DPEase gene, gene expression module and preparation method of D-psicose

Abstract

The present invention relates to the field of bioengineering, and in particular to a DPEase gene, a gene expression module and a method for preparing D-psicose. The present invention provides a DPEase gene, wherein the source of the DPEase gene includes one or more of Agrobacterium sp., C. cellulolyticum, F. plautii, Clostridium sp., Sin orhizobium sp. or Dorea sp. The present invention aims to construct a cerevisiae strain with high DPEase expression activity, which can efficiently convert D-fructose into D-psicose.

Description

Technical Field

[0001] The present invention relates to the field of bioengineering, and in particular to a preparation method of a DPEase gene, a gene expression module and D-psicose. Background Art

[0002] Rare sugars are a type of monosaccharides and their derivatives that exist naturally in nature but are present in very small quantities. They taste similar to sucrose, but have the advantages of low calories, high stability, harmonious sweetness, non-hygroscopicity, non-cariogenicity, and high tolerance. They can make up for the shortcomings of traditional sweeteners and play an important role in improving the diet of special groups. They have received widespread attention in recent years. At present, more than 50 kinds of rare sugars have been reported, among which D-psicose (the C-3 diastereomer of fructose) is a typical representative. In addition to its low calorie characteristics, it also plays an important physiological role in inhibiting blood sugar increase and body fat accumulation, scavenging free radicals, protecting nerves, modifying drugs or active substances to optimize their functional activities, etc. It is a new sweetener for people with diabetes and obesity, and has been used in various fields such as food, health care, and medicine.

[0003] However, due to the low yield of D-psicose in nature and the difficulty in purification, the production of D-psicose is currently mainly achieved through chemical synthesis and biocatalysis. Chemical synthesis methods include the use of molybdate ions to catalyze the conversion of D-fructose, the use of 1,2,4,5-di-O-isopropyl-β-D-pyranose, or the synthesis by heating ethanol and triethylamine. However, the above chemical synthesis methods have many disadvantages such as complex purification process, low conversion rate, chemical waste pollution, and the generation of by-products. In addition, the cost of chemical synthesis is relatively expensive, which is not conducive to the large-scale production of D-psicose. Therefore, the use of biotransformation technology to synthesize functional D-psicose has become an international research hotspot.

[0004] D-psicose 3-epimerase (DPEase, EC5.1.3.30) is a typical ketohexose-3-epimerase. It was first discovered by Professor Kim of South Korea in Agrobacterium tumefacien in 2005. Subsequently, more and more DPEases from different microbial sources were gradually discovered and cloned and expressed in heterologous hosts. Because of its higher affinity with the substrate D-psicose, it can catalyze D-fructose to produce D-psicose, so it has become the most commonly used enzyme for the bioconversion method to synthesize D-psicose. At present, the research on DPEase enzyme is mainly focused on the discovery, construction and expression, and the exploration of its enzymatic properties and crystal structure, and most of the research is on the recombinant Escherichia coli expression system. Since the DPEase enzyme cloned and expressed using Escherichia coli as the host always has safety issues in industrial applications; when Bacillus subtilis is used as the host to produce allulose, the residual fructose cannot be converted, resulting in difficulty in the subsequent separation of D-psicose; Saccharomyces cerevisiae can convert the residual fructose into ethanol and biomass, but due to host differences, the DPEase activity expressed by recombinant Saccharomyces cerevisiae is low.

[0005] In order to promote the application of DPEase in the food industry and further expand the large-scale production of D-psicose, it is necessary to establish and optimize a safer and more efficient food-grade strain expression system to meet the needs of industrial production. Summary of the invention

[0006] In view of this, the present invention provides a DPEase gene, a gene expression module and a method for preparing D-psicose. The present invention aims to construct a cerevisiae yeast with high DPEase expression activity, which can efficiently convert D-fructose into D-psicose.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The invention provides a DPEase gene, wherein the source of the DPEase gene comprises one or more of Agrobacterium sp., C. cellulolyticum, F. plautii, Clostridium sp., Sinorhizobium sp. or Dorea sp.

[0009] In some embodiments of the present invention, in the above-mentioned DPEase gene, the gene is derived from Doreasp.

[0010] In some embodiments of the present invention, the above-mentioned DPEase gene has:

[0011] (1), the nucleotide sequence shown in SEQ ID NO: 1; or

[0012] (2) a nucleotide sequence obtained by replacing, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in (1), and having the same or similar functions as the nucleotide sequence shown in (1); or

[0013] (3) A nucleotide sequence having at least 90% sequence homology with the nucleotide sequence described in (1) or (2).

[0014] In some embodiments of the present invention, the sequence of SEQ ID NO:1 is as follows: ATGAAGC ATGGTATTTACTACGCTTATTGGGAAAAAGAATGGGCTGCTGATTATTTGTATTATGTTGAAAAGGTCGCTAGATTAGGTTTTGATTTGTTAGAAATCGGTGCTGCTCCATTACCAGAATATTCTACTGATCAAATTAAGGCTTTGAGAGATTGTGCTTCTCAAAATGGTATTCAATTAACTGCTGGTTATGGTCCAACATATGATCATAATATGGGTTCTTCTGATGCTGGTATTAGAGCTGGTGCTTTGGAATGGTATAAAAGATTGTTTGATGTCATGGAACAGTTGGATATTCATTTAATTGGTGGTGCTTTATACGGTTATTGGCCAGTTGATTTTTCTAATATTAACAAGGAGGAGGATTGGAAAAGATCTGTTGAAGGTATGCATTTGTTGGCTCCAATTGCTAAAGAACATGATATTAATCTGGGTATGGAAGTTTTAAACAGATTTGAATCTCACATCTTGAACACAGCTGAAGAAGGTGTTGCTTTTGTTAAAGAAGTTGGTCAAGAAAATGTCAAAGTTATGTTAGATACCTTCCATATGAACATTGAAGAAGAATCTATCGGTGATGCTATTAGAACAGCTGGTAATTTGTTAGGTCATTTTCATACAGGTGAATGTAATAGAATGGTTCCAGGTAAAGGTAGAACACCATGGAGAGAAATTGGTAATGCTTTGAGAGACATTGAATATGATGGTACTGTTGTTATGGAACCATTTGTTTCTATGGGTGGTCAAGTTGGTAGAGATATTCATATTTGGAGAGATATTTCCAGAGGTGCTTCTGAAGCTGAATTGGATAAAGATGCTAAAAATGCTGTTGCTTTTCAAAAATACATGTTGGATTGGAAATAA。

[0015] The present invention also provides a DPEase expression module, comprising the above-mentioned DPEase gene.

[0016] The present invention also provides the use of the DPEase gene or the DPEase expression module in constructing a gene expression module.

[0017] The present invention also provides a gene expression module, comprising the above-mentioned DPEase expression module and molecular chaperone expression module.

[0018] In some embodiments of the present invention, in the above-mentioned gene expression module, the DPEase expression module carries a homology arm of the Can gene site and a histidine-deficient screening tag;

[0019] The molecular chaperone expression module carries the homology arm of the HO gene site and a leucine-deficient screening tag.

[0020] In some embodiments of the present invention, in the above gene expression module, the molecular chaperone expression module includes: Groel and Groes.

[0021] In some embodiments of the present invention, in the above gene expression module, the molecular chaperone expression module has:

[0022] (4) the nucleotide sequences shown in SEQ ID NO: 2 and SEQ ID NO: 3; or

[0023] (5) a nucleotide sequence obtained by replacing, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in (4), and having the same or similar function as the nucleotide sequence shown in (4); or

[0024] (6) A nucleotide sequence having at least 90% sequence homology with the nucleotide sequence described in (4) or (5).

[0025]

[0026] In some embodiments of the invention, the sequence of the above SEQ ID NO:3 is: ATGAACA TCAGACCATTGCACGACAGAGTTATTGTCAAGAGAAAGGAAGTCGAAACCAAGTCTGCTGGTGGTATCGTCTTGACTGGTTCAGCCGCTGCTAAGTCCACTAGAGGCGAAGTCCTAGCCGTCGGTAACGGTCGTATCTTGGAAA ATGGTGAAGTTAAGCCATTAGATGTCAAGGTTGGTGACATTGTTATCTTCAACGATGGTTACGGTGTTAAATCCGAAAAGATTGACAACGAAGAAGTTTTGATCATGTCTGAATCTGATATTTTGGCTATTGTTGAAGCTTGA.

[0027] In some embodiments of the present invention, the above-mentioned gene expression module further comprises: a promoter and a terminator;

[0028] The promoter includes: GPD , P TEF , P GAL or P TDH One or more of;

[0029] The terminator includes one or more of GPDT, CYC1T or TEFT1.

[0030] The present invention also provides an expression vector, comprising the above gene expression module.

[0031] The present invention also provides a host for transforming and / or transfecting the above expression vector.

[0032] In some embodiments of the present invention, the host comprises: Saccharomyces cerevisiae.

[0033] In some embodiments of the present invention, the above host is Saccharomyces cerevisiae BY4741.

[0034] The present invention also provides a method for preparing D-psicose, comprising the following steps: using D-fructose and cobalt chloride as raw materials, and obtaining the D-psicose through catalysis by the above-mentioned host.

[0035] In some embodiments of the present invention, in the above preparation method, the concentration of D-fructose is 100-800 g / L.

[0036] In some embodiments of the present invention, in the above preparation method, the concentration of D-fructose is 100 g / L.

[0037] In some embodiments of the present invention, in the above preparation method, the OD value of the host is 10-30.

[0038] In some embodiments of the present invention, in the above preparation method, the OD value of the host is 30.

[0039] In some embodiments of the present invention, in the above preparation method, the concentration of cobalt chloride used is 0.3-1 mM.

[0040] In some embodiments of the present invention, in the above preparation method, the concentration of cobalt chloride used is 1 mM.

[0041] The present invention provides use of the DPEase gene, the DPEase expression module, the gene expression module, the expression vector, and the host in directly or indirectly preparing D-psicose and / or products containing D-psicose.

[0042] In some embodiments of the present invention, in the above applications, the product includes: one or more of food, health care products or medicines.

[0043] The invention provides a DPEase gene, wherein the source of the DPEase gene comprises one or more of Agrobacterium sp., C. cellulolyticum, F. plautii, Clostridium sp., Sinorhizobium sp. or Dorea sp.

[0044] The beneficial effects of the present invention include:

[0045] (1) The present invention aims to construct a Saccharomyces cerevisiae strain with high DPEase expression activity, which can efficiently convert D-fructose into D-psicose.

[0046] (2) The conversion rate of D-fructose to D-psicose catalyzed by Saccharomyces cerevisiae reported in the literature is only 26.6%, while the conversion rate of the recombinant Saccharomyces cerevisiae used in the present invention can reach 34.78%. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art are briefly introduced below.

[0048] Figure 1 The diagrams of isomerase and molecular chaperone plasmid construction are shown; wherein: a shows the plasmids expressing DPE isomerase genes from different sources; b shows the plasmids expressing molecular chaperone (Grol / s);

[0049] Figure 2 The diagram shows the construction of isomerase and molecular chaperone genome integration plasmids; wherein: a shows the chromosome integration plasmid map of the isomerase gene expression module and; b shows the chromosome integration plasmid map of the molecular chaperone (Grol / s) expression module;

[0050] Figure 3 The HPLC peak diagram of the reaction sample and the standard is shown; wherein: from top to bottom are the reaction sample, D-psicose standard, and D-fructose standard. DETAILED DESCRIPTION

[0051] The invention discloses a DPEase gene, a gene expression module and a preparation method of D-psicose.

[0052] It should be understood that the expression "one or more of..." includes each of the items recited after the expression individually and in various different combinations of two or more of the recited items, unless otherwise understood from the context and usage. The expression "and / or" in combination with three or more recited items should be understood to have the same meaning, unless otherwise understood from the context.

[0053] The use of the terms "comprising", "having" or "containing", including their grammatical synonyms, should generally be understood as open and non-restrictive, for example not excluding other unrecited elements or steps, unless otherwise specifically stated or otherwise understood from the context.

[0054] It should be understood that the order of steps or the order in which certain actions are performed is not important as long as the present invention remains operable. In addition, two or more steps or actions may be performed simultaneously.

[0055] The use of any and all examples or exemplary language, such as "for example" or "including", herein is intended only to better illustrate the invention and does not limit the scope of the invention unless otherwise claimed. No language in this specification should be construed as indicating that any non-claimed element is essential to the practice of the invention.

[0056] In addition, the numerical ranges and parameters used to define the present invention are approximate values, and the relevant values ​​in the specific embodiments have been presented as accurately as possible. However, any numerical value inherently inevitably contains standard deviations due to individual test methods. Therefore, unless otherwise expressly stated, it should be understood that all ranges, quantities, values ​​and percentages used in this disclosure are modified by "about". Here, "about" generally means that the actual value is within plus or minus 10%, 5%, 1% or 0.5% of a specific value or range.

[0057] In Examples 1 to 4 of the present invention, all the raw materials and reagents used can be purchased from the market.

[0058] In Examples 1 to 4 of the present invention, the yeast containing the synthetic chromosome 5 is a laboratory constructed strain, which is a synthetic chromosome 5 yeast. Construction method reference: Xie Ze-Xiong, Li Bing-Zhi, … Yuan Ying-Jin*. "Perfect" designer chromosome V and behavior of a ringderivative. Science, 2017, 355(6329): eaaf4704.

[0059] The present invention will be further described below in conjunction with embodiments:

[0060] Example 1 Construction of isomerase expression plasmids and chaperone expression plasmids from different sources

[0061] In this example, DPEase from six different sources reported in the literature, including Agrobacterium sp. (Genbank accession number: EGL65884.1), C. cellulolyticum (Genbank accession number: ACL75304), F. plautii (Genbank accession number: EHM40452.1), Clostridium sp (Genbank accession number: WP_014314767.1), Sinorhizobium sp. Genbank accession number: WP_069063284.1), and Dorea sp. (Genbank accession number: CDD07088.1), and Grol Genbank accession number: NC_000913.3) and Gros Genbank accession number: NC_000913.3) molecular chaperones from Escherichia coli were selected for Saccharomyces cerevisiae codon optimization, and whole gene synthesis was performed according to the optimized sequence. The obtained DPEase gene fragment was connected to the pRS415 plasmid by Gibson Assembly to obtain the isomerase-expressing Saccharomyces cerevisiae recombinant plasmid pRS415-Pgpd-DP ​​E-Tgpd (named as plasmids DPEAG, DPECCE, DPEFP, DPECLO, DPEDOR, DP ESIN). The plasmid map is shown in Figure 1The obtained molecular chaperone gene was assembled on the pRS416 plasmid to obtain the molecular chaperone expression plasmid pRS416-Ptef-Grol-CYC1T-Pgpd-Gros-Tgpd (named as plasmid GRO01). The plasmid map is shown in Figure 1 As shown in b.

[0062] Example 2 Catalysis of isomerases from different sources expressed in Saccharomyces cerevisiae

[0063] The isomerase expression plasmids from different sources and the molecular chaperone expression plasmid constructed in Example 1 were simultaneously transferred into Saccharomyces cerevisiae BY4741 (the BY4741 strain was derived from the original strain of Saccharomyces cerevisiae - S288C, which is a commonly used strain preserved in this laboratory and is a gamete MATa type) for expression, and positive clones were screened using SC-Ura-Leu culture plates deficient in uracil and leucine.

[0064] Inoculate a single colony selected from the SC-Ura-Leu culture plate into a test tube containing 5 mL of SC-Ura-Leu liquid culture medium for overnight culture as the primary seed, with an OD of about 4. Take 2 mL of the primary seed and culture it in a 250 mL (containing 50 mL of culture medium) conical flask at 30°C for 48 h, then collect the bacteria, with an OD of about 10. Resuspend the yeast cells in 2 mL of ultrapure water to a final OD of 30 for enzyme catalysis.

[0065] Take the above 871mL yeast cells, 125mL (800g / L D-fructose) and 4mL (250mM cobalt chloride) to prepare a reaction system, and place it in a 55℃ water bath for 5h. Centrifuge (speed 12000g, centrifuge for 10min) the reaction solution, dilute it 10 times with ultrapure water for HPLC detection, the test results are as follows Figure 3 As shown, D-psicose and D-fructose coexist in the sample after the reaction. The conversion rate was calculated based on the residual amount of D-fructose and D-psicose after the reaction. The conversion rates of DPEase from different sources are shown in Table 1. Finally, the Dorea sp. source with the highest conversion rate was selected for genomic integration expression.

[0066] Table 1 Expression and transformation efficiency of DPEase from different sources in Saccharomyces cerevisiae

[0067]

[0068] Example 3 Construction of Doreasp.-derived isomerase and chaperone genome integration module

[0069] In this example, the expression module of DPEase from Dorea sp. and the expression module of molecular chaperone (Grol / s) were constructed respectively by molecular cloning technology. The upstream and downstream homology arms of CAN gene, histidine expression module and DPEase expression module were cloned from the genome of Saccharomyces cerevisiae, pRS413 plasmid and DPE01 plasmid respectively by PCR, and the obtained cloned fragments were connected to plasmid pRS416 by Gibson Assembly to construct the following: Figure 2 The plasmid map shown in a was named plasmid DOR01; the same method was used to construct Figure 2 b shows a plasmid carrying the homology arms of the HO gene site and a leucine-deficient screening tag molecular chaperone (Groel / s) expression module, named plasmid GRO02.

[0070] Example 4: Isomerase and chaperone genome integration module from Dorea sp. expressed in Saccharomyces cerevisiae

[0071] After the two expression modules of Example 3 were amplified by PCR, they were chemically transferred into the BY4741 strain of Saccharomyces cerevisiae and the SYN strain of yeast containing synthetic chromosome 5 for homologous recombination to construct BY4741DPE and SYNDPE strains respectively, and positive clones were screened using culture plates deficient in histidine and leucine. The catalytic reaction was carried out using the method described in Example 2, and the conversion efficiency of the BY4741DPE strain reached 35.06%, and the conversion rate of the SYNDPE strain reached 34.78%.

[0072] Table 2 Expression and transformation efficiency of DPEase from Dorea sp. in different Saccharomyces cerevisiae

[0073]

[0074] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. DPEase gene, characterized in that The sequence of the DPEase gene is: the nucleotide sequence shown in SEQ ID NO:

1.

2. DPEase expression module, characterized in that Comprising the DPEase gene as claimed in claim 1.

3. Use of the DPEase gene according to claim 1 or the DPEase expression module according to claim 2 in constructing a gene expression module.

4. A gene expression module, characterized in that It comprises the DPEase expression module and the molecular chaperone expression module as claimed in claim 2.

5. The gene expression module according to claim 4, characterized in that The molecular chaperone expression module includes: Groel and Groes.

6. The gene expression module according to claim 4 or 5, characterized in that The sequence of the molecular chaperone expression module is: the nucleotide sequence shown in SEQ ID NO: 2 and SEQ ID NO:

3.

7. The gene expression module according to claim 6, wherein: Also includes: promoters and terminators; The promoter includes: GPD , P TEF , P GAL or P TDH One or more of; The terminator includes one or more of GPDT, CYC1T or TEFT1.

8. An expression vector, characterized in that Comprising the gene expression module according to any one of claims 4 to 7.

9. A host, characterized in that Transformation and / or transfection with the expression vector according to claim 8.

10. A method for preparing D-psicose, characterized in that: The following steps are involved: The D-psicose is obtained by using D-fructose and cobalt chloride as raw materials and catalyzing by the host as claimed in claim 9.

11. Use of the DPEase gene according to claim 1, the DPEase expression module according to claim 2, the gene expression module according to claim 7, the expression vector according to claim 8, and the host according to claim 9 in directly or indirectly preparing D-psicose and / or products containing D-psicose.

Images