A sulfonylurea herbicide hydrolytic enzyme tsmE mutant, its coding gene and use

Abstract

The application discloses a sulfonylurea herbicide hydrolytic enzyme TsmE mutant, a coding gene thereof and application. The sulfonylurea herbicide hydrolytic enzyme TsmE mutant has an amino acid sequence shown in SEQ ID NO. 4. The application also discloses a gene coding the mutant. The application further discloses application of the mutant in degrading sulfonylurea herbicides. The application takes wild-type TsmE as a starting template, and obtains a mutant M7 (S179A) with significantly improved enzyme activity through a directional evolution technology. Compared with the wild type, the specific enzyme activity of the mutant M7 to metsulfuron methyl, mesosulfuron methyl, tribenuron, bensulfuron methyl, sulfometuron methyl and chlorimuron ethyl is respectively increased by 1.7, 1.6, 2.5, 1.3, 1.4 and 1.2 times. The mutant and the coding gene thereof can be used for constructing a sulfonylurea herbicide-resistant transgenic crop, and can also be used for removing sulfonylurea herbicides in soil and water, and has very important theoretical and application values.

Description

Technical Field

[0001] This invention belongs to the field of protein engineering technology of enzymes, and relates to a TsmE mutant of sulfonylurea herbicide hydrolase, its encoding gene and uses. Background Technology

[0002] In recent years, with the gradual restriction and phasing out of highly toxic and long-residual herbicides, the herbicide market has gradually entered an era of low-toxicity and high-efficiency products. Sulfonylurea herbicides, with their advantages of high efficiency, broad spectrum, and low toxicity, have developed rapidly and have become the third largest herbicide category after organophosphates and acetamides. According to the Food and Agriculture Organization of the United Nations (FAO), the usage of sulfonylurea herbicides was only 129 tons in 1992, but by 2011 it had increased 17 times. In Europe and North America, its usage even increased more than 100 times. In my country, the annual application area of ​​sulfonylurea herbicides has exceeded 2 million hectares and is still expanding. Currently, the global annual sales of sulfonylurea herbicides exceed US$2 billion, accounting for approximately 10% of all herbicide sales.

[0003] Although sulfonylurea herbicides are of low toxicity to mammals, some sulfonylurea herbicides, such as metsulfuron-methyl, pyrimisulfuron-methyl, chlorimuron-methyl, and azoxystrobin, are chemically stable and have a long residual period in the soil, especially in alkaline soils where the residual period can be as long as 2-3 years, causing serious phytotoxicity to subsequent crops. Conversely, some sulfonylurea herbicides with short residual periods, such as bensulfuron-methyl, thifensulfuron-methyl, and bensulfuron-methyl, can be used as target herbicides in the construction of herbicide-resistant transgenic crops. Therefore, obtaining excellent sulfonylurea herbicide-degrading detoxifying enzymes and genetic resources has significant application value for the bioremediation of sulfonylurea herbicide residue pollution and for herbicide-resistant transgenic engineering.

[0004] TsmE, an esterase identified from the bacterium Hansschlegeliazhihuaiae S113, is capable of catalyzing the deesterification and detoxification of various sulfonylurea herbicides, including thifensulfuron, metsulfuron-methyl, pyrimisulfuron, bensulfuron-methyl, acesulfame K, and chlorpyrifos. However, while TsmE exhibits extremely high deesterification efficiency against thifensulfuron, its efficiency against other sulfonylurea herbicides is relatively low. Against this backdrop, this invention utilizes directed evolution technology to enhance the catalytic activity of this enzyme, enabling it to more efficiently catalyze the deesterification and detoxification of sulfonylurea herbicides and thus improving its practical application value. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a sulfonylurea herbicide hydrolase TsmE mutant with higher activity, its encoding gene, and its uses.

[0006] The objective of this invention can be achieved through the following technical solutions:

[0007] A sulfonylurea herbicide hydrolase TsmE mutant, the amino acid sequence of which is shown in SEQ ID NO.4.

[0008] The gene encoding the mutant described in this invention.

[0009] As a preferred embodiment of the present invention, the gene nucleotide sequence is shown in SEQ ID NO.3.

[0010] A recombinant expression vector containing the mutant gene of the sulfonylurea herbicide hydrolase described in this invention.

[0011] As a preferred embodiment of the present invention, the recombinant expression vector is obtained by inserting the sulfonylurea herbicide hydrolase mutant gene of the present invention between the NdeI and HindIII sites of pET-29a(+).

[0012] Genetically engineered bacteria containing the TsmE mutant gene of sulfonylurea herbicide hydrolase described in this invention.

[0013] The application of the mutant described in this invention in the degradation of sulfonylurea herbicides.

[0014] The application of the mutant described in this invention in removing sulfonylurea herbicide residues from soil and water.

[0015] The application of the gene described in this invention in degrading sulfonylurea herbicides and constructing sulfonylurea-resistant transgenic crops.

[0016] The application of the recombinant expression vector or the genetically engineered bacteria described in this invention in the degradation of sulfonylurea herbicides; wherein the sulfonylurea herbicides are bensulfuron-methyl, mefensulfuron-methyl, thifensulfuron-methyl, bensulfuron-methyl, mefensulfuron-methyl, or chlorpyrifos.

[0017] The beneficial effects of this invention are as follows:

[0018] This invention uses the wild-type sulfonylurea herbicide hydrolase TsmE as a starting template and, through directed evolution, obtained a mutant M7 (S179A) with significantly enhanced enzyme activity. Compared with the wild type, mutant M7 showed increased specific enzyme activities against mesosulfuron, methimazole, bensulfuron, bensulfuron-methyl, azoxystrobin, and chlorpyrifos by 1.7, 1.6, 2.5, 1.3, 1.4, and 1.2 times, respectively. The mutant and its encoding gene can be used to construct sulfonylurea-resistant transgenic crops and for the removal of sulfonylurea herbicides from soil and water, possessing significant theoretical and practical value. Attached image description:

[0019] Figure 1 Diagram showing the construction of the M7 mutant recombinant expression vector.

[0020] Figure 2 SDS-PAGE profile of the sulfonylurea herbicide hydrolase TsmE mutant. Lane 1 is the protein marker, and the remaining lanes are wild-type TsmE and mutant M7, respectively. Detailed Implementation

[0021] Example 1. Directed evolution screening of TsmE mutants with significantly increased enzyme activity

[0022] 1.1 Synthesis of wild-type tsmE gene

[0023] The nucleotide sequence (1197 bp) of the wild-type tsmE gene was synthesized, as shown in SEQ ID NO.1 of the sequence listing, which encodes the TsmE protein (398 amino acids), as shown in SEQ ID NO.2 of the sequence listing. The synthesized tsmE was cloned into the pUC57 vector, and the recombinant vector was named pUC-tsmE, which was then transformed into Escherichia coli DH5α.

[0024] 1.2 Construction of tsmE gene mutation library

[0025] Using plasmid pUC-tsmE as a template, error-prone PCR was performed with primers 1 and 2, resulting in mutations in the tsmE gene due to random base mismatches. The error-prone PCR product was cloned into the pMD19-T vector, and the enzyme-ligated product was heat-transformed into mesosulfonamide-sensitive E. coli DH10B(ilvG) + The random mutant library was plated on a substrate containing 100 mg / L of [agent / material]. -1 Amp, 200mg / L -1 IPTG and 200mg / L -1 Incubate overnight at 37°C in LB plates of X-Gal.

[0026] The primers and error-prone PCR reaction system are as follows:

[0027] Primer 1: ATGGAAACCGATAAAAAAACCG, as shown in SEQ ID NO.5 in the sequence listing;

[0028] Primer 2: TCAGCTTTCGTTCTGATCTAAG, as shown in SEQ ID NO.6 in the sequence listing;

[0029] The error-prone PCR amplification system is as follows:

[0030]

[0031] PCR amplification procedure:

[0032] a. Pre-denaturate at 95℃ for 3 minutes;

[0033] b. Denaturation at 94℃ for 0.5 min, annealing at 52℃ for 1.0 min, extension at 72℃ for 1.5 min, for 30 cycles;

[0034] c. Extend at 72℃ for 10 minutes, then cool to room temperature.

[0035] 1.3 Screening of tsmE gene mutation libraries

[0036] The transformation products from the above mutant library were inoculated into a basal salt medium containing 50 μM mesosulfuron-methyl (with 5 g / L added). -1 glucose, 200mg / L -1 Valine, 200 mg / L -1 Leucine and 100mgL -1 Ampicillin), cultured for 3 days. Given that *E. coli* DH10B (ilvG) + It is highly sensitive to high concentrations of mesulfuron-methyl; the resistance gene can convert mesulfuron-methyl into an acidic product that is non-toxic to bacteria, thereby relieving the resistance to Escherichia coli DH10B (ilvG). + The growth-inhibiting effect of sulfonylureas was used to perform high-throughput screening of the above mutant libraries. Colonies of recombinant strains that grew well on screening plates were selected. The resistance and deesterification ability of the selected strains to sulfonylurea herbicides were determined, and recombinant strains with significantly enhanced deesterification activity against sulfonylurea herbicides were screened. The tsmE sequence mutation status in the recombinant strains was analyzed.

[0037] The basic salt culture medium formula is as follows: 1.0g NH4Cl, 0.5g NaCl, 1.5g K2HPO4, 0.5g KH2PO4, 0.2g MgSO4·7H2O, and diluted to 1L with deionized water. For solid culture medium, add 2% agar powder.

[0038] 1.4 Acquiring mutated resistance genes

[0039] After several rounds of screening, two TsmE-mutated resistance genes were obtained and named M7 genes. The M7 nucleotide sequence at positions 535 and 536 was mutated from AG to GC, as shown in SEQ ID NO.3; resulting in a mutation at position 179 of its amino acid sequence from serine to alanine, as shown in SEQ ID NO.4.

[0040] Example 2: High-efficiency expression of the mutant M7 gene in BL21(pET-29a(+))

[0041] 2.1 Construction of bacterial expression vectors and acquisition of recombinant microorganisms

[0042] The nucleotide sequence (1212 bp) of the M7 gene with NdeI / HindIII restriction sites was synthesized, as shown in SEQ ID NO.7 of the sequence listing. The synthesized M7 gene was cloned into the pUC57 vector to obtain the recombinant vector pUC-M7. The recombinant vector pUC-M7 and the pET-29a(+) plasmid were digested with restriction endonucleases NdeI and HindIII, respectively, using the following digestion system:

[0043] 10×MBuffer 5μL

[0044] NdeI(10U·μL -1 2.0μL

[0045] HindⅢ(10U·μL -1 2.0μL

[0046] DNA (pUC-M7 or pET-29a(+) plasmid) 30 μL

[0047] ddH2O 11μL

[0048] The M7 gene fragment was digested at 37℃ for 12 hours. Then, the digested M7 gene fragment was ligated with the digested bacterial expression vector pET-29a(+) to construct the recombinant expression vector, which was named pET29a-M7. The recombinant expression vector was transformed into the expression host bacterium BL21(DE3) to obtain the recombinant microorganism BL21(M7).

[0049] 2.2 Expression and purification of TsmE mutant

[0050] BL21(M7) was inoculated into LB medium and cultured at 37°C with a shaker at 200 rpm until OD200. 600nm The concentration was between 0.4 and 0.6. IPTG was added to a concentration of 0.4 mM, and the mixture was induced and cultured at 16°C for 12 hours. 100 ml of bacterial culture was centrifuged to collect the bacterial cells. The cells were washed twice with PBS (50 mM, pH 7.4), resuspended in 10 ml of PBS buffer, and sonicated (AutoScience, UH-650 Ultrasonic Processor, 30% intensity) for 5-10 minutes. The mixture was then centrifuged at 12000 rpm for 30 minutes. The supernatant was collected, and the TsmE mutant was purified using a nickel affinity chromatography column. The purified enzyme was then subjected to protein electrophoresis. (See attached image). Figure 2 .

[0051] Example 3: Determination of enzyme activity in TsmE mutants

[0052] Enzyme activity reaction system (1 mL): Purified TsmE mutant enzyme and 100 μM sulfonylurea herbicide substrate were added to 50 mM PBS buffer (pH 7.4). Timing for each reaction began with the addition of the enzyme, and the reaction was terminated by rapidly adding an equal volume of acetonitrile after reacting at 30°C for 10 min. With no enzyme added as a control, the activity of the mutant was determined by detecting the reduction in the amount of each sulfonylurea substrate using high-performance liquid chromatography (HPLC). HPLC conditions were as follows: A 3000 Titanium System high-performance liquid chromatograph was used; a Thermo Scientific Syncronis C18 column (5 μm, 250 mm × 4.6 mm); the mobile phase was acetonitrile / water (60 / 40, v / v), with 0.5% acetic acid added to the water; the flow rate was 1 mL / min; the injection volume was 20 μL; the detection wavelengths were 230 nm and 255 nm; and the column temperature was 40 °C. One unit of enzyme activity was defined as the amount of enzyme required to catalyze the hydrolysis of 1.0 μmol of substrate in 1 min at pH 7.4 and 30 °C. The experimental results are shown in Table 1.

[0053] The above experimental results show that, compared with wild-type TsmE, the specific enzyme activities of mutant M7 against mesosulfuron, methimazole, bensulfuron, bensulfuron, ammonium bensulfuron, and chlorsulfuron increased by 1.7, 1.6, 2.5, 1.3, 1.4, and 1.2 times, respectively.

[0054] Table 1. Enzyme activity of TsmE mutant M7 against various sulfonylurea herbicides.

[0055]

[0056] The microorganisms used in the above examples were sourced from the following sources: Escherichia coli DH5α was purchased from Takara Bio Engineering (Dalian) Co., Ltd., the Escherichia coli high expression vector pET-29a(+) was purchased from Novogen, and the expression host bacterium Escherichia coli BL21(DE3) was purchased from Shanghai Yingjun Biotechnology Co., Ltd.

Claims

1. A sulfonylurea herbicide hydrolase TsmE mutant, characterized in that, The amino acid sequence of the mutant is shown in SEQ ID NO.

4.

2. The gene encoding the mutant of claim 1.

3. The gene according to claim 2, characterized in that, The nucleotide sequence of the gene is shown in SEQ ID NO.

3.

4. A recombinant expression vector containing the gene described in claim 2 or 3.

5. The recombinant expression vector according to claim 4, characterized in that, The recombinant expression vector is formed by inserting the gene described in claim 2 or 3 into pET-29a(+). Nde I and Hind Obtained between three sites.

6. Genetically engineered bacteria containing the gene described in claim 2 or 3.

7. The application of the mutant according to claim 1 in the degradation of sulfonylurea herbicides, characterized in that, The sulfonylurea herbicides are bensulfuron-methyl, mefensulfuron-methyl, bensulfuron-methyl, mefensulfuron-methyl, acesulfame potassium, or chlorpyrifos.

8. The application of the mutant according to claim 1 in removing sulfonylurea herbicide residues from soil and water, characterized in that, The sulfonylurea herbicides are bensulfuron-methyl, mefensulfuron-methyl, bensulfuron-methyl, mefensulfuron-methyl, acesulfame potassium, or chlorpyrifos.

9. The application of the gene according to claim 2 or 3 in degrading sulfonylurea herbicides and constructing sulfonylurea-resistant transgenic crops, characterized in that, The sulfonylurea herbicides are bensulfuron-methyl, mefensulfuron-methyl, bensulfuron-methyl, mefensulfuron-methyl, acesulfame potassium, or chlorpyrifos.

10. The application of the recombinant expression vector of claim 4 or the genetically engineered bacteria of claim 6 in the degradation of sulfonylurea herbicides, characterized in that, The sulfonylurea herbicides are bensulfuron-methyl, mefensulfuron-methyl, bensulfuron-methyl, mefensulfuron-methyl, acesulfame potassium, or chlorpyrifos.

Images