomyces cerevisiae XTC-y11 liquid inoculum into the wort culture medium for fermentation culture is to further promote the synthesis of ester substances and isoamyl acetate, ethyl acetate, isocyanate, phenethyl acetate and acetoacetic ester by the Saccharomyces cerevisiae XTC-y11. It is proved that the Saccharomyces cerevisiae XTC-y11 has excellent ability to produce isoamyl acetate, ethyl acetate, isocyanate, phenethyl acetate and acetoacetic ester. When the Saccharomyces cerevisiae XTC-y11 is applied to the production of fermented flour products, the Saccharomyces cerevisiae XTC-y11 can increase the aroma of steamed buns by producing more isoamyl acetate, ethyl acetate, isocyanate, phenethyl acetate and acetoacetic ester. The isoamyl acetate content in the fermentation liquor obtained by inoculating the liquid inoculum into the wort culture medium for fermentation culture for 24 h is preferably 14-15 μg / L, and more preferably 14.4637 μg / L. The ethyl acetate content is preferably 40-50 μg / L, and more preferably 41.1432 μg / L. The isocyanate content is preferably 8-12 μg / L, and more preferably 10.2700 μg / L. The phenethyl acetate content is preferably 10-15 μg / L, and more preferably 13.4194 μg / L. The acetoacetic ester content is preferably 2-4 μg / L, and more preferably 3.1301 μg / L. The total ester yield in the fermentation liquor obtained by inoculating the liquid inoculum into the wort culture medium for fermentation culture for 24 h is increased, and the total ester yield preferably reaches 0.9 g / 100 mL-1 g / 100 mL, and more preferably 0.97 g / 100 mL.
[0042] The composition of the wort culture medium is preferably 70 mL of wort per 1000 mL of water, and the pH is natural. The Saccharomyces cerevisiae XTC-y11 inoculum is preferably a liquid inoculum, and a solid inoculum can also be prepared by adding a corresponding carrier material to the liquid inoculum.
[0043] The application provides application of the Saccharomyces cerevisiae XTC-y11 or the microbial agent in the preparation of fermented flour products and / or the increase of the content of ester substances in the fermented flour products.
[0044] In the application, the viable cell count of the Saccharomyces cerevisiae XTC-y11 in the dough during the preparation of the fermented flour product is preferably greater than or equal to 1x10 8 CFU / g, more preferably 1x10 8 CFU / g. The fermented flour product in the application preferably comprises one or more of bread, steamed buns, steamed cakes, steamed buns and sesame seed cakes. In a specific embodiment of the application, the viable cell count of the Saccharomyces cerevisiae XTC-y11 in the fermented dough during the preparation of the fermented steamed buns is preferably greater than or equal to 1x10 8 CFU / g, more preferably 1x10 8 CFU / g.
[0045] The ester substances in the application preferably comprise one or more of isoamyl acetate, ethyl acetate, isocyanate, phenethyl acetate and acetoacetate, more preferably isoamyl acetate, ethyl acetate, isocyanate, phenethyl acetate and acetoacetate. The isoamyl acetate, ethyl acetate, isocyanate, phenethyl acetate and acetoacetate in the application can increase the aroma of the fermented flour product.
[0046] The role of the Saccharomyces cerevisiae in the fermentation process of the fermented flour product not only enables the dough to expand and rise, but also can more effectively utilize the reducing sugar substances in the fermentation substrate than non-Saccharomyces cerevisiae, and itself produces some volatile compounds beneficial to the flavor of the steamed buns through various metabolic cycles, including glycolysis, tricarboxylic acid metabolism and pyruvate metabolism. The ester substances have a positive effect and influence on the flavor of the steamed buns. The ester substances widely exist in flowers and fruits in nature, and most of them present a pleasant fragrance. In the preparation of the steamed buns, the content and amount ratio of the ester substances have important significance for increasing the content of the ester substances in the fermented flour product, regulating the appropriate amount ratio of the flavor substances and improving the quality of the fermented flour product. Therefore, the application of the Saccharomyces cerevisiae XTC-y11 screened from the old flour to increase the content of the important ester substances in the fermentation broth and the flavor and sensory quality of the steamed buns has important research significance and application value. The application is based on the key problem of the traditional fermentation of the old flour steamed buns, and a Saccharomyces cerevisiae XTC-y11 with high yield of ester aroma substances is obtained through artificial screening, separation and purification. The Saccharomyces cerevisiae XTC-y11 is applied to the fermentation of the steamed buns to increase the content of the ester substances. The steamed buns prepared by the Saccharomyces cerevisiae XTC-y11 have a high sensory score, a fermentation aroma and a good taste.
[0047] In order to further illustrate the application, the technical solutions provided by the application are described in detail below in combination with the drawings and examples, but they should not be understood as limiting the protection scope of the application.
[0048] Screening, isolation, purification and identification of Saccharomyces cerevisiae XTC-y11 CGMCC No. 25927 in old dough
[0049] (1) Gradient dilution and coating culture of sample
[0050] 10 g of the sample of naturally fermented old dough collected from Xingtai City, Hebei Province was placed in 90 mL of sterile normal saline, mixed until the dough was dissolved, and then 1 mL of the sample solution was added to a test tube containing 9 mL of sterile normal saline and mixed to obtain a dilution solution with a concentration gradient of 10 -1 . The dilution solution with a concentration gradient of 10 -1 was sequentially gradient-diluted to obtain a dilution solution with a concentration gradient of 10 -2 , a dilution solution with a concentration gradient of 10 -3 , a dilution solution with a concentration gradient of 10 -4 , a dilution solution with a concentration gradient of 10 -5 , and a dilution solution with a concentration gradient of 10 -6 .
[0051] 100 μL of the dilution solution with a concentration gradient of 10 -4 , the dilution solution with a concentration gradient of 10 -5 , and the dilution solution with a concentration gradient of 10 -6 were taken with a pipette and added to yeast peptone glucose (YPD) agar medium for coating, and the coating was cultured at a temperature of 28°C for 2-3 days. The dilution solution with a concentration gradient of 10 -4 -10 -6 was set in two parallel groups.
[0052] The yeast peptone glucose (YPD) agar medium was composed of 10 g of yeast extract, 20 g of peptone, 20 g of glucose, and 20 g of agar powder per 1000 mL of distilled water.
[0053] (2) Isolation and purification
[0054] A single colony was picked according to the size, color, and morphology of the colony, and repeated streaking was performed for 3-5 times. The morphology and purification state of the strain were checked under a microscope to obtain a pure strain. It was determined by smell that one of the 12 strains of yeast bacteria screened in the pure strain had a strong aroma, which was named XTC-y11. The colony morphology of XTC-y11 was round, milk white, surface moist and smooth, easy to pick up, and the colony was slightly raised. Under a microscope, it was round or oval, and it was a budding reproduction. The colony morphology of XTC-y11 is shown in Figure 1 .
[0055] (3) Identification of strain XTC-y11
[0056] 1) Biomolecular identification
[0057] DNA extraction: The obtained strain XTC-y11 was inoculated into yeast extract powder peptone glucose medium and cultured at a temperature of 28°C for 24 h to obtain a bacterial solution. The DNA in the bacterial solution was extracted using a yeast genomic DNA extraction kit, and the extracted bacterial solution DNA was stored at a temperature of -20°C.
[0058] PCR amplification: The extracted XTC-y11 bacterial solution DNA was used as a template, and fungal 18s universal primers ITS1 and ITS4 were used for PCR amplification. The reaction system and PCR amplification conditions are shown in Table 1 and Table 2.
[0059] Table 1 PCR amplification reaction system
[0060]
[0061] Table 2 PCR amplification conditions
[0062]
[0063] The PCR amplification product of the XTC-y11 bacterial solution DNA was detected by agarose gel electrophoresis, and the detection results are shown in Figure 3 . According to Figure 3 , it was determined that the PCR amplification product of the XTC-y11 bacterial solution DNA had a molecular weight band of interest at 500-1000 bp, and the band was clear without obvious tailing phenomenon, and could be sequenced.
[0064] 2) ITS sequence identification
[0065] The obtained PCR amplification product of the XTC-y11 bacterial solution DNA was entrusted to Huada Gene Technology Co., Ltd. for sequencing, and the 18S rDNA gene sequence of the XTC-y11 strain was shown in SEQ ID NO. 1. The sequencing results were compared and analyzed with the National Center for Biotechnology Information database, and the similarity with Saccharomyces cerevisiae was 99.87%, as shown in Figure 4 ; identified as Saccharomyces cerevisiae, and the strain was named Saccharomyces cerevisiae XTC-y11.
[0066] Comparative Example 1
[0067] Saccharomyces cerevisiae 31616 was purchased from China Industrial Microbial Culture Collection Center, and the strain preservation number was CICC-31616. Saccharomyces cerevisiae CICC-31616 was inoculated into YPD liquid medium, and the culture was incubated at 28°C for 24 h to obtain a bacterial liquid. The colony morphology of the Saccharomyces cerevisiae CICC-31616 diluent liquid is shown in Figure 1. Figure 2 .
[0068] Example 2 Preparation of Saccharomyces cerevisiae XTC-y11 fermentation broth and determination of ester compounds thereof
[0069] (1) Preparation of Saccharomyces cerevisiae XTC-y11 fermentation broth
[0070] Saccharomyces cerevisiae XTC-y11 obtained in Example 1 was inoculated in YPD liquid medium, and the culture was incubated at 28°C for 24 h to obtain Saccharomyces cerevisiae XTC-y11 seed liquid. The Saccharomyces cerevisiae XTC-y11 seed liquid was inoculated in YPD liquid medium at a volume ratio of 2%, and the culture was incubated at 28°C for 24 h to obtain Saccharomyces cerevisiae XTC-y11 fermentation broth. The Saccharomyces cerevisiae XTC-y11 fermentation broth was centrifuged at a speed of 7000 r / min for 6 min to obtain bacterial slurry, which was washed twice with sterile PBS buffer, and then suspended with sterile PBS buffer to obtain a suspension. The OD of the suspension was adjusted to 1, and the suspension was inoculated in 50 mL wort medium at a volume ratio of 2%, and the culture was fermented at a speed of 150 r / min and a temperature of 28°C for 24 h. The wort medium after fermentation was centrifuged, and the supernatant was filtered to obtain the final Saccharomyces cerevisiae XTC-y11 fermentation broth, which was stored at a temperature of -20°C. 600
[0071] (2) Determination of total ester content of Saccharomyces cerevisiae XTC-y11 fermentation broth
[0072] The determination of the total ester content of the Saccharomyces cerevisiae XTC-y11 fermentation broth obtained in step (1) was performed by titration, and the steps were as follows.
[0073] 1) Saccharomyces cerevisiae XTC-y11 fermentation broth dilution: an appropriate amount of fermentation broth was taken in a 50 mL conical flask, diluted 10 times with deionized water, and an appropriate amount of phenolphthalein solution was added.
[0074] 2) Neutralization: the Saccharomyces cerevisiae XTC-y11 fermentation broth after dilution was titrated with 0.1 mol / L NaOH to a light red color.
[0075] 3) Saponification: 25 mL of 0.1 mol / L NaOH solution was added to the Saccharomyces cerevisiae XTC-y11 fermentation broth in step 2), and the mixture was saponified and refluxed in a boiling water bath for 30 min, and then rapidly cooled with flowing water.
[0076] 4) Back titration: immediately after cooling, titrate to the point where the red color just disappears with 0.1 mol / L HCl solution.
[0077] The total ester content (g / 100 mL) in the fermentation broth of Saccharomyces cerevisiae XTC-y11 was calculated using formula (1).
[0078] X = (12N1-V2N2)*88.12*dilution factor / 2*100 (1)
[0079] In formula (1), X represents the total ester content, and the unit is g / 100 mL;
[0080] N1: 0.1 mol / L NaOH standard solution;
[0081] N2: 0.1 mol / L HCl standard solution;
[0082] V2: Volume of HCl standard solution consumed during back titration (mL).
[0083] (3) Determination and analysis of ester aroma substances in the fermentation broth of Saccharomyces cerevisiae XTC-y11
[0084] The fermentation broth of Saccharomyces cerevisiae XTC-y11 obtained in step (1) was determined for ester aroma substances using solid-phase microextraction and GC-MS analysis method, and the specific condition parameters are as follows:
[0085] 1) Solid-phase microextraction conditions: solid-phase microextraction was completed using a manual SPME sampler (brand: Supleco, USA) and a 100 μm PDMS solid-phase microextraction fiber head (brand: Supleco). 5 mL of the fermentation broth of Saccharomyces cerevisiae XTC-y11 obtained in step (1) was taken into a sample bottle, 1 g of NaCl was added, 1 μL of internal standard heptanoic acid methyl ester (0.1 μL / mL) was quickly added before analysis, and the bottle was sealed. The aged 100 μm PDMS solid-phase microextraction fiber extraction head was inserted into the headspace of the sample bottle, and then the sample bottle was placed on a 45°C extraction for 30 min to obtain the extraction liquid for standby.
[0086] 2) GC-MS Parameters and Conditions: The extract from step 1) was analyzed by GC-MS. The GC-MS parameters were as follows: programmed temperature rise (45℃ for 4 min, then increased to 180℃ at a rate of 5℃ / min, then increased to 250℃ at a rate of 25℃ / min and held for 5.5 min), with the injection port at 250℃, the detector at 280℃, and high-purity nitrogen as the carrier gas. Ionization was performed using EI, with an ionization voltage of 70 eV, a constant voltage of 10 psi, a quadrupole temperature of 150℃, an ion source temperature of 230℃, a filament current of 0.25 mA, an electron multiplier voltage of 1500 V, and a scan range of 33-350 AMU.
[0087] Comparative Example 2
[0088] (1) Preparation of fermentation broth of Saccharomyces cerevisiae CICC-31616
[0089] The only difference from Example 2 is that the brewing yeast XTC-y11 is replaced with brewing yeast CICC-31616.
[0090] (2) The method for determining the total ester content of the fermentation broth of Saccharomyces cerevisiae CICC-31616 is the same as in Example 2.
[0091] (3) The determination and analysis of ester aroma substances in the fermentation broth of Saccharomyces cerevisiae CICC-31616 were the same as in Example 2.
[0092] The results of the determination of total ester content in the fermentation broth of Saccharomyces cerevisiae XTC-y11 in Example 2 and the fermentation broth of Saccharomyces cerevisiae CICC-31616 in Comparative Example 2 are as follows: Figure 5 As shown, in Example 2, the total ester content in the fermentation broth of Saccharomyces cerevisiae XTC-y11 fermented for 24 hours reached 0.97 g / 100 mL, while in Comparative Example 2, the total ester content in the fermentation broth of Saccharomyces cerevisiae CICC-31616 fermented for 24 hours reached 0.725 g / 100 mL, indicating that Saccharomyces cerevisiae XTC-y11 has better ester production performance.
[0093] In Example 2, the isoamyl acetate content in the fermentation broth of *Saccharomyces cerevisiae* XTC-y11 was 14.4637 μg / L, while in Comparative Example 2, the isoamyl acetate content in the fermentation broth of *Saccharomyces cerevisiae* CICC-31616 used for production was 13.3866 μg / L. The GC-MS peak chromatograms are shown below. Figure 6 As shown in Table 3, the results are as follows. Figure 6 The peak time of 6.43 in the upper part of the graph is for isoamyl acetate from Example 2. Figure 6 The lower half of the graph shows that the peak time of 6.44 represents isoamyl acetate in Comparative Example 2. The isoamyl acetate content in the fermentation broth of Saccharomyces cerevisiae XTC-y11 is 1.08 times that in the fermentation broth of Saccharomyces cerevisiae CICC-31616 used in production isoamyl acetate.
[0094] Table 3: Types and contents of ester substances in Saccharomyces cerevisiae XTC-y11 fermentation liquor (unit: μg / L)
[0095]
[0096] OAV (Odor Active Value) is a value representing the contribution of volatile aroma components in food to the overall aroma system of the food. The greater the value, the greater the contribution to the aroma of the food. The calculation method is: the ratio of the concentration of the aroma substance to the threshold value of the substance. The OAV value of isoamyl acetate in Saccharomyces cerevisiae XTC-y11 fermentation liquor is 7.23, and the OAV value of isoamyl acetate in Saccharomyces cerevisiae CICC-31616 fermentation liquor is 6.93.
[0097] Example 3: Fermentation of steamed buns by Saccharomyces cerevisiae XTC-y11
[0098] (1) Preparation of steamed buns
[0099] Preparation of yeast suspension: the slant-preserved Saccharomyces cerevisiae XTC-y11 was inoculated into YPD liquid medium and activated at a temperature of 28℃ for 24h to obtain Saccharomyces cerevisiae XTC-y11 seed liquor. The Saccharomyces cerevisiae XTC-y11 seed liquor was inoculated into YPD liquid medium and fermented at a temperature of 28℃ for 24h to obtain Saccharomyces cerevisiae XTC-y11 liquor. The Saccharomyces cerevisiae XTC-y11 liquor was centrifuged at 7000r / min to discard the supernatant, washed with sterile 0.85% NaCl solution for 2-3 times, and then suspended with sterile 0.85% NaCl solution to obtain XTC-y11 yeast suspension.
[0100] 1) Primary fermentation:
[0101] 100g of flour was weighed and 50mL of the above XTC-y11 yeast suspension was added. The viable cell count of the yeast XTC-y11 in the dough before fermentation was adjusted to 10 8 CFU / g, and kneaded into a ball and fermented at a temperature of 35℃ for 2h.
[0102] 2) Secondary fermentation:
[0103] After kneading and releasing the gas of the dough after the primary fermentation, the dough was divided into 60g portions and continued to ferment at a temperature of 35℃ for 20min.
[0104] 3) Steaming of steamed buns:
[0105] The dough after the secondary fermentation was placed in a steamer and steamed with cold water. The heating was stopped after the water boiled for 20min, and the steamed buns were obtained after cooling to room temperature.
[0106] Comparative Example 3
[0107] The only difference between Comparative Example 3 and Example 3 is that Saccharomyces cerevisiae XTC-y11 is replaced by Saccharomyces cerevisiae CICC-31616.
[0108] The fermented steamed buns prepared from Saccharomyces cerevisiae XTC-y11 (CGMCC No. 25927) of Example 3 and the fermented steamed buns prepared from Saccharomyces cerevisiae CICC-31616 of Comparative Example 3 are subjected to sensory evaluation, and the specific parameters of the sensory evaluation are as follows:
[0109] Personnel selection: 10 healthy experimental personnel aged 20-30 years old (after one week of pre-experimental sensory training) are selected, and the sensory evaluation standard is shown in Table 4.
[0110] Table 4 Sensory evaluation standard
[0111]
[0112]
[0113] The sensory radar chart of the fermented steamed buns of Example 3 and Comparative Example 3 is shown in Figure 7 and Table 5.
[0114] Table 5 Sensory evaluation results (points) of the fermented steamed buns of Example 3 and Comparative Example 3
[0115] Chewiness Color Shape Taste Odor Springiness Texture Sensory Total Score Example 3 11.9 7.3 10.6 11.1 12 11.3 11.4 75.6 Comparative Example 3 9.6 7.8 9.9 11.5 11.1 11.4 11.1 72.4
[0116] According to Figure 7 and Table 4, the Saccharomyces cerevisiae XTC-y11 of the present application has a higher total sensory score of 75.6 points, while the total score of the Saccharomyces cerevisiae CICC-31616 for production is 72.4 points; and the steamed buns fermented by Saccharomyces cerevisiae XTC-y11 have higher scores in taste, appearance, leavening property and smell, with a smell score of 12 points, while the Saccharomyces cerevisiae CICC-31616 for production has a smell score of 11.1 points.
[0117] In conclusion, the present application provides a Saccharomyces cerevisiae XTC-y11, the total ester content and the isoamyl acetate content in the fermentation liquor of the Saccharomyces cerevisiae XTC-y11 are high, which indicates that the Saccharomyces cerevisiae XTC-y11 can produce more aroma substances during fermentation, the steamed buns prepared by using the Saccharomyces cerevisiae XTC-y11 have high total sensory score, the Saccharomyces cerevisiae XTC-y11 of the present application has excellent ability to produce isoamyl acetate, and when it is applied to the fermentation of steamed buns, it can increase the aroma of the steamed buns by producing more isoamyl acetate, and the steamed buns have good taste. It can be seen that the Saccharomyces cerevisiae XTC-y11 of the present application has good application prospect in the promotion of growth.
[0118] Although the above embodiment has made a detailed description of the present application, it is only a part of the embodiments of the present application, but not all the embodiments, and other embodiments can be obtained according to the present embodiment without creativity, which all belong to the protection scope of the present application.
Claims
1. The application of Saccharomyces cerevisiae XTC-y11 or an inoculum containing said Saccharomyces cerevisiae XTC-y11 in the preparation of fermented dough products and / or in increasing the ester content in fermented dough products; characterized in that, The application includes the following steps: Saccharomyces cerevisiae XTC-y11 was inoculated into a fermentation medium and fermented to obtain a fermentation broth containing esters. The fermentation medium includes malt extract medium; The preservation number of the brewing yeast XTC-y11 is CGMCC No. 25927; The esters include isoamyl acetate, ethyl acetate, isocyanate, phenethyl acetate, and acetoacetate.
2. The application according to claim 1, characterized in that, The working viable count of the brewer's yeast XTC-y11 is greater than or equal to 10. 8 CFU / g.
3. The application according to claim 1, characterized in that, The fermented dough products include one or more of the following: bread, steamed buns, steamed cakes, mantou (steamed bread), and sesame seed cakes.
Citation Information
Patent Citations
Saccharomyces cerevisiae strain and application thereof
CN106399137A
Saccharomyces cerevisiae and microbial agent as well as application thereof to preparation of fermented product and particularly brewing of wine in Huazhuo basin
CN111961603A