Application of piR-mmu-57256903 in the preparation of drugs for preventing and treating heart diseases caused by anticancer drugs
By overexpressing piR-mmu-57256903 in anticancer drugs, histone demethylation transferase is regulated, and the cardiac toxicity problems caused by anticancer drugs are solved, cardiac function is improved and new prevention and treatment methods are provided.
Patent Information
- Application Number
- CN202310473199.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-04-27
- Publication Date
- 2025-09-05
- Estimated Expiration
- 2043-04-27
AI Technical Summary
Existing anti-cancer drugs such as doxorubicin often cause cardiotoxicity problems during the treatment process, especially myocardial injury and heart failure, and lack effective prevention and treatment methods.
piR-mmu-57256903 is used as a target, and the expression of histone demethylation transferase is regulated by overexpressing piR-mmu-57256903 by reagents such as recombinant adeno-associated viruses or extracellular vesicles enriched with piR-mmu-57256903, affecting the expression of antigenized proteins, thereby improving cardiac function.
piR-mmu-57256903 significantly improves the heart function after the administration of anti-cancer drugs, reduces cardiac fibrosis and cardiomyocyte apoptosis, and provides new cardioprotection drug strategies, providing new ways to diagnose and treat myocardial injury and heart failure.
Smart Images

Figure CN116574798B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the use of piR-mmu-57256903 in the preparation of drugs for preventing and treating heart diseases caused by anticancer drugs. Background Art
[0002] Doxorubicin (Dox) is a potent anticancer chemotherapy drug widely used to treat various hematological malignancies and solid sarcomas. However, increasing evidence suggests that the clinical use of Dox can also produce significant cardiotoxicity in a dose-dependent manner, such as heart failure and dilated cardiomyopathy. The molecular mechanisms involved in Dox cardiotoxicity are multifactorial, including increased reactive oxygen species, DNA damage, and cell apoptosis. Because cancer patients are at increased risk of cardiotoxicity after doxorubicin treatment, there is an urgent need to explore new drugs and strategies to prevent and treat Dox-induced cardiomyopathy.
[0003] PIWI-interacting RNA (piRNA) is a recently discovered class of small, non-coding RNAs (24-30 nt in length) that interact with Piwi proteins. piRNAs play a crucial role in maintaining reproductive system and stem cell function. Summary of the Invention
[0004] The purpose of the present invention is to provide piR-mmu-57256903 as a target for use in the preparation of drugs for preventing and treating heart diseases caused by the administration of anticancer drugs, increase the medical use of piR-mmu-57256903, and provide cardioprotective drugs for clinical tumor treatment.
[0005] The present invention provides piR-mmu-57256903 as a target in the preparation of anticancer drugs for preventing and treating heart diseases caused by administration.
[0006] Preferably, the anticancer drug comprises doxorubicin, epirubicin or mitoxantrone.
[0007] Preferably, the heart disease includes myocardial damage and / or heart failure.
[0008] Preferably, the drug includes an agent that overexpresses piR-mmu-57256903.
[0009] Preferably, the reagent for overexpressing piR-mmu-57256903 includes a piR-mmu-57256903 overexpression vector.
[0010] Preferably, the initial vector of the piR-mmu-57256903 overexpression vector includes an adeno-associated virus or a lentiviral vector.
[0011] Preferably, the adeno-associated virus includes AAV9; and the lentiviral vector includes GV229.
[0012] Preferably, the piR-mmu-57256903 overexpression vector comprises a piR-mmu-57256903 recombinant adeno-associated virus or an extracellular vesicle enriched with piR-mmu-57256903;
[0013] The titer of the piR-mmu-57256903 recombinant adeno-associated virus was 1×10 11 ~1×10 13 Viral genomes / mL;
[0014] The concentration of the piR-mmu-57256903-enriched extracellular vesicles was 40 μg / mL.
[0015] The present invention also provides a drug for preventing and treating heart diseases caused by administration of anticancer drugs, wherein the drug comprises a reagent for overexpressing piR-mmu-57256903 and pharmaceutically acceptable excipients.
[0016] Preferably, the reagent for overexpressing piR-mmu-57256903 comprises a piR-mmu-57256903 recombinant adeno-associated virus or an extracellular vesicle enriched with piR-mmu-57256903, and the titer of the piR-mmu-57256903 recombinant adeno-associated virus is 1×10 11 ~1×10 13 viral genomes / mL; the concentration of the piR-mmu-57256903-enriched extracellular vesicles was 40 μg / mL.
[0017] Beneficial effects:
[0018] The present invention provides piR-mmu-57256903 as a target for the preparation of cardiac diseases caused by the administration of anticancer drugs. The piR-mmu-57256903 can cause transcriptional activation of downstream target genes by regulating the expression and activity of histone demethylation transferases, thereby affecting the expression of antigenic proteins, and playing an important role in promoting pathological processes related to oxidative stress and cell apoptosis. Based on this principle, the present invention uses piR-mmu-57256903 as a target to prevent and treat various cardiac diseases caused by the administration of anticancer drugs, improve cardiac function, and provide cardiac protection for cancer patients after the administration of anticancer drugs. At the same time, it also provides new drug development approaches and drug action targets for the diagnosis and treatment of heart failure or myocardial damage after drug treatment in cancer patients, and has very important medicinal value. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments are briefly introduced below.
[0020] Figure 1 This is a schematic diagram showing the principle of using piR-mmu-57256903 as a target in the preparation of a method for preventing and treating heart disease caused by administration of anticancer drugs in Example 2;
[0021] Figure 2 This is the echocardiographic test result of overexpressing piR-mmu-57256903 to interfere with the cardiac function of Dox-administered mice in Test Example 1;
[0022] Figure 3 The results of RT-qPCR animal level verification of AAV9-piR6903 efficiency in Test Example 2;
[0023] Figure 4 This is the GV229 vector map in Example 3;
[0024] Figure 5 The process of enriching piR-mmu-57256903 extracellular vesicles in Example 3 and the related characterization results of enriching piR-mmu-57256903 extracellular vesicles in Test Example 3;
[0025] Figure 6 The immunofluorescence Tunel staining in Test Example 3 was used to detect the effect of piR-6903-enriched extracellular vesicles on Dox-induced cardiomyocyte apoptosis. DETAILED DESCRIPTION
[0026] The present invention provides piR-mmu-57256903 as a target in the preparation of anticancer drugs for preventing and treating heart diseases caused by administration.
[0027] In the present invention, the sequence of the piR-mmu-57256903 is preferably as shown in SEQ ID NO. 1, specifically 5'-TGCTGGTGGTGGGGAGTAGCTCCTTCTTCT-3'.
[0028] The anticancer drug of the present invention preferably includes doxorubicin, epirubicin, or mitoxantrone, more preferably doxorubicin. The heart disease of the present invention preferably includes myocardial injury and / or heart failure, more preferably myocardial injury and heart failure. The myocardial injury of the present invention preferably includes cardiac fibrosis and / or myocardial cell apoptosis.
[0029] In the present invention, the drug includes an agent for overexpressing piR-mmu-57256903. The agent for overexpressing piR-mmu-57256903 preferably includes a piR-mmu-57256903 overexpression vector. The piR-mmu-57256903 described in the present invention is a newly discovered class of non-coding small RNAs with a unique biological formation process. The promoter used in the overexpression strategy is a non-U6 promoter.
[0030] The initial vector in the piR-mmu-57256903 overexpression vector of the present invention preferably includes an adeno-associated virus or a lentiviral vector.
[0031] The adeno-associated virus of the present invention preferably includes AAV9, more preferably a pHBAAV-cTNT-MCS-lightless vector. The present invention preferably inserts the piR-mmu-57256903 between EcoRI and HindIII of the pHBAAV-cTNT-MCS-lightless vector. When preparing the piR-mmu-57256903 recombinant adeno-associated virus of the present invention, it is preferred that a promoter and a transcription enhancing element be added upstream of piR-mmu-5725690. The nucleotide sequence of the piR-mmu-5725690 to which the promoter and transcription enhancing element are added is preferably 5'-AAGGTATATTGCTGTTGACAGTGAGCGTGCTGGTGGTGGGGAGTAGCTCCTTCTTCTTAGTGAAGCCACAGATGTAAGAAGAAGGAGCTACTCCCCACCACCAGCATGCCTACTGCCTCG-3' (SEQID NO.2).
[0032] When the initial vector is an adeno-associated virus, the piR-mmu-57256903 overexpression vector of the present invention is a piR-mmu-57256903 recombinant adeno-associated virus. The titer of the piR-mmu-57256903 recombinant adeno-associated virus of the present invention is preferably 1×10 11 ~1×10 13 GC / mL, more preferably 1×10 13 GC / mL. The present invention does not specifically limit the packaging process of the piR-mmu-57256903 recombinant adeno-associated virus, and conventional packaging methods in the art can be used. The present invention does not specifically limit the source of the piR-mmu-57256903, and it can be obtained by chemical synthesis or biological metabolism.
[0033] The lentiviral vector of the present invention preferably comprises GV229, wherein the element sequence of the GV229 is preferably H1-MCS-CMV-Puromycin. The present invention preferably inserts the piR-mmu-57256903 between AgeI and EcoRI of the GV229 to produce a piR-mmu-57256903 recombinant lentivirus containing the piR-mmu-57256903.
[0034] When the initial vector is a lentiviral vector, the piR-mmu-57256903 overexpression vector of the present invention is an extracellular vesicle enriched with piR-mmu-57256903. The extracellular vesicle enriched with piR-mmu-57256903 of the present invention contains piR-mmu-57256903. The concentration of the extracellular vesicle enriched with piR-mmu-57256903 of the present invention is preferably 40 μg / mL, more preferably 10 10 pieces / mL.
[0035] The present invention preferably constructs a 293T cell line stably expressing the piR-57256903, and obtains the extracellular vesicles enriched in piR-57256903 by separating the supernatant.
[0036] The present invention also provides a drug for preventing and treating heart diseases caused by administration of doxorubicin, wherein the drug comprises a reagent for overexpressing piR-mmu-57256903 and pharmaceutically acceptable excipients.
[0037] The reagent for overexpressing piR-mmu-57256903 of the present invention preferably includes a piR-mmu-57256903 recombinant adeno-associated virus or an extracellular vesicle enriched with piR-mmu-57256903. The titer of the piR-mmu-57256903 recombinant adeno-associated virus of the present invention is preferably 1×10 11 ~1×10 13 GC / mL, more preferably 1×10 13 The concentration of the enriched piR-mmu-57256903 extracellular vesicles of the present invention is preferably 40 μg / mL, more preferably 10 10 The dosage of the reagent for overexpressing piR-mmu-57256903 in the drug of the present invention is preferably 1×10 12 GC.
[0038] The excipients of the present invention preferably include one or more of a buffer, an encapsulating agent, a filler, an adhesive, a transdermal absorbent, a wetting agent, a disintegrant, an absorption enhancer, a surfactant, a colorant, a flavoring agent, and an adsorption carrier. More preferably, the corresponding excipient is selected according to the dosage form of the drug. The dosage form of the drug of the present invention preferably includes tablets, powders, granules, capsules, decoctions, oral solutions, injections, or suppositories, and more preferably includes injections.
[0039] In order to further illustrate the present invention, the technical solution provided by the present invention is described in detail below with reference to the accompanying drawings and embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0040] Example 1
[0041] 1. Construction of piR-mmu-57256903 recombinant adeno-associated virus, the steps are as follows:
[0042] A synthetic fragment of piR-mmu-57256903 (hereinafter referred to as piR6903) with a promoter and transcription enhancer element was prepared, with the specific sequence being 5′-AAGGTATATTGCTGTTGACAGTGAGCGTGCTGGTGGTGGGGAGTAGCTCCTTCTTCTTAGTGAAGCCACAGATGTAAGAAGAAGGAGCTACTCCCCACCACCAGCATGCCTACTGCCTCG-3′ (SEQ ID NO. 2).
[0043] 1) Initial vector digestion
[0044] Mix pHBAAV-cTNT-MCS-light-free vector according to the system described in Table 1, gently pipette to mix, and place in a 37°C water bath for 1-2 hours. After the enzyme digestion is completed, perform agarose gel electrophoresis to recover the target fragment.
[0045] Table 1 Vector enzyme digestion system
[0046]
[0047] 2) Acquisition of synthetic fragments of piR6903
[0048] The nucleotide sequence of the forward primer (AAV-piR603-F) for preparing piR6903 was: 5'-ACAgaattcAAGGTATATTGCTGTTGACAGTGCTGGTGGTGGGGAGTAGCTCCTTCTTCTTAGTGAAACA-3' (SEQ ID NO. 3); the nucleotide sequence of the reverse primer (AAV-piR603-R) was: 5'-ACAaagcttCGAGGCGGCATGCTGGTGGTGGGGAGTAGCTCCTTCTTCTTACATCTGTGGCTTCACTAAGAAGAA-3' (SEQ ID NO. 4). The amplification system is shown in Table 2, where the template DNA in Table 2 was derived from mouse cells or organs. The amplification procedure is shown in Table 3.
[0049] Table 2 PCR amplification system for preparing synthetic fragments of piR6903
[0050] Component name Volume (μL) 2×PCR Buffer 25 dNTPs mix (10mM each) 1 Positive-strand nucleotides (10 μM) 2 Anti-strand nucleotides (10 μM) 2 Template DNA (200 ng / μL) 1 <![CDATA[ddH2O]]> 18 Phanta Super-Fidelity DNA Polymerase 1 Total volume 50
[0051] Table 3 PCR amplification procedure for preparing piR6903
[0052]
[0053]
[0054] 3) Connect the target fragment to the vector
[0055] Refer to the instructions of Hanbio Bio's HB infusionTM one-step cloning kit to prepare the ligation system and ligation;
[0056] E. coli was then transformed, and the target strain was screened using resistance-free LB medium. The strain was then sent to Qingke for sequencing. Plasmid extraction was performed using a nucleic acid extraction kit to obtain the piR6903 recombinant adenovirus (hereinafter referred to as AAV9-piR6903). Sequencing results were consistent with the target sequence, indicating that the recombinant adenovirus AAV9-piR6903 was successfully constructed. The titer of the constructed AAV9-piR6903 was 1.0×10 13 CG / mL.
[0057] Example 2
[0058] 1. Animal Grouping and Model Establishment
[0059] Forty adult male rats purchased from Beijing Weitonglihua Experimental Animal Technology Co., Ltd. were equally divided into an adriamycin-treated (Dox) group (experimental group) and a normal saline group (control group);
[0060] Experimental group: Dox powder was prepared into a 0.5 mg / mL stock solution using normal saline. A sterile syringe was used to continuously inject 4-5 times at a dose of 5 mg / kg / week, with a cumulative injection volume of 25 mg / kg. After the injection, dynamic cardiac ultrasound examination was performed to evaluate cardiac function.
[0061] Control group: injected with an equal volume of normal saline, and other operations were the same as those of the experimental group.
[0062] 2. Tail Vein Injection of AAV9
[0063] The control group and experimental group mice were randomly divided into two groups, namely saline+AAV9-control (AAV9-Ctr), saline+AAV9-piR6903, Dox+AAV9-Ctr, and Dox+AAV9-piR6903 groups. One week before the treatment in step 1, the mice in each group were placed on the tail vein syringe and the tails of the mice were disinfected with alcohol. The saline+AAV9-piR6903 and Dox+AAV9-piR6903 groups were injected with 1×10 13 100 μL of AAV9-piR6903 obtained in Example 1 was injected at a dose of μg / mL. The principle diagram is shown in FIG. Figure 1 As shown;
[0064] The saline+AAV9-Ctr and Dox+AAV9-Ctr groups were injected with 1×10 13 Inject AAV9-Ctr (AAV9 virus carrying pHBAAV-cTNT-MCS-lightless vector) at a dose of 1 μg / mL. After the injection, use cotton wool to stop bleeding and place the mice in the cage. Perform the treatment in step 1 above for the experimental group mice.
[0065] Test Example 1
[0066] After the treatment in Example 2, mice were anesthetized with 1.5% to 2% isoflurane and the cardiac function of the four groups of mice in Example 2 was evaluated using a Visual Sonics 2100 small animal ultrasound imaging system at a frequency of 30 MHz. B-mode and M-mode images were acquired, and the ejection fraction (EF) and fractional shortening (FS) of the cardiac ultrasound were measured to evaluate the systolic function of the mice. Each indicator was measured three times and the average was taken to evaluate the cardiac function of the mice. The results are shown in FIG. Figure 2 As shown. Among them, Figure 2A in the middle is a representative image of mouse cardiac ultrasound; B is the statistical results of mouse EF, which include the saline+AAV9-Ctr, saline+AAV9-piR6903, Dox+AAV9-Ctr, and Dox+AAV9-piR6903 groups from left to right, with ejection fractions of 60.0%, 63.8%, 44.4%, and 63.0%, respectively; C is the statistical results of mouse FS, which include the saline+AAV9-Ctr, saline+AAV9-piR6903, Dox+AAV9-Ctr, and Dox+AAV9-piR6903 groups from left to right, with fractional shortening of 31.5%, 33.8%, 21.2%, and 32.8%, respectively. *** indicates p<0.001.
[0067] according to Figure 2 It can be concluded that overexpression of piR-mmu-57256903 can significantly improve cardiac function after doxorubicin administration.
[0068] Test Example 2
[0069] After the treatment of Example 2, RNA from the tissues of the experimental mice was extracted using the Trizol method, and the total RNA was reverse transcribed using the RevertAiFirst Strand cDNA Synthesis Kit (Thermo Scientific #K1622). The cDNA was quantified by real-time fluorescence quantitative polymerase chain reaction (qPCR) in a LightCycler480II (Roche) using the stem-loop method using iTaq Universal SYBR Green Supermix (Bio-Rad #1725121 / -20°C). The primers used were purchased from Ruibo Bio. 5S (purchased from Ruibo Bio) was used as an internal reference to detect the relative expression of piR-mmu-57256903. All qPCR reactions were repeated 5 times, and the signal was collected at the end of each cycle. -ΔΔCt The relative expression level was calculated by the method. The statistical graph of the detection results is shown in Figure 3 .
[0070] according to Figure 3 It can be concluded that the relative expression level of piR-6903 in the heart tissue of mice in the AAV9-piR6903 group increased by 2.4 times compared with that in the AAV9-Ctr group, indicating that AAV9-piR6903 effectively enhanced the cardiac expression of piRNA. *** indicates p < 0.001.
[0071] Example 3
[0072] 1. Construction of piR6903 recombinant adenolentivirus, the steps are as follows:
[0073] Shanghai GeneCare Gene Medical Technology Co., Ltd. was commissioned to construct the piR6903 recombinant adenolentivirus. The vector information is as follows:
[0074] 1) Vector name: GV229; element sequence: H1-MCS-CMV-Puromycin; cloning site: Age I / EcoR I; the control is a scramble empty vector with the insert sequence: 5'-TTCTCCGAACGTGTCACGT-3' (SEQ ID NO. 5); the vector map is as follows Figure 4 shown.
[0075] 2) Acquisition of a synthetic fragment of piR-mmu-57256903 (hereinafter referred to as piR6903)
[0076] The nucleotide sequence of the forward primer piR6903(64188-1)-P1 for preparing piR6903 was: 5'-ccggTG CTGGTGGTGGGGAGTAGCTCCTTCTTCTttttttg-3' (SEQ ID NO. 6); the nucleotide sequence of the reverse primer piR-mmu-57256903(64188-1)-P2 was: 5'-aattcaaaaaaAGAAGAAGGAGCT ACTCCCCACCACCAGCA-3' (SEQ ID NO. 7).
[0077] The primers contain exchange pairing bases, restriction enzyme cutting sites, and partial sequence of the 5' end of the target gene for PCR fishing of the target gene, and piR6903(64188-1)-P1 and piR6903(64188-1)-P2 are used for annealing.
[0078] 2) Sequencing results and analysis of positive recombinant clones
[0079] Sequencing results: 5'-CAAAATTTTCGGGTTTTACAGGGACAGCAGAGATCCA GTTTGGTTAGTAACCGGGCCCGTCCTAGACTCGAGATATTTGCATGTCGCTATGTGTTCTGGGAAATCACCATAAACGTGAAATGTCTTTTGGATTTGGGAATCTTATAAGTTCTGTATGAGACCACTC ACCGG TGCTGGTGGTGGGGAGTAGCTCCTTCTTCTTTTTTT GAATTCGGATCCATTAGGCGGCCGCGTGGATAACCGTATTACCGCCATGCATTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTT-3' (SEQ ID NO. 8).
[0080] The alignment result was correct, indicating that the piR6903 recombinant adenolentivirus (hereinafter referred to as piR-6903 plasmid) was constructed.
[0081] 2. Preparation of piR6903-enriched extracellular vesicles. The construction steps are as follows: Figure 5 As shown in A.
[0082] 1) Host 293T cells were passaged into six-well plates and cultured to a cell density of 70%-80%;
[0083] 2) Prepare cell transfection reagent solution A: Add 4 μg of piR-6903 plasmid to 500 μL of serum-free culture medium, mix gently, and let stand for 5 minutes;
[0084] 3) Prepare cell transfection reagent solution B: add 8 μL of Lipo2000 transfection reagent to 500 μL of serum-free culture medium, mix gently, and let stand for 5 minutes;
[0085] 4) Gently mix the cell transfection solution A and solution B and let it stand at room temperature for 15-20 minutes;
[0086] 5) Remove the old cell culture medium from the cell plate and add 1 mL of serum-free culture medium to each well. After standing for a while, add 1 mL of mixed plasmid transfection reagent.
[0087] 6) Replace the culture medium with normal medium after 6-8 hours;
[0088] 7) After 48 hours, add puromycin (Puro, 1 μg / mL) to remove cells that have not been transformed with the plasmid, and observe the cell status after 24 hours;
[0089] 8) Maintaining an appropriate puro concentration until no floating dead cells are found after the addition of puro and the cells grow normally, thereby obtaining a 293T stable transgenic line stably overexpressing piR-6903, designated 293T-EPPIR;
[0090] 9) Expand the cells in the six-well plate into a culture dish and continue culturing with normal culture medium containing Puro.
[0091] 10) The 293T stable transfectant stably overexpressing piR-6903 prepared in step 9) was collected and the supernatant of the cell culture was subjected to ultracentrifugation. The specific steps included: centrifugation at 500g for 5 minutes; centrifugation at 3000g for 10 minutes; centrifugation at 12000g for 45 minutes; the supernatant was filtered using a 0.22μm filter, and the filtered supernatant was centrifuged at 100000g for 70 minutes. The above centrifugation was performed at 4°C to obtain extracellular vesicles enriched with piR-mmu-57256903, which were recorded as EVs-EPPIR-OE. The specific process is as follows: Figure 5 As shown in A.
[0092] Test Example 3
[0093] 1. Using the 293T stable transfectant containing the control plasmid as the control group, the 293T stable transfectant stably overexpressing piR-6903 prepared in step 9) of Example 3 was subjected to fluorescence quantitative PCR detection, with the internal reference gene being 5s, and the steps were as follows:
[0094] 1) A fluorescence quantitative PCR reaction system was prepared according to the following reaction system, as shown in Table 4 (two replicates for each sample), and fluorescence quantitative PCR detection was performed; the sequence of the specific sense primer was 5'-TGCTGGTGGTGGGGAGTAGCTCCTT-3' (SEQ ID NO. 9).
[0095] Table 4 Fluorescence quantitative PCR reaction system
[0096]
[0097] 2) After the configuration is complete, the fluorescent quantitative PCR reaction can be performed according to the following reaction procedure as shown in Table 5;
[0098] Table 5 Fluorescence quantitative PCR reaction procedure
[0099]
[0100]
[0101] 5) The relative quantitative method was used for experimental analysis, which can reflect the relative expression of the target gene in each experimental group relative to the control group. After taking the average value of the parallel repetitions, the expression of the target gene in each experimental group was analyzed by 2 -ΔΔCt Calculation was performed, where ΔCt = target gene Ct value - internal reference Ct value, ΔΔCt = ΔCt value of each group including the control group - average ΔCt value of the control group. Figure 5 As shown in B.
[0102] Depend on Figure 5In B, it can be concluded that the stable cell line was successfully constructed and stably overexpressed piR-6903
[0103] 2. The 293T stable transfected strain containing the control plasmid was used as the control group (Ctr) to detect the enrichment efficiency of the piR-6903 extracellular vesicles prepared in Example 3 using real-time fluorescence quantitative PCR. The internal reference gene was U6. The results are as follows: Figure 5 As shown in C;
[0104] Depend on Figure 5 It can be concluded from Figure C that piR-6903 was successfully enriched in extracellular vesicles isolated from the stable transfectant.
[0105] 3. Nanoparticle tracking analysis technology was used to detect the size and concentration of piR-6903 enriched extracellular vesicles. The results are as follows: Figure 5 As shown in D:
[0106] Depend on Figure 5 From C to D, we can conclude that this example successfully obtained extracellular vesicles stably enriched with piR-6903.
[0107] 4. Immunofluorescence Tunel staining was used to detect the effect of piR-6903-enriched extracellular vesicles on Dox-induced cardiomyocyte apoptosis. The steps are as follows:
[0108] (1) Construction of cell model: Primary neonatal rat cardiomyocytes were obtained, cultured overnight, and then added with doxorubicin (final concentration 0.3 μM) and kept in the dark for 24 h.
[0109] (2) Perform Tunel staining on the cell model in step (1) as follows
[0110] 1) Remove the culture medium from the cells and wash with 1× PBS;
[0111] 2) Fix with 4% paraformaldehyde at room temperature for 30 min, then wash three times with 1× PBS for 5 min each;
[0112] 3) Permeabilization with 0.5% Triton X-100 for 20 min, followed by washing with 1× PBS three times for 5 min each;
[0113] 4) Block with 5% BSA at room temperature for 1 hour;
[0114] 5) Incubate with primary antibody: α-actinin (1:200) in 5% BSA, shake slowly at 4°C overnight;
[0115] 6) Wash the cell plate with 1× PBS three times for 5 min each;
[0116] 7) Incubation with secondary antibody: prepare CY3 mouse secondary antibody at 1:200 in 5% BSA and incubate in a shaker at room temperature in the dark for 2 h.
[0117] 8) Protect the cell plate from light and wash with 1× PBS three times for 5 min each.
[0118] 9) Cell equilibration: Dilute 5× Equilibration Buffer with ddH2O to 1× Equilibration Buffer, add 100 μL per well, and equilibrate at room temperature for 10-30 minutes.
[0119] 10) Prepare the Tunel reaction solution in the dark, as shown in Table 6:
[0120] Table 6 Preparation of Tunel reaction solution formula
[0121]
[0122] 50 μL per well, incubate at 37°C in the dark for 1 h;
[0123] 11) Protect the cell plate from light and wash with 1× PBS three times for 5 min each.
[0124] 12) Incubate with nuclear dye: prepare 1:2000 Hoechst in 5% BSA and incubate at room temperature in the dark for 20 minutes;
[0125] 13) Protect the cell plate from light and wash with 1× PBS three times for 5 min each.
[0126] 14) Perform immunofluorescence photography.
[0127] The results are as follows Figure 6 shown.
[0128] Depend on Figure 6 It can be concluded that extracellular vesicles enriched with piR-6903 can effectively reduce doxorubicin-induced cardiomyocyte apoptosis.
[0129] From the above examples, it can be concluded that the reagent overexpressing piR-mmu-57256903 can improve cardiac function after doxorubicin administration, reduce cardiac fibrosis after doxorubicin administration, and inhibit myocardial cell apoptosis after doxorubicin administration, providing a new preventive and therapeutic drug development approach and drug target for the diagnosis and treatment of doxorubicin-induced cardiac damage and / or heart failure.
[0130] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.
Claims
1. Use of a reagent that overexpresses piR-mmu-57256903 in the preparation of a drug for treating heart disease induced by the anticancer drug doxorubicin; The heart disease is myocardial damage; The reagent for overexpressing piR-mmu-57256903 is a piR-mmu-57256903 overexpression vector; the nucleotide sequence of the piR-mmu-57256903 is shown in SEQ ID NO.
1.
2. The use according to claim 1, characterized in that The heart disease is heart failure.
3. The use according to claim 1, characterized in that The initial vector of the piR-mmu-57256903 overexpression vector is an adeno-associated virus or a lentivirus vector.
4. The use according to claim 3, characterized in that The adeno-associated virus is AAV9; the lentiviral vector is GV229.
5. The use according to claim 1, characterized in that The piR-mmu-57256903 overexpression vector is a piR-mmu-57256903 recombinant adeno-associated virus or an extracellular vesicle enriched with piR-mmu-57256903.
6. The use according to claim 5, characterized in that The titer of the piR-mmu-57256903 recombinant adeno-associated virus was 1×10 11 ~1×10 13 Viral genomes / mL; The concentration of the piR-mmu-57256903-enriched extracellular vesicles was 40 μg / mL.