Application of BUB1 in the diagnosis and treatment of cervical cancer

Abstract

The present invention belongs to the field of biomedicine, and specifically relates to the application of BUB1 in the diagnosis and treatment of cervical cancer. The present invention found that BUB1 expression was significantly elevated in cervical cancer patients, particularly in cervical squamous cell carcinoma and endocervical adenocarcinoma, indicating that BUB1 can be used as a diagnostic marker for cervical cancer. Knockdown of the BUB1 gene can inhibit the proliferation of cervical cancer cells and induce apoptosis of cervical cancer cells. BUB1 regulates cervical cancer cell autophagy by regulating the PI3K / AKT / mTOR pathway during the formation and degradation of autophagosomes. Knockdown of the BUB1 gene can inhibit cervical cancer cell autophagy, increase cervical cancer cell apoptosis, and partially reverse cell apoptosis by inhibiting mTOR function. Animal model experiments have also demonstrated that knockdown of BUB1 can significantly inhibit the growth of subcutaneously transplanted tumors.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and particularly relates to the application of BUB1 in the diagnosis and treatment of cervical cancer. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance understanding of the overall background of the invention and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to those skilled in the art.

[0003] Cervical cancer remains the fourth most common gynecological cancer worldwide, with an estimated 604,127 new cases and 341,831 deaths in 2020. High-risk human papillomavirus (HPV) infection is the main cause of cervical cancer. Although screening and HPV vaccines are available for prevention, the global burden of cervical cancer is substantial. The molecular mechanisms underlying the transition from intraepithelial lesions to invasive carcinomas remain unclear. In addition to HPV infection, multiple cofactors and molecular events are also involved in the development and progression of cervical cancer. The 5-year overall survival rate for early-stage cervical cancer is >90%, but the survival rate decreases significantly for locally advanced and metastatic disease. With advances in the molecular biology and genomics of cervical cancer, targeted therapies, such as anti-angiogenic and immune checkpoint inhibitors, have greatly changed the treatment of cervical cancer. However, these drugs are far from sufficient; therefore, the development of new targets and drugs is necessary.

[0004] BUB1 is a serine / threonine protein kinase that is involved in the spindle assembly checkpoint (SAC) and has been reported to be altered in many cancers. Upregulated BUB1 expression is closely associated with the development and progression of various cancers, including breast, prostate, liver, lymphoma, and ovarian cancer. However, the mechanism of action of BUB1 in cervical cancer has not been investigated. Summary of the Invention

[0005] In order to address the deficiencies of the prior art, the present invention aims to provide an application of BUB1 in the diagnosis and treatment of cervical cancer.

[0006] In order to achieve the above object, the present invention is implemented through the following technical solutions:

[0007] In a first aspect, the present invention provides the use of a BUB1 detection reagent in the preparation of a cervical cancer diagnosis product.

[0008] In a second aspect, the present invention provides use of an agent for inhibiting BUB1 expression in the preparation of a product for treating cervical cancer.

[0009] The beneficial effects achieved by one or more technical solutions of the present invention are as follows:

[0010] The present invention found that the expression of BUB1 in cervical cancer patients was significantly increased, especially in cervical squamous cell carcinoma and endocervical adenocarcinoma, indicating that BUB1 can be used as a diagnostic marker for cervical cancer.

[0011] Knockdown of the BUB1 gene inhibits cervical cancer cell proliferation and induces apoptosis. BUB1 regulates autophagy in cervical cancer cells by modulating the PI3K / AKT / mTOR pathway during autophagosome formation and degradation. Knockdown of the BUB1 gene inhibits autophagy, increases apoptosis, and partially reverses apoptosis by inhibiting mTOR function. Animal model experiments have also demonstrated that knockdown of BUB1 significantly inhibits the growth of subcutaneous transplanted tumors. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] The accompanying drawings, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0013] Figure 1 Figures 1 and 2 show data from biological analyses using GEO and TCGA datasets, where A shows the identification of differentially expressed genes using GSE6791, B shows the validation of BUB1 expression using GSE6791, C shows the comparison of BUB1 mRNA levels in cervical squamous cell carcinoma tissues and normal cervical tissues using the GEPIA database, and D shows the validation data showing a positive correlation between BUB1 expression and Ki67 levels in cervical squamous cell carcinoma tissues.

[0014] Figure 2 Figure 1 is a comparison of BUB1 mRNA and protein levels in cervical cancer tissues and normal cervical tissues, where A is the data of BUB1 mRNA level detected by qRT-PCR, and B is the data of BUB1 protein expression in 6 paired cervical cancer tissues and para-cancerous tissues detected by Western blot, where T1-T6 represent cervical cancer tissues, and N1-N6 represent para-cancerous tissues;

[0015] Figure 3 Immunohistochemical staining was used to detect the expression of BUB1 in 80 cervical squamous cell carcinoma tissues and 10 normal cervical tissues. A is a representative staining image, and B is a comparison of the scoring results.

[0016] Figure 4 Figure 1 shows the validation data for BUB1-KD's ability to inhibit cell proliferation and induce apoptosis. A shows the comparison of BUB1 protein abundance in HeLa, CaSki, and SiHa cell lines; B shows the transfection efficiency validation data by Western blotting; C shows the EdU assay data; D shows the long-term effect assay data; E shows the CCK-8 assay data; and F shows the flow cytometry results.

[0017] Figure 5 Figures A and B show the results of differentially expressed genes identified by whole transcriptome sequencing and expression data of proteins related to the PI3K / AKT pathway. A shows the results of differentially expressed gene identification, B shows the data of Gene Ontology classification and enrichment analysis of differentially expressed genes, C shows the pathway enrichment results, and D shows the data of protein expression related to the PI3K / AKT pathway detected in HeLa, CaSki, and SiHa cell lines.

[0018] Figure 6 The figure shows the data results of chloroquine (CQ), bafilomycin-a1 (Baf-A1) and 3-methyladenine (3-MA) ​​blocking cell autophagy in BUB1-KD and BUB1 overexpression models;

[0019] Figure 7 The results of confocal fluorescence imaging detection of autophagosome-lysosome contact after sh-NC and sh-BUB1 transfection in CaSki cells. A is the confocal fluorescence imaging image, and B is the grayscale value change of the LC3B-LAMP1 image line segment in A.

[0020] Figure 8 Images and data for immunofluorescence detection of LC3B levels;

[0021] Figure 9 Images and statistical data of Western blot detection of the effects of rapamycin and WAY-600 on autophagy in CaSki cells;

[0022] Figure 10 Flow cytometry was used to detect cell apoptosis after different treatments, where A shows the cell apoptosis after treatment with autophagy inhibitors, CQ, and Baf-A1, and B shows the cell apoptosis after treatment with rapamycin and WAY-600;

[0023] Figure 11 The figure shows the construction of mouse transplant tumor models and the comparison of tumor parameters. A is an image of the mouse transplant tumor model, B is an image of the mouse transplant tumor and a comparison of the transplant tumor mass, and C is a comparison of the mouse transplant tumor volume.

[0024] Figure 12 Western blotting was used to detect the expression levels of BUB1, p-4EBP1, and pAKT in transplanted tumor tissues;

[0025] Figure 13 Representative images of BUB1, Ki67, LC3B, and P62 IHC staining in tumor tissues. DETAILED DESCRIPTION

[0026] A first typical embodiment of the present invention is the use of a BUB1 detection reagent in the preparation of a cervical cancer diagnosis product.

[0027] In one or more examples of this embodiment, the BUB1 detection reagent includes one or more of a detection reagent for detecting BUB1 protein level or a detection reagent for detecting BUB1 mRNA expression level.

[0028] In one or more examples of this embodiment, the test sample of the cervical cancer diagnostic product includes one or more of human tissue, blood, urine or saliva.

[0029] In one or more examples of this embodiment, the cervical cancer diagnostic product includes one or more of a primer, a probe, a chip, a nucleic acid membrane strip, a preparation or a kit.

[0030] A second typical embodiment of the present invention is the use of an agent for inhibiting BUB1 expression in the preparation of a product for treating cervical cancer.

[0031] In one or more examples of this embodiment, the functions of the cervical cancer treatment product include one or more of the following:

[0032] (1) Inhibit the proliferation of cervical cancer cells;

[0033] (2) Induce apoptosis of cervical cancer cells;

[0034] (3) inhibiting autophagy in cervical cancer cells;

[0035] (4) Inhibit tumor growth.

[0036] In one or more examples of this embodiment, the cervical cancer treatment product inhibits cervical cancer cell autophagy by regulating and activating mTORC1, blocking mTORC2, or inhibiting autophagosome-lysosome fusion.

[0037] In one or more examples of this embodiment, the cervical cancer treatment product includes one or more of medicines, foods, and health products.

[0038] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments and comparative examples.

[0039] The experimental methods used in the examples of the present invention are as follows.

[0040] 1. Clinical cervical specimens

[0041] Cervical specimens were collected from 80 patients with cervical cancer. A control group comprised 10 patients undergoing hysterectomy for benign conditions such as uterine leiomyoma. All studies followed a protocol approved by the Ethics Committee of Qilu Hospital of Shandong University, and all patients provided informed consent.

[0042] 2. Cell Lines and Culture Conditions

[0043] Cervical cancer cell lines were purchased from Zhongqiao Xinzhou Biotechnology Co., Ltd. (Shanghai, China). HeLa cells were cultured in Dulbecco's Modified Eagle's Medium (BI, Israel), CaSki cells were cultured in RPMI 1640 medium (BI, Israel), and SiHa cells were cultured in MEM medium (BI, Israel). Both media were supplemented with 10% fetal bovine serum (FBS). Cells were cultured at 37.5°C in a humidified atmosphere containing 5% CO.

[0044] 3. Immunoblotting

[0045] Proteins were extracted from cells and tissues. Cells were lysed with RIPA buffer containing 1% phenylmethanesulfonyl fluoride (PMSF) and 1% sodium fluoride. Protein concentration was determined using a BCA protein assay kit (Beyotime, Beijing, China). Total proteins were electrophoresed on an 11% SDS-polyacrylamide gel (SDS-PAG) and transferred to a polyvinylidene difluoride (PVDF) membrane. The membrane was blocked with protein-free rapid blocking buffer (EpiZyme, Shanghai, China) for 10 minutes at room temperature and incubated with the primary antibody overnight at 4°C. The membrane was incubated with the secondary antibody for 90 minutes, and the bands were detected using an ECL-based system.

[0046] 4. Quantitative Real-time Transcription Polymerase Chain Reaction

[0047] Total RNA was extracted using TRIZOL reagent (Invitrogen, Carlsbad, CA, USA), and concentration and purity were determined spectrophotometrically (Thermo Fisher Scientific Inc., MA, USA). Reverse transcription was performed using a one-step RT mix system (Solarbio, Beijing, China). qRT-PCR™ polymerase chain reaction amplifier (Applied Biosystems, USA) was performed using SYBR Green Master Mix (Takara, Japan) on a StepOne. Relative RNA abundance was calculated using the standard 2-ΔΔCt method, with β-actin as a control. Primers for the BUB1 gene were as follows: forward primer: ACAATCAACGGAGAAAGCATGA, the nucleic acid sequence of which is shown in SEQ ID NO. 1; reverse primer: CTCCACCACCTGATGCAACT, the nucleic acid sequence of which is shown in SEQ ID NO. 2.

[0048] 5.CCK-8 assay

[0049] Cell viability was detected using a cell counting kit (Cell Counting Kit-8, CCK-8, Zhongshan Jinqiao, Beijing, China); 3×10 3 Cells were seeded in each well of a 96-well plate and cultured for 0, 24, 48, 72, 96, and 120 h. After incubation with 10 μl CCK-8 for 2 h, the cells were analyzed using a microplate reader (Infinite 2000; Tecan, Switzerland) for testing.

[0050] 6. EdU Assay

[0051] Cell proliferation was assessed using a 5-ethynyl-2'-deoxyuridine (EdU) assay kit (Solarbio, Beijing, China). Cells were seeded at a density of 1 × 10 cells per well in a 96-well plate. Cells were incubated with 10 μM EdU buffer (cell culture medium: reagent A 5000:1) at 37°C for 24 hours and fixed with methanol for 30 minutes. After washing with 1× PBS, cells were permeabilized with 0.5% Triton X-100 for 20 minutes. 100 μL of 1× EdU solution was added to each well, and nuclear morphology was assessed by Hoechst staining. Staining results were observed under a fluorescence microscope.

[0052] 7. Immunohistochemistry (IHC)

[0053] Fresh tumor tissue and xenografts were fixed with 4% paraformaldehyde for at least 24 hours and then dehydrated. Tissues were then embedded in paraffin and cut into 4-μm-thick sections. Microwave antigen retrieval was performed for 15 minutes in EDTA buffer (pH 9.0) or citrate buffer (pH 6.0) at 98°C, depending on the antibody protocol. IHC was performed using the SP-9000 Immunohistochemistry Detection Kit (Zhongshan Jinqiao, Beijing) according to the manufacturer's instructions. Endogenous peroxidase was blocked with 3% hydrogen peroxide for 20 minutes, and nonspecific binding was blocked with goat serum for 30 minutes. Primary antibodies (BUB1, 1:50; Ki67, 1:100; LC3A / B, 1:500; P62, 1:200) were incubated overnight at 4°C in a humidified chamber. After incubation with biotin-conjugated goat anti-rabbit IgG polymer for 20 minutes and horseradish peroxidase-conjugated streptavidin for 15 minutes, expression was detected using DAB reagent. Then, the membranes were stained with hematoxylin for 5 min, dehydrated, and sealed with neutral glue.

[0054] Semiquantitative analysis of patient specimens was performed using a scoring method. All immunohistochemically stained sections were reviewed by two pathologists. The percentage of positive cells was scored on a scale of 0 to 4: 0, 0-5%; 1, 6-25%; 2, 26-50%; 3, 51-75%; and 4, 76-100%. Immunohistochemical staining intensity was scored as follows: 0, no staining; 1, light yellow; 2, medium brown; and 3, intense brown. The two scores were multiplied together to obtain the total immunoreactivity score (IRS), which was categorized as follows: 0-4, absent or weak expression; 6-8, moderately positive expression; and 9-12, strongly positive expression. Patients were divided into a low BUB1 expression group (IRS ≤ 7) and a high BUB1 expression group (IRS > 7) based on the IRS.

[0055] Image-Pro Plus 6.0 software (Media Cybernetics, USA) was used to quantify the positive signal in the transplanted tumor tissues. All tissues analyzed for staining were analyzed using the same settings. The integrated optical density (IOD) and total area size of each field were measured, and staining was scored using IOD / size.

[0056] 8. Immunofluorescence and Confocal Microscopy Analysis

[0057] Cells were seeded in 24-well plates (3.5 × 10 4 Each well) was plated on a glass coverslip. Briefly, the cell sheets were fixed with cold methanol for 15 minutes. After washing the cells with PBS, the cells were permeabilized with PBS containing 0.2% Triton-X100 for 10 minutes and blocked with 3% BSA PBS for 30 minutes. Then, the primary antibody was incubated for at least 18 hours in a wet box at 4°C. The next day, the secondary antibody was incubated for 1 hour in the dark at 37.5°C, followed by DAPI (Yusen Biotechnology, Shanghai, China) staining. Images were collected using a x100 oil objective confocal microscope and analyzed using ImageJ software from the National Institutes of Health, USA.

[0058] 9. Colony Formation Assay

[0059] Five hundred cells in logarithmically growing phase were seeded into 6-well plates at a confluence of 70% to 80%. The cells were cultured at 37.5°C and 5% CO for 14 days to allow colony formation. After two weeks, the cells were fixed with methanol and stained with crystal violet stain (Beyotime, Nanjing, China).

[0060] 10. Flow Cytometry

[0061] For apoptosis experiments, treated cells were harvested, washed twice with 1× PBS, and then resuspended in 1× binding buffer (62700-80, Biogems). Each cell was incubated with 5 μl of Annexin V-APC and 5 μl of 7AAD for 30 min. Cells were analyzed using a Cytoflex flow cytometer (Beckman Coulter, USA) and analyzed with CytExpert software.

[0062] 11. Nude mouse transplant tumor experiment

[0063] Twelve BALB / c female nude mice (14-16 g, 4 weeks old, Charles River, Beijing, China) were selected and raised in an SPF-grade mouse facility. The mice were randomly divided into a control group (sh-NC) and a sh-BUB1 group according to their body weight, with 6 mice in each group. The cervical cancer cell line CaSki transfected with sh-NC or sh-BUB1 was resuspended in PBS, and 150 μl (1×10 cells) of this suspension was injected subcutaneously into the right axilla of the mouse. The tumor volume and weight of the nude mice were measured every 2 days until the maximum length of the tumor reached 1.5 cm. The nude mice were killed after taking pictures and the tumor volume was measured. The tumor volume was calculated as 0.5×length×width. 2 .

[0064] 12. Statistical Analysis

[0065] All experiments were repeated at least three times. Quantitative data are expressed as mean ± standard error of the mean (SEM). Mann-Whitney test, two-sided t-test, or two-way analysis of variance was performed between groups using GraphPad Prism 7.00 (GraphPad Software, La Jolla, CA, USA). Univariate analysis was performed using SPSS v17.0 (SPSS Inc., Chicago, IL, USA). P < 0.05 was considered statistically significant.

[0066] Example 1

[0067] Bioinformatics analysis was performed using GEO (Gene Expression Omnibus) and TCGA (The Cancer Genome Atlas) datasets. Figure 1 As shown in Figures A and B, analysis of the GSE6791 dataset showed that there were 2857 upregulated genes in cervical cancer compared with normal tissues, among which BUB1 expression was significantly increased (p = 7.7e -05 ).like Figure 1As shown in Figures C and D, analysis of the TCGA dataset confirmed that BUB1 was upregulated in cervical squamous cell carcinoma and endocervical adenocarcinoma, and its expression was positively correlated with Ki67 levels (R=0.59, p=0), and Ki67 was associated with cell proliferation and differentiation.

[0068] qRT-PCR was used to detect the expression of BUB1 mRNA in 27 normal cervical tissues and 33 cervical squamous cell carcinoma tissues, and Western blot was used to detect the expression of BUB1 protein in 6 paired cervical cancer tissues and adjacent tissues. Figure 2 As shown in Figures A and B, the mRNA and protein levels of BUB1 in cervical cancer tissues were higher than those in normal tissues and adjacent tissues (p<0.05).

[0069] Immunohistochemical staining was used to detect the expression of BUB1 in 80 cervical squamous cell carcinoma tissues and 10 normal cervical tissues to explore the clinical significance of BUB1 expression. Figure 3 As shown in A. BUB1 expression is located in the nucleus, and the cytoplasm is stained yellow-brown. Figure 3 As shown in Figure B, the results showed that the overall immune response score (IRS) of cervical cancer tissue was significantly higher than that of normal cervical epithelium. Analysis of the clinicopathological characteristics of cancer samples showed that BUB1 expression was correlated with the pathological type (p < 0.05) and histological grade (p < 0.05) of cervical cancer, as shown in Table 1. BUB1 was highly expressed in non-squamous cell carcinoma and poorly differentiated cell carcinoma.

[0070] Table 1 Relationship between clinicopathological factors and BUB1 expression

[0071]

[0072]

[0073] Example 2

[0074] like Figure 4 As shown in Figure A, among the three cervical cancer cell lines, HeLa cells have the highest abundance of BUB1 protein, followed by CaSki and SiHa cells. Therefore, HeLa and CaSki cells were selected to create BUB1 knockdown (BUB1-KD) models, and CaSki and SiHa cells were selected to create BUB1 overexpression models. Western blotting was used to verify the transfection efficiency, as shown in Figure 2. Figure 4 As shown in B. Figure 4 As shown in Figure C, EdU experiments showed that knocking down BUB1 expression in HeLa and CaSki cells inhibited their proliferation. Figure 4 As shown in Figure D, BUB1-KD reduced colony formation in the long-term effect assay (p < 0.05). Figure 4 As shown in Figure E, in the CCK-8 assay, the relative viability of BUB1-KD cells was significantly lower than that of the negative control (NC), especially in the last 3 days. Overexpression of BUB1 in CaSki and SiHa cells had the opposite effect.

[0075] Flow cytometry was used to detect cell apoptosis. Figure 4 As shown in (F), double-positive staining of APC Annexin-V and 7AAD showed that BUB1-KD induced apoptosis in cervical cancer cells compared with the control group.

[0076] Example 3

[0077] Whole transcriptome sequencing was used to identify differentially expressed genes (DEGs). Figure 5 As shown in Figure A, compared with the control group, there are 2857 up-regulated genes and 350 down-regulated genes in the HeLa cell BUB1-KD group. Figure 5 As shown in Figure B, Gene Ontology classification and enrichment analysis of these differentially expressed genes showed that the enriched biological processes included cell component organization or biogenesis, localization, signal transduction, rhythmic process, biological adhesion and cell killing; the affected cell components included organelles, membranes, membrane-sealed lumens, cell junctions, virions and nucleoids; the affected molecular functions included signal transduction activity, molecular transduction activity, nucleic acid binding transcription factor activity, transporter activity, transcription factor activity, protein binding, chemical attraction activity and chemical repulsion activity. Figure 5 As shown in Figure C, pathway enrichment results showed that DEGs were enriched in the PI3K / AKT signaling pathway. The expression of PI3K / AKT pathway-related proteins was detected in HeLa, CaSki, and SiHa cell lines. Figure 5 As shown in Figure 5D, knockdown of BUB1 reduced phosphorylation of AKT on Ser473 of the mammalian target of rapamycin complex 2 (mTORC2) effector protein but increased phosphorylation of mTORC1 effector proteins and 4E-BP1. However, overexpression of BUB1 had the opposite effect.

[0078] BUB1 may mediate caspase-independent mitotic death (CIMD) through autophagy. Autophagy is a self-protection mechanism closely related to apoptosis. There is a tight reverse coupling between the induction of autophagy and the activation of mTORC1. Since the function of BUB1 involves apoptosis and the PI3K / AKT / mTOR signaling pathway, there is good reason to speculate that BUB1 may be involved in cellular autophagy. In order to verify that BUB1 is involved in cellular autophagy, chloroquine (CQ), bafilomycin-a1 (Baf-A1) and 3-methyladenine (3-MA) ​​were used to block cellular autophagy. CaSki was selected to simultaneously create BUB1-KD and BUB1 overexpression models. As Figure 6 As shown, compared with the control group, BUB1 KD reduced the levels of the autophagy protein microtubule-associated protein 1 light chain 3-II (LC3-II), thereby decreasing the LC3-II / LC3-I ratio in the Baf-A1 and CQ groups. The opposite effect was observed in the BUB1 overexpression group. These results suggest that BUB1 KD inhibits autophagosome formation.

[0079] Example 4

[0080] According to the results of Example 3, in the presence of CQ or 3-MA, BUB1 overexpression tended to reduce the levels of LC3-I and LC3-II, but did not significantly change the ratio of LC3-II / LC3-I, while cells treated with 3-MA and CQ showed an increase in LC3-II levels. A reasonable assumption is that BUB1 overexpression may promote autophagolysosomal degradation. Therefore, confocal fluorescence imaging was used to determine autophagosome-lysosome fusion. Figure 7 As shown in the figure, in BUB1-KD CaSki cells, lysosomes were located in the juxtanuclear region; in the NC group, lysosomes were scattered in the cytoplasm, and lc3b-punctate autophagosomes were observed. The frequency of lysosome-autophagosome encounters was lower in the BUB1-KD group (Mander's coefficient was 0.832 in the NC group and 0.586 in the BUB1-KD group). Figure 8 As shown in Figure 3, the proportion of LC3B punctate cells increased in both the BUB1-KD and BUB1-overexpression groups. Taken together, these results suggest that BUB1 KD reduces the encounter and fusion of autophagosomes with lysosomes, leading to impaired autophagosome degradation.

[0081] Example 5

[0082] To further confirm the mechanism by which BUB1 regulates autophagy, we used the allosteric mTORC1 inhibitor rapamycin and the mTORC1 and mTORC2 inhibitor WAY-600 to induce autophagy. Figure 9As shown, mTORC inhibitors can partially rescue the autophagy inhibition caused by BUB1 KD and synergize with BUB1 overexpression to induce autophagy. In the knockdown model, the increase in LC3-II levels in the WAY600-treated group was similar to that in the corresponding rapamycin-treated group, while LC3-I levels were significantly higher. This suggests that although autophagic flux is reduced (LC3-I increase), autophagosomes still accumulate (LC3-II increase), and WAY-600 inhibition and BUB1-KD-triggered mTORC2 inhibition inhibit autophagosome formation and autophagosome degradation. However, the mechanism by which mTORC2 regulates autophagy is still unclear. These data suggest that BUB1 promotes autophagy by blocking mTORC1 and activating mTORC2.

[0083] To further verify the relationship between BUB1-KD inhibition of autophagy and apoptosis, flow cytometry was used to detect the individual proportion of apoptotic cells. Figure 10 As shown in Figure A, blocking autophagy with Baf-A1 or CQ increased BUB1-KD-induced apoptosis compared with the respective control groups. Figure 10 As shown in panel B, rapamycin and WAY-600 abolished BUB1-KD-induced apoptosis. In both the NC and BUB1-KD groups, apoptosis was increased in the WAY-600 group compared with the rapamycin group. This result also confirms that WAY-600 inhibits autophagy compared with rapamycin.

[0084] Example 6

[0085] like Figure 11 As shown in Figure A, 4-week-old female BALB / c mice were randomly divided into NC group and KD group according to body weight, and 1×10 7 Cervical cancer cell line CaSki was transfected with sh-NC or sh-BUB1. Tumor size and body weight of mice were recorded regularly. After surgery, subcutaneous tumors were removed and weighed. Figure 11 As shown in Figures B and C, the weight and volume of the tumor in the KD group were significantly smaller than those in the NC group. A portion of the tumor mass was separated for Western blotting, and the other portion was embedded in paraffin for IHC. Figure 12 As shown in Figure 3, Western blot analysis showed that BUB1-KD inhibited AKT phosphorylation and increased the expression of phospho-4EBP1. Figure 13 As shown, IHC results showed that Ki67 levels were higher in the NC group than in the BUB1-KD group. In summary, the tumorigenicity of BUB1-KD cells was significantly lower than that of control cells. Furthermore, IHC assays revealed an increase in the proportion of cells containing LC3A / B puncta, as well as increased P62 levels and the number of P62 puncta in the BUB1-KD group. These results suggest that BUB1 plays an important role in the tumorigenicity of cervical cancer cells in vivo by regulating autophagy.

[0086] The foregoing description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art will readily appreciate that various modifications and variations of the present invention are possible. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention are intended to be within the scope of protection of the present invention.

Claims

1. Use of a reagent that inhibits BUB1 expression in the preparation of a product for treating cervical cancer; the product for treating cervical cancer comprises a drug; the drug is a reagent that inhibits BUB1 expression; the reagent that inhibits BUB1 expression is shRNA targeting BUB1.

2. The use according to claim 1, characterized in that The functions of the cervical cancer treatment product include one or more of the following: (1) Inhibit the proliferation of cervical cancer cells; (2) Inducing apoptosis of cervical cancer cells; (3) Inhibit autophagy in cervical cancer cells; (4) Inhibit tumor growth.

Images