Arginine deiminase mutant T203G with improved enzyme activity
By performing site-directed mutation of austenothermophila arginine deiminase, the catalytic efficiency of the enzyme is improved, the problem of low enzyme activity in the existing ADI is solved, and more efficient citrulline production and anti-tumor drug preparation are achieved.
Patent Information
- Application Number
- CN202310776976.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-03-30
- Publication Date
- 2025-08-26
- Estimated Expiration
- 2042-03-30
AI Technical Summary
The existing arginine deiminase (ADI) exhibits low specific enzyme activity, becoming its technical bottleneck in citrulline production and limiting its application in the biomanufacturing of functional food ingredients.
By performing site-directed mutations of arginine deiminase from the Austenitic Salt Salvia, specifically including mutating aspartic acid at the 116th, threonine at the 203th, alanine at the 103th, threonine at the 32th or glycine at the 345th, mutants N116G, T203G, A103Y, T32Y, G345A, to improve the catalytic efficiency of the enzyme.
The mutation of arginine deiminase enzyme activity increased by 1.47-2.11 times, maintaining moderate pH conditions, and is suitable for amino acid production and anti-tumor drug preparation.
Smart Images

Figure CN116590264B_ABST
Abstract
Description
[0001] This application is a divisional application of application number 202210329069.3, application date March 30, 2022, and invention name “Arginine deiminase mutant with improved enzyme activity”. Technical Field
[0002] The invention relates to an arginine deiminase mutant T203G with improved enzyme activity, belonging to the technical fields of genetic engineering and enzyme engineering. Background Art
[0003] Arginine deiminase (EC 3.5.3.6), abbreviated as ADI, hydrolyzes arginine to produce citrulline and ammonia, making it useful in citrulline production. Arginine deiminase has a wide range of microbial sources. Since its initial discovery in 1933, it has been found in Streptococcus lactis, Streptococcus faecalis, yeast, Pseudomonas, Mycoplasma, Halobacterium, and some eukaryotic cells. ADI from different microbial sources exhibits significant differences in its molecular weight range, optimal pH, and optimal temperature, among other enzymatic properties.
[0004] Currently, ADI is primarily being studied for the production of citrulline. Its advantages, such as mild reaction conditions, high conversion efficiency, and simple extraction process, make it highly valuable for research and production. However, most ADIs reported to date exhibit low specific enzymatic activity, which has become a technical bottleneck for their industrial application. Therefore, the search for arginine deiminase with higher catalytic efficiency, safety, and stability has become a key issue for its use in the biomanufacturing of functional food ingredients. Summary of the Invention
[0005] The present invention provides an arginine deiminase mutant modified by site-directed mutagenesis, which is obtained by using the arginine deiminase gene accession number of Halothermothrix orenii: NC_011899.1:720621-721853, and the nucleotide sequence is shown in SEQ ID NO.1, and is obtained by using site-directed mutagenesis technology.
[0006] In one embodiment, the mutant is a mutant in which aspartic acid at position 116, threonine at position 203, alanine at position 103, threonine at position 32 or glycine at position 345 of the starting enzyme is mutated.
[0007] In one embodiment, the mutant is obtained by mutating the aspartic acid at position 116 of the starting enzyme to glycine, thereby obtaining the mutant N116G, the amino acid sequence of which is shown in SEQ ID NO.2.
[0008] In one embodiment, the mutant is obtained by mutating the threonine at position 203 of the starting enzyme to glycine, thereby obtaining the mutant T203G, the amino acid sequence of which is shown in SEQ ID NO.3.
[0009] In one embodiment, the mutant is obtained by mutating the 103rd alanine of the starting enzyme to tyrosine, to obtain the mutant A103Y, the amino acid sequence of which is shown in SEQ ID NO.4.
[0010] In one embodiment, the mutant is obtained by mutating the threonine at position 32 of the starting enzyme to tyrosine, thereby obtaining the mutant T32Y, the amino acid sequence of which is shown in SEQ ID NO.5.
[0011] In one embodiment, the mutant is obtained by mutating the glycine at position 345 of the starting enzyme to alanine, thereby obtaining the mutant G345A, the amino acid sequence of which is shown in SEQ ID NO.6.
[0012] The present invention also provides a gene encoding the mutant.
[0013] In one embodiment, the nucleotide sequence of the gene is shown as SEQ ID NOs. 7 to 11.
[0014] The invention also provides a recombinant plasmid carrying the gene.
[0015] In one embodiment, the recombinant plasmid includes but is not limited to pET series plasmids.
[0016] The present invention also provides a recombinant microbial cell expressing the mutant.
[0017] In one embodiment, the recombinant microbial cell includes, but is not limited to, bacteria or fungi.
[0018] In one embodiment, the microorganism is Escherichia coli.
[0019] In one embodiment, the Escherichia coli uses Escherichia coli BL21 (DE3) as a host and pET-28a as a vector to express the arginine deiminase mutant.
[0020] The present invention also provides a method for improving the activity of arginine deiminase, wherein the method comprises mutating aspartic acid at position 116, threonine at position 203, alanine at position 103, threonine at position 32 or glycine at position 345 of the arginine deiminase derived from Halothermothrix orenii.
[0021] In one embodiment, the method is to mutate the aspartic acid at position 116 of the arginine deiminase derived from Thermomyces ostreatus to glycine, or mutate the threonine at position 203 to glycine, or mutate the alanine at position 103 to tyrosine, or mutate the threonine at position 32 to tyrosine, or mutate the glycine at position 345 to alanine.
[0022] The present invention also provides a method for producing an arginine deiminase mutant, which comprises culturing the recombinant Escherichia coli expressing the mutant in an LB culture medium at 30-37° C. for at least 12 hours.
[0023] In one embodiment, the method further induces the recombinant E. coli; the induction is to culture the recombinant E. coli to an OD of 600 In the range of 0.5-0.7, 0.5 mmol / L IPTG was added and induced at 28°C and 200 r / min for 6 h.
[0024] The present invention also provides the use of the arginine deiminase mutant in the production of amino acids or the preparation of anti-tumor drugs.
[0025] Beneficial Effects: The arginine deiminase mutants provided by the present invention exhibit significantly improved enzymatic activity compared to the wild-type enzyme. The mutant enzymes maintain a moderate pH and exhibit activity levels of 135.8 U / mg, 154.9 U / mg, 158.7 U / mg, 163.0 U / mg, and 194.1 U / mg, representing increases of 1.47-2.11 times compared to the wild-type enzyme. This invention optimizes and improves the low activity of the wild-type arginine deiminase, creating better conditions for the enzyme's practical application. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] Figure 1 This is the construction map of the recombinant plasmid.
[0027] Figure 2 is the relative enzymatic activity of the wild-type enzyme WT and the mutant enzyme. DETAILED DESCRIPTION
[0028] Materials and reagents: The restriction endonucleases, Solution I ligase, and PCR reagents used were purchased from TaKaRa Biotechnology Co., Ltd.; plasmid extraction kits, genome extraction kits, agarose purification kits, E.coil DH5α, E.coil BL21 (DE3) strains, and primers were all purchased from Sangon Biotechnology (Shanghai) Co., Ltd.; other reagents were of analytical grade purchased domestically or abroad.
[0029] Example 1: Design of arginine deiminase mutation sites
[0030] Mutation sites were selected using multiple sequence alignment and the online server HotSpot Wizard (https: / / loschmidt.chemi.muni.cz / hotspotwizard / ). The arginine deiminase protein structure was simulated using SWISS-MODEL software to obtain a tertiary structural model. The amino acid sites identified for mutation were aspartic acid at position 116, threonine at position 203, alanine at position 103, threonine at position 32, glycine at position 345, aspartic acid at position 340, and proline at position 398.
[0031] Example 2: Site-directed mutagenesis of arginine deiminase and construction of recombinant plasmid and recombinant Escherichia coli
[0032] Primers were designed based on the gene encoding arcA from Halothermothrix orenii shown in SEQ ID NO.1:
[0033] N116G-F:ATATGGAC GGC GAGACACTTATTCGTAAGATGATGGC;
[0034] N116G-R:TGTCTC GCC GTCCATATCTGCGAAGTACTCCTTT;
[0035] T203G-F:CAAGGAT GGC GAAATCCCCTTCTGGTTTGATCG;
[0036] T203G-R:GGATTTC GCC ATCCTTGAAGTCCGGATGGTACG;
[0037] A103Y-F:TAAGGGG TAT CGTCAAGTCTTAAAGGAGTACTTCGC;
[0038] A103Y-R:CTTGACG ATA CCCCTTACCAATCACACCAGCT;
[0039] T32Y-F:G TAT CCGGACTTACTTGAGCGTCTGTTGTTCG;
[0040] T32Y-R:CAAGTAAGTCCGG ATA CAAATTCTCAATTTCGTGTCCAGG;
[0041] G345A-F:ATTACATCGATGCC GCG CGTGAACAGTGGAACGACGG;
[0042] G345A-R: CGC GGCATCGATGTAATCACCGCCTGCACAGC;
[0043] The underlined parts represent the codons corresponding to the 116th aspartic acid, 203rd threonine, 103rd alanine, 32nd threonine, and 345th glycine encoded by the mutant gene.
[0044] The PCR amplification system is:
[0045]
[0046]
[0047] After PCR amplification, 1 μL of DpnⅠ restriction enzyme (10 U / μL) was added to the reaction solution and incubated at 37°C for 2 hours to eliminate the template. The PCR product was transformed into E.coil DH5α cells, plated, and a single colony was picked into liquid culture medium. The plasmid was extracted and sequenced to obtain the correct mutant plasmid pET-28a-ADI. N116G 、pET-28a-ADI T203G 、pET-28a-ADI A103Y 、pET-28a-ADI T32Y 、pET-28a-ADI G345A The successfully constructed mutant plasmids were transformed into E.coil BL21(DE3) to obtain the mutant strain BL21(DE3) / pET-28a-ADI N116G , BL21(DE3) / pET-28a-ADI T203G , BL21(DE3) / pET-28a-ADI A103Y , BL21(DE3) / pET-28a-ADI T32Y , BL21(DE3) / pET-28a-ADI G345A .
[0048] Example 3: Expression and purification of wild-type and mutant enzymes
[0049] Single colonies of BL21(DE3) / pET-28a-ADI and each mutant strain were picked and cultured in LB medium containing 0.5 mmol / L kanamycin at 37°C and 200 r / min for 12 h. Then, they were transferred to LB medium containing 0.5 mmol / L kanamycin and cultured at 37°C and 200 r / min until OD 600 In the range of 0.5-0.7, 0.5 mmol / L IPTG was added and induced at 28°C and 200 r / min for 6 h.
[0050] After the fermentation broth was centrifuged at 10,000 r / min and 4°C for 10 minutes, the supernatant was discarded and washed twice with phosphate buffer. 15-20 mL of phosphate buffer was added to suspend the bacteria and ultrasonically disrupted for 15 minutes (power 22 W, disruption 1 second, rest 2 seconds). Centrifuged at 4°C and 10,000 r / min for 10 minutes, the supernatant was collected as the crude enzyme solution and filtered with a 0.22 μm pore size aqueous membrane. The results showed that the crude enzyme activity of the wild enzyme was 3.88 U / mL, the crude enzyme activity of N116G was 5.74 U / ml, the crude enzyme activity of T203G was 6.52 U / mL, the crude enzyme activity of A103Y was 6.71 U / mL, the crude enzyme activity of T32Y was 6.89 U / mL, and the crude enzyme activity of G345A was 8.2 U / mL.
[0051] Use Binding Buffer to 2+ Pre-equilibrate the chelating agarose resin column; add crude enzyme solution and equilibrate with Binding Buffer and Washing Buffer respectively; elute the enzyme with Elution Buffer and recover it; dialyze the recovered enzyme solution against dialysis buffer and store it in a refrigerator at 4°C.
[0052] Preparation of buffer solutions involved:
[0053] Phosphate buffer (PB): 50 mmol / L, pH 5.5
[0054] Binding Buffer: 50mmol / L PB, 500mmol / L NaCl, pH 7.0
[0055] Washing Buffer: 50mmol / L PB, 500mmol / L NaCl, pH 7.0, 50mmol / L imidazole
[0056] Elution Buffer: 50mmol / L PB, 500mmol / L NaCl, pH 7.0, 500mmol / L imidazole
[0057] Dialysis buffer: 50 mmol / L PB, pH 7.0, 10 mmol / L EDTA
[0058] Enzyme activity assay conditions: The reaction system consisted of 0.05 mg of purified enzyme, 500 μl of 100 mg / ml arginine solution (pH 6.5), and 50 mM PBS buffer (pH 6.5) to 1 ml. The reaction was incubated at 60°C for 10 min, followed by boiling for 5 min to inactivate the enzyme. After centrifugation, the product was diluted to a desired concentration and assayed by HPLC.
[0059] Enzyme activity definition: Under the reaction conditions, the amount of enzyme required to catalyze the production of 1 μmol of citrulline per minute using arginine as the substrate is one unit of enzyme activity. Under these conditions, the original enzyme activity is defined as 100%, and the percentage of relative enzyme activity is plotted against the mutant species. The results of enzyme activity evaluation are as follows: Figure 2 Compared with the wild enzyme WT of 91.8U / mg, the specific enzyme activities of the mutants were 135.7U / mg for N116G, 154.9U / mg for T203G, 158.7U / mg for A103Y, 163.0U / mg for T32Y, and 194.1U / mg for G345A, while D340P and P398G basically lost their enzyme activity.
[0060] Comparative Example 1:
[0061] According to the same strategy as in Examples 1 to 3, mutants D340P and P398G were constructed, and plasmid pET-28a-ADI was used. D340P 、pET-28a-ADI P398G , and constructed the recombinant bacteria BL21(DE3) / pET-28a-ADI D340P , BL21(DE3) / pET-28a-ADI P398G The recombinant bacteria were cultured in the same manner as in Example 3, and the crude enzyme solution and the specific enzyme activity after purification were detected. The results showed that the crude enzyme activity and specific enzyme activity of D340P and P398G were almost undetectable, indicating that the mutants D340P and P398G had lost their enzyme activity. These two sites are conserved sites and are important residues for the catalytic ability of the enzyme.
[0062] P398G-F: GGC CGTTGCATGAGTATGCCCCTTGTGCGCGA;
[0063] P398G-R:ATACTCATGCAACG GCCGCCTCCGCGTCCACGAGA;
[0064] D340P:GCGGT CCGTACATCGATGCCGGGCGTGAACAG;
[0065] D340P:ATCGATGTA CGG ACCGCCTGCACAGCGAATAA.
[0066] Although the present invention has been disclosed above in terms of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.
Claims
1. An arginine deiminase mutant, characterized in that The amino acid sequence is shown in SEQ ID NO.
3.
2. A gene encoding the mutant according to claim 1.
3. A recombinant plasmid carrying the gene according to claim 2.
4. A recombinant microbial cell expressing the mutant according to claim 1.
5. The recombinant microbial cell according to claim 4, characterized in that The host cell is a bacterium or a fungus.
6. A recombinant Escherichia coli, characterized in that Escherichia coli BL21 (DE3) is used as a host and pET-28a is used as a vector to express the arginine deiminase mutant according to claim 1.
7. A method for improving the activity of arginine deiminase, characterized in that: The threonine at position 203 of the arginine deiminase from the thermophilic Halothrix ostreatus was mutated to glycine, and the sequence after the mutation is shown in SEQ ID NO.
3.
8. A method for producing an arginine deiminase mutant, characterized in that: The recombinant Escherichia coli according to claim 6 is cultured in LB medium at 30-37° C. for at least 12 h.
9. The method according to claim 8, characterized in that The recombinant E. coli was also induced; the induction was to culture the recombinant E. coli to OD 600 In the range of 0.5-0.7, add 0.5 mmol / L IPTG and induce at 25-28℃ for 4-8 h.
10. Use of the arginine deiminase mutant according to claim 1 or the recombinant Escherichia coli according to claim 6 in the production of citrulline.
Citation Information
Patent Citations
Gene engineering arginine deiminase reformed through site directed mutagenesis
CN106591270A
Arginine deiminase mutant with improved enzyme activity and temperature stability and application of mutant
CN106591271A