A Lumpy Skin Disease Virus lacking TK and its applications
By constructing the gene-deficient cattle nodular skin disease virus strain LSDVΔTK, the side effects of existing vaccines were solved, safe and efficient vaccination effects were achieved, and economic losses in the cattle farming industry were reduced.
Patent Information
- Application Number
- CN202310356761.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-04-04
- Publication Date
- 2025-07-22
- Estimated Expiration
- 2043-04-04
AI Technical Summary
The existing cattle nodular dermatosis virus vaccine has side effects and the lack of safe and effective therapeutic drugs or vaccines has led to serious economic losses in the cattle industry.
The gene-deleted bovine nodular dermatosis virus strain LSDVΔTK was constructed, and the mutant strain was screened through the drug 5-bromodeoxyuracil nucleoside (BrdU) was used to obtain the LSDVΔTK strain without TK genes, which was used to prepare vaccines and immune preparations to avoid side reactions.
The LSDVΔTK vaccine produces a good neutralizing antibody response in cattle without side reactions, reducing breeding costs and improving economic benefits.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The present invention relates to the field of viral vaccines and vaccine preparation, and particularly to a lumpy skin disease virus vaccine for cattle. Background Art
[0002] Lumpy Skin Disease (LSD) is a highly contagious disease of cattle caused by Lumpy Skin Disease Virus (LSDV). The clinical manifestations are as follows: fever up to 40 - 41.5 °C, lasting for 1 - 3 days, weight loss, reduced milk production, and in severe cases, milk production stops; there will also be salivation, lacrimation, accompanied by purulent or mucopurulent nasal discharge; the volume of lymph nodes throughout the body increases, forming single or multiple round skin nodules, mostly appearing in areas with sparse hair such as the head, neck, back, udder, perineum, genitalia, limbs, tail, etc. The ulceration of skin nodules attracts maggots and causes bacterial infection, and the wound cannot heal for several months, finally leaving permanent pockmarks that can penetrate into the muscle tissue, seriously reducing the quality of leather products. Although the incidence of LSD varies greatly (5% - 90%), the mortality rate is relatively low (below 10%), but it can reach 85% in some epidemic areas. The sporadic or huge difference in mortality rate may be closely related to cattle breeds, virulence of virus strains, animal health status, and types of transmission vectors, etc. LSD has caused significant economic losses to the cattle industry in epidemic countries, and this disease is listed as one of the diseases that must be reported by the World Organization for Animal Health.
[0003] Lumpy skin disease virus belongs to the family Poxviridae, subfamily Chordopoxvirinae, genus Capripoxvirus. The virus is a double-stranded DNA virus with a genome length of approximately 150 kbp, encoding approximately 156 putative genes. LSDV particles are brick-shaped, 294 ± 20 nm in length and 262 nm ± 22 nm in width. Under transmission electron microscopy, the Capripoxvirus genome presents a triple-fold helical or tubular shape, and the genome forms a double-concave core structure, which is surrounded by a capsid together with two lateral bodies. Like other poxvirus genomes, the two ends are hairpin structures, which are closely related to replication. Adjacent to the hairpin structures at both ends are inverted repeat sequences (ITRs). TK has been proven to be a non-essential virulence gene for replication in DNA viruses. When it is deleted, the virulence of the virus will decrease (Tenser RB, 1991; Martín Hernández AM et al, 1995), but the antigenicity is not affected (Liu Zhengfei et al, 2002). The full length of the LSDV TK (thymidine kinase) gene is 534 bp, encoding 178 amino acids, which also has an important impact on the virulence of LSDV (Wallace DB, Viljoen GJ, 2022).
[0004] Since LSD was introduced into China in 2019, the disease has spread rapidly across provinces and cities in China, causing huge economic losses to the breeding industry. Currently, there is no specific drug to treat lumpy skin disease in cattle. Generally, live attenuated vaccines (LAV) are used to prevent LSD; the first type is the live attenuated homologous vaccine based on LSDV strains, including Neethling strain vaccine and KGSP strain vaccine; the second type is the live attenuated heterologous vaccine of non-LSDV strains, such as goatpox vaccine and sheeppox vaccine. In South Africa, the live attenuated homologous vaccine (Neethling / vaccine / LW1959) is mainly used to control the disease, and there are already many derivative vaccines, such as Lumpyvax, Herbivac LS and OBP vaccines. Although the live attenuated homologous vaccine is attenuated by continuous passage, when using the Neethling vaccine, cattle will have side effects. The common side effects are local reactions at the inoculation site, transient fever and decreased milk production, and some animals may show mild systemic reactions. Therefore, it is of great significance to the cattle industry to develop one or several safe and effective LSD treatment drugs or vaccines as soon as possible. Summary of the Invention
[0005] In a first aspect, the present invention provides a gene-deleted lumpy skin disease virus strain LSDVΔTK, with a deposit date: March 10, 2023, deposit number: CCTCC NO: V202314, and the name of the depositary institution: China Center for Type Culture Collection.
[0006] Furthermore, the gene deletion is the deletion of the TK gene (thymidine kinase).
[0007] Furthermore, the lumpy skin disease virus strain LSDV is preferably the Neethling vaccine strain.
[0008] Furthermore, the sequence of ΔTK of the lumpy skin disease virus strain LSDVΔTK with gene deletion is as follows:
[0009] SEQ ID NO:1
[0010] atgctatgAatatatacatttaattataggacctatgttttctggcaaaagtactgaattgataagaatagttaaaaggt
[0011] accaaatagcgcagtataaatgctgtgtagtaaaatacttaaaagatatccgatatggtaattctgtgtatacgcatgat
[0012] aataaccatgtatctgccatatcaacaactttattatatgacgtcgttgataaaattatgaattacattataggtataga
[0013] tgaaggccaattctttaaagatattgtatctttttctgaaaataCggcaaatatgggaaagataattataatagctgcac
[0014] tagatagcacgtttcaacgaaaagaatttaatgatatattgaaattaataccgttatctgaaaaagtaacaaaattaaac
[0015] gctgtatgtatggaatgttataaagacgccgcattttctaagaggatcactaaagaaaaggaaatagaactcatcggggg
[0016] taaggaaaaatataaatctgtttgtaggaaatgttatttttGagaataa。
[0017] Second aspect, the present invention provides a method for obtaining a gene - deleted bovine lumpy skin disease virus strain LSDVΔTK; the method comprises the following steps:
[0018] S01 Construct an LSDV cell line with ΔTK;
[0019] S02 During the culture of the above - mentioned LSDV cell with ΔTK, screen for the LSDVΔTK mutant strain through drugs.
[0020] Furthermore, the cell is preferably Vero TK - cell. Inoculate Vero TK - cells in DMEM culture medium containing BrdU. After it grows confluently, infect Vero TK - cells at 5 MOI and continue to culture in DMEM culture medium containing BrdU.
[0021] Furthermore, the drug is a 5 - bromodeoxyuridine (BrdU) solution, and the concentration of the solution is 10 - 50 mg / L.
[0022] Third aspect, the present invention provides a pharmaceutical composition containing the gene - deleted bovine lumpy skin disease virus strain LSDVΔTK, and the pharmaceutical composition can be a combination of a vaccine, an immunopreparation and / or an immunoadjuvant.
[0023] Furthermore, the gene - deleted bovine lumpy skin disease virus strain LSDVΔTK can be viral nucleic acid or protein.
[0024] Fourth aspect, the present invention provides an application of the gene - deleted bovine lumpy skin disease virus strain LSDVΔTK in the preparation of an immunopharmaceutical for bovine lumpy skin disease.
[0025] Furthermore, the immunopharmaceutical can be a vaccine, an immunopreparation and / or an immunoadjuvant.
[0026] Furthermore, the vaccine is preferably a live vaccine or an inactivated vaccine.
[0027] Furthermore, the immunopreparation and / or the immunoadjuvant is a nucleic acid or protein containing the expressed gene - deleted bovine lumpy skin disease virus strain LSDVΔTK.
[0028] Furthermore, the administration route of the immunopharmaceutical is selected from: oral administration, sublingual administration, gastric or intestinal administration, topical administration, injection administration, intravenous injection, subcutaneous injection, intramuscular injection, transdermal administration, and / or inhalation administration, etc.
[0029] Furthermore, the dosage form of the immunopharmaceutical can be: tablets, capsules, powders, injections, syrups, solutions, sustained-release agents, immediate-release agents, controlled-release agents, emulsions, microemulsions, nanoformulations, targeted formulations, suppositories, ointments, gels, solid dispersions, inclusion compounds, and / or patches.
[0030] In a fifth aspect, the present invention provides a viral vector and its composition, wherein the virus is a gene-deleted lumpy skin disease virus strain LSDVΔTK, Capripoxvirus Lumpy skin disease virus LSDVΔTK(N)); deposit date: March 10, 2023; deposit number: CCTCC NO: V202314; depository institution: China Center for Type Culture Collection.
[0031] atgctatgAatatatacatttaattataggacctatgttttctggcaaaagtactgaattgataagaatagttaaaaggt
[0032] accaaatagcgcagtataaatgctgtgtagtaaaatacttaaaagatatccgatatggtaattctgtgtatacgcatgat
[0033] aataaccatgtatctgccatatcaacaactttattatatgacgtcgttgataaaattatgaattacattataggtataga
[0034] tgaaggccaattctttaaagatattgtatctttttctgaaaataCggcaaatatgggaaagataattataatagctgcac
[0035] tagatagcacgtttcaacgaaaagaatttaatgatatattgaaattaataccgttatctgaaaaagtaacaaaattaaac
[0036] gctgtatgtatggaatgttataaagacgccgcattttctaagaggatcactaaagaaaaggaaatagaactcatcggggg
[0037] taaggaaaaatataaatctgtttgtaggaaatgttatttttGagaataa。
[0038] Furthermore, the composition is a composition composed of a gene - deleted bovine lumpy skin disease virus strain LSDVΔTK vector loaded with heterologous and / or homologous genes.
[0039] Beneficial effects:
[0040] The bovine lumpy skin disease virus strain LSDVΔTK mutant strain constructed and screened through the drug 5 - bromodeoxyuridine (BrdU), as an injection vaccine, can produce a good neutralizing antibody response in cattle, has no side effects, and has high safety. It reduces the breeding cost for cattle farming in the livestock industry and improves economic benefits. Description of the drawings
[0041] Figure 1 Phylogenetic tree analysis of the strain used in this invention, other publicly available Neething vaccine strains, and LSDV clinical isolates in China.
[0042] Figure 2 Schematic diagram for comparing the TK gene sequence of the LSDVΔTK (Neethling strain) mutant strain constructed in Example 1 with the corresponding sequence of the parental strain.
[0043] Figure 3 Titer test of the LSDVΔTK mutant strain in Example 1.
[0044] Figure 4 Immunization and blood collection process in Example 2.
[0045] Figure 5 Effect evaluation of the LSDVΔTK mutant strain in inactivated vaccine in Example 2.
[0046] Figure 6 Safety evaluation of the LSDVΔTK mutant strain in attenuated live vaccine in Example 3.
[0047] Figure 7 Neutralizing antibody level after inoculation with LSDVΔTK in Example 3. Detailed implementation manners
[0048] The Neethling original strain is an attenuated live vaccine that has been passaged in vitro and attenuated, and is preserved by the inventor's unit. Phylogenetic tree analysis of the strain used in this invention, other publicly available Neething vaccine strains, and LSDV clinical isolates in China (see Figure 1 ).
[0049] The TK gene encodes thymidine kinase, which catalyzes exogenous thymidine and participates in nucleic acid synthesis. However, TK is not an essential gene for the growth of poxviruses. BrdU is an analogue of thymidine. After being catalyzed and utilized by TK, it is incorporated into the viral genome as a substitute for thymidine, preventing normal viral nucleic acid synthesis. Therefore, in the presence of BrdU, only viruses with TK deletion mutations can replicate. In the present invention, Vero TK cells infected with LSDV were cultured with BrdU - cells. When CPE appeared in most cells, the cells were frozen and thawed three times, then purified on LT cells, and several plaques were picked for DNA extraction. After PCR amplification and sequencing, an LSDV TK gene deletion mutant strain was finally obtained. This method of screening gene mutations by drugs can reduce the drawback of the subsequent overly long biosafety evaluation time caused by the introduction of genes to be screened. By this method, it also conforms to the gene mutation law of microorganisms themselves, and an accurately mutated lumpy skin disease virus strain, LSDVΔTK mutant strain, is obtained.
[0050] The "lumpy skin disease virus strain LSDVΔTK" described in this article is the Capripoxvirus lumpy skin disease virus LSDVΔTK(N); preservation date: March 10, 2023; preservation number: CCTCC NO: V202314; preservation unit name: China Center for Type Culture Collection.
[0051] Example 1 Construction and titer detection of the lumpy skin disease virus LSDVΔTK mutant strain
[0052] First, the lumpy skin disease virus strain LSDVΔTK mutant strain was constructed using the drug 5-bromodeoxyuridine (BrdU). The LSDVΔTK mutant strain was screened by BrdU pressure.
[0053] Monolayer Vero cells (already lacking thymidine kinase, TK gene) (preserved in the laboratory) were inoculated and cultured with different concentrations of DMEM culture medium containing 5, 15, 25, 50, 75, and 100 mg / L BrdU, and one culture well without BrdU was set as a control. The parental strain LSDV was used to infect the Vero TK -Cells were adsorbed at 37°C for 2 h, and then cultured with different concentrations of culture media (containing 5 - 100 mg / L BrdU respectively), and the cytopathic effect (CPE) was observed. At 120 h after virus inoculation, the virus-infected cells were harvested. After three cycles of freezing and thawing, the virus was passaged one more generation according to the above method. Then the virus was inoculated onto CEF cells and cultured with nutrient agarose without BrdU (prepared by mixing 2×MEM medium containing 4% calf serum and 1% agarose at a volume ratio of 1:1). Single virus plaques were selected, and the virus was amplified after four rounds of plaque purification. Through drug (BrdU) screening and subsequent sequencing, a strain of LSDVΔTK (Neethling strain) was successfully obtained (see Figure 2 ); Preservation date: March 10, 2023, Preservation number: CCTCC NO:V202314, Name of the preservation unit: China Center for Type Culture Collection; Its ΔTK sequence is as shown in SEQ ID NO:1; From the growth curve results, it was found that the titer trend of LSDVΔTK was consistent with that of LSDV, and the growth titer of LSDVΔTK was not affected (see Figure 3 ).
[0054] SEQ ID NO:1
[0055] atgctatgAatatatacatttaattataggacctatgttttctggcaaaagtactgaattgataagaatagttaaaaggt
[0056] accaaatagcgcagtataaatgctgtgtagtaaaatacttaaaagatatccgatatggtaattctgtgtatacgcatgat
[0057] aataaccatgtatctgccatatcaacaactttattatatgacgtcgttgataaaattatgaattacattataggtataga
[0058] tgaaggccaattctttaaagatattgtatctttttctgaaaataCggcaaatatgggaaagataattataatagctgcac
[0059] tagatagcacgtttcaacgaaaagaatttaatgatatattgaaattaataccgttatctgaaaaagtaacaaaattaaac
[0060] gctgtatgtatggaatgttataaagacgccgcattttctaagaggatcactaaagaaaaggaaatagaactcatcggggg
[0061] taaggaaaaatataaatctgtttgtaggaaatgttatttttGagaataa。
[0062] Example 2 Evaluation of the Efficacy of LSDVΔTK in Inactivated Vaccines
[0063] Inactivate with β-propiolactone at a ratio of 1:4000 at 4°C for 48 hours, and then hydrolyze in a 37°C water bath. Then titrate the inactivated virus to detect whether the virus is completely inactivated. Inoculate the inactivated virus on LT cells, and the results show that the virus has been completely inactivated. Select SEPPIC, ISA201VG adjuvant from France for emulsification (add 1 ml of adjuvant per gram of inactivated virus solution) to prepare the inactivated vaccine.
[0064] Select 5 Holstein dairy bulls aged 6 - 10 months with negative LSDV serum, and inject 2 ml intramuscularly. Then, observe the injection site every day. After continuous observation for 7 days, no adverse reactions such as swelling and local inflammation appear at the injection site. Collect blood every week, separate the serum, and conduct subsequent neutralization experiments. Three weeks after the primary immunization, perform a booster immunization using the same method as the primary immunization (see Figure 4 ).
[0065] Neutralizing antibody determination: Dilute the collected serum serially in a 96-well plate until LSDV is diluted to 100 TCID 50 , mix the serum at each dilution with an equal volume of virus mixture containing 100 TCID 50 , place it in an incubator at 37°C for 1 h. Then, digest the confluent LT cells and add them to the 96-well plate. After 6 days, judge the results and calculate the neutralization titer using the Reed and Mench method. The results show that LSDVΔTK did not cause adverse reactions after being inoculated into cattle as a vaccine after inactivation, and could produce significant neutralizing antibodies (see Figure 5 ).
[0066] Example 3 Evaluation of the Efficacy of LSDVΔTK in Attenuated Live Vaccines
[0067] Similarly, select 8 Holstein dairy cows with negative LSDV serum, and inoculate subcutaneously with 1 ml of 1×10 7 TCID 50 of LSDVΔTK. After inoculation, observe the clinical symptoms and measure the anorectal temperature daily; collect nasal and eye swabs and anticoagulated blood every other day. Collect whole blood every week and separate the serum for neutralizing antibody determination.
[0068] It can be seen from the body temperature measurement results that after inoculating LSDVΔTK at this dose in the live attenuated vaccine, the inoculated cattle showed a transient increase in body temperature on the 3rd day after inoculation (see Figure 6 ). The results of qPCR detection of viral nucleic acids in swabs and blood showed that viral nucleic acids could not be detected 7 days after vaccination (Table 1). The results of the neutralizing antibody experiment showed that after inoculating LSDVΔTK in the live attenuated vaccine, cattle could produce neutralizing antibodies up to 1:20 times (see Figure 7 ).
[0069] In summary, after inoculating cattle with LSDVΔTK, no obvious side effects occurred. Cattle could clear the virus in a short time and produce a good level of neutralizing antibodies.
[0070] Table 1 Detection of nucleic acid viruses
[0071]
Claims
1. A mutant lumpy skin disease virus strain LSDVΔTK(N), deposit number: CCTCC NO: V202314, depository institution name: China Center for Type Culture Collection. The sequence of ΔTK of the mutant lumpy skin disease virus strain LSDVΔTK(N) is as shown in SEQ ID NO:
1.
2. Use of the mutant lumpy skin disease virus strain LSDVΔTK(N) according to claim 1 in the preparation of a lumpy skin disease vaccine.
3. A vaccine composition containing the mutant lumpy skin disease virus strain LSDVΔTK(N) according to claim 1, wherein the vaccine composition contains an immunoadjuvant.
Citation Information
Patent Citations
Porcine pseudorabies virus gene deletion attenuated vaccine strain for passage via low temperature of cell and attenuation via drug screening and application thereof
CN106282128A
Construction method of bovine nodular skin disease virus TK gene deleted strain LSDV-TK
CN117384965A