A lead pollution detection probe and a lead ion detection method

By using lead pollution detection probes and DNAzyme amplification strategies, the problem of complex and expensive lead ion detection in existing technologies has been solved, achieving simple and efficient lead ion detection that is suitable for lead ion detection in real-world environments.

CN116640834BActive Publication Date: 2026-03-03ANHUI MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310724284.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-06-16
Publication Date
2026-03-03
Estimated Expiration
2043-06-16

AI Technical Summary

Technical Problem

Existing lead ion detection methods require specialized technicians to operate expensive laboratory equipment, and the detection process is time-consuming and complex, limiting their application in real-time detection.

Method used

The lead pollution detection probe consists of probe EDP and probe RFP. It combines a DNAzyme and enzyme-assisted amplification strategy to detect lead ions by specifically recognizing them and performing a multiple cascade amplification reaction under isothermal conditions, releasing a fluorescent signal.

Benefits of technology

It achieves low-cost, simple and efficient lead ion detection, and the detection results are close to those of ICP-MS, showing its application potential in real-world environments.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116640834B_ABST
    Figure CN116640834B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of biodetection technology, specifically relating to a lead pollution detection probe and a method for lead ion detection. It consists of a probe EDP and a probe RFP. The probe EDP includes a substrate chain that binds to an RNA base (rA) and an enzyme chain. The probe RFP is a hairpin probe, with a fluorescent group FAM and a quenching group Dabcyl at its stem and a cleavage site for an endonuclease at its loop. The method combines DNAzyme with an enzyme-assisted amplification strategy to detect lead pollution and lead ions. 2+ Low-cost, simple and efficient detection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biological detection technology, specifically relating to a lead pollution detection probe and a lead ion detection method. Background Technology

[0002] Lead (Pb) 2+ Pb is a non-essential metallic element for the human body and is widely distributed in nature. 2+ As a representative of heavy metals, Pb is one of the most polluting metals in the natural environment. Unaffected by biodegradation, it can cause severe metal pollution even at low concentrations, posing a serious threat to environmental safety and human health. Studies have shown that Pb... 2+ Poisoning can cause irreversible damage to the human nervous, cardiovascular, and urinary systems, leading to various human diseases. Therefore, developing a simple, low-cost, and efficient method for [the treatment of] PB [is crucial]. 2+ Detection technology has become a necessity.

[0003] Traditional Pb 2+ Detection methods include atomic absorption spectrometry (AAS), inductively coupled plasma mass spectrometry (ICP-MS), and X-ray fluorescence spectrometry. These methods require specialized technicians, rely on expensive laboratory equipment, and suffer from complex sample pretreatment and long detection times. These drawbacks significantly limit their application in Pb detection. 2+ Applications in real-time detection. Isothermal amplification technology has become a traditional method for detecting Pb due to its simplicity, accuracy, and lack of reliance on expensive, large-scale instruments. 2+ An ideal alternative to detection methods, this is a simple process for rapidly and efficiently accumulating nucleic acid sequences under isothermal conditions. Summary of the Invention

[0004] The purpose of this invention is to provide a lead pollution detection probe and a lead ion detection method that can detect lead ions in a low-cost, simple and efficient manner.

[0005] To achieve the above objectives, the present invention provides the following technical solution:

[0006] This invention discloses a lead contamination detection probe and a lead ion detection method, comprising:

[0007] The lead pollution detection probe consists of a probe EDP and a probe RFP. The probe EDP includes a substrate chain that binds to an RNA base (rA) and an enzyme chain. The probe RFP is a hairpin probe. The stem of the hairpin probe RFP has a fluorescent group FAM and a quenching group Dabcyl, and the loop of the hairpin probe RFP has a recognition site for cleaving endonuclease.

[0008] The lead ion detection method includes the following steps:

[0009] (1) Filter the sample to be tested using a filter;

[0010] (2) The RFP is incubated, slowly cooled, and then placed at room temperature to obtain an RFP with a stable hairpin structure;

[0011] (3) The EDP was mixed in Tris buffer, heated, and then slowly cooled to form an EDP complex;

[0012] (4) Add the filtered sample to be tested described in step (1) to step (3), mix thoroughly, then add the RFP with stable hairpin structure, polymerase, nicking endonuclease, dNTPs solution and buffer solution described in step (2), mix evenly, and place in a constant temperature incubator for incubation. Perform fluorescence detection on the obtained solution, and realize the Pb assay based on the obtained fluorescence signal value. 2+ The detection.

[0013] Furthermore, the sample to be tested is a solution.

[0014] Furthermore, the nucleotide sequence of the substrate chain to which the rA binds is shown below:

[0015] 5'-ATTTAATTTAGCGTCACTAT rA GGAAGAGATGTGT-3';

[0016] The enzyme chain has the following nucleotide sequence:

[0017] 5'-ACACATCTCTGAAGTAGCGCCGCCGTATAGTGACGCTAAATTAAAT-3';

[0018] The probe RFP has the following nucleotide sequence:

[0019] 5'-TTTGTCA / iDabcyldT / AGCTAATGATGTTGAGCTGAGGATTAGCTA / i6FAMdT / GACACATCTCTCC-3'.

[0020] Furthermore, the Tris buffer solution in step (3) contains Tris-HCl, MgCl2, and NaCl; wherein the concentration of Tris-HCl is 10 mM; the concentration of MgCl2 is 10 mM; and the concentration of NaCl is 100 mM.

[0021] Furthermore, the buffer solution mentioned in step (4) is rCutSmart. TM Buffer and K1enow buffer.

[0022] Furthermore, the reaction temperature in the constant temperature incubator described in step (4) is 30°C to 40°C, and the reaction time is 60 to 150 min.

[0023] Furthermore, the wavelength of fluorescence detection in step (4) is 518 nm.

[0024] The beneficial effects of this invention: By combining DNAzyme with an enzyme-assisted amplification strategy, Pb... 2+ This method offers low-cost, simple, and efficient detection of Pb in Chaohu Lake. 2+ Its excellent performance in detection demonstrates its potential for application in detecting lead ions in real-world environments. Attached Figure Description

[0025] Figure 1 This is the data result of the actual application of the present invention to the detection of lead ions in Chaohu Lake and the detection of Chaohu Lake water by ICP-MS. Detailed Implementation

[0026] The present invention will be further illustrated by way of embodiments below, but the present invention is not limited to the scope of the embodiments described herein.

[0027] A lead pollution detection probe consists of a probe EDP and a probe RFP. The probe EDP includes a substrate strand that binds to an RNA base (rA) and an enzyme strand, with a substrate strand to enzyme strand concentration ratio of 1:1.2. The probe EDP can detect lead pollution in Pb. 2+ In its presence, it specifically identifies and captures Pb. 2+ This leads to the cleavage of the EDP substrate chain and the release of free DNA fragments (FPs). The probe RFP is a hairpin probe, with a fluorescent group FAM and a quenching group Dabcyl at its stem and a nicking endonuclease recognition site at its loop. When the EDP and RFP coexist, they do not interfere with each other, and this remains unchanged even after the addition of polymerase and nicking endonuclease. Similarly, individual EDPs and RFPs do not change in the presence of polymerase and nicking endonuclease, allowing for the specific recognition of Pb by the EDP. 2+ The free DNA fragments are released and then form a DNA complex via RFP. With the participation of polymerase and nicking endonuclease, the DNA complex undergoes a series of multiple cascade amplification reactions, releasing a large amount of fluorescent signals, thereby achieving Pb targeting. 2+ The detection.

[0028] Chaohu Lake is divided into three areas, such as Figure 1 a: ① West Lake area, ② East Lake area, and ③ Central Lake area. In addition, water samples were collected from each area twice, in January and September, as targets for testing.

[0029] Lead ions are detected according to the following steps:

[0030] (1) The water from Chaohu Lake was filtered using a filter with a pore size of 0.22 μm to remove solid particles and insoluble matter from the sample;

[0031] (2) Incubate RFP at 90℃ for 5 min, slowly cool it down to 65℃, and then place it at room temperature for 2 h to form a stable hairpin structure.

[0032] (3) Mix EDP in Tris buffer and heat at 95°C for 5 minutes, then slowly cool to 25°C to form an EDP complex.

[0033] (4) Add the filtered Chaohu water from step (1) to step (3), mix thoroughly, then add the RFP with a stable hairpin structure, polymerase, nicking endonuclease, dNTPs solution, and buffer solution from step (2), mix evenly, and place in a constant temperature incubator for incubation. Perform fluorescence detection on the obtained solution, and use the obtained fluorescence signal value to determine the Pb content. 2+ The detection.

[0034] Specifically, the nucleotide sequence of the substrate chain that rA binds to is shown below:

[0035] 5'-ATTTAATTTAGCGTCACTAT rA GGAAGAGATGTGT-3';

[0036] The enzyme chain has the following nucleotide sequence:

[0037] 5'-ACACATCTCTGAAGTAGCGCCGCCGTATAGTGACGCTAAATTAAAT-3';

[0038] The probe RFP has the following nucleotide sequence:

[0039] 5'-TTTGTCA / iDabcyldT / AGCTAATGATGTTGAGCTGAGGATTAGCTA / i6FAMdT / GACACATCTCTCC-3'.

[0040] Specifically, step (3) Tris buffer contains Tris-HCl, MgCl2, and NaCl; wherein the concentration of Tris-HCl is 10 mM; the concentration of MgCl2 is 10 mM; and the concentration of NaCl is 100 mM.

[0041] Specifically, the buffer solution in step (4) is rCutSmart. TM Buffer and K1enow buffer.

[0042] Specifically, in step (4), the reaction temperature in the constant temperature incubator is 30°C to 40°C, and the reaction time is 60 to 150 min.

[0043] Specifically, in step (4), the reaction temperature in the constant temperature incubator is 37°C and the reaction time is 120 min.

[0044] Specifically, the wavelength of fluorescence detection in step (4) is 518 nm.

[0045] ICP-MS was performed on the same batch of Chaohu Lake water, and the results were as follows: Figure 1 b. Experimental results show that the detection data of Chaohu Lake water by the present invention is close to the monitoring data of Chaohu Lake water by ICP-MS, which indicates the reliability of the present invention. The successful development of the present invention has achieved a cheaper, simpler and more efficient detection of lead ions.

Claims

1. A lead contamination detection probe, characterized in that: The lead pollution detection probe consists of a probe EDP and a probe RFP. The probe EDP includes a substrate chain that binds to an RNA base (rA) and an enzyme chain. The probe RFP is a hairpin probe. The stem of the hairpin probe RFP has a fluorescent group FAM and a quenching group Dabcyl, and the loop of the hairpin probe RFP has a recognition site for cleaving endonuclease. The substrate chain that the rA binds to has the following nucleotide sequence: 5'-ATTTAATTTAGCGTCACTAT rA GGAAGAGATGTGT -3'; The enzyme chain has the following nucleotide sequence: 5'-ACACATCTCTGAAGTAGCGCCGCCGTATAGTGACGCTAAATTAAAT -3'; The probe RFP has the following nucleotide sequence: 5-TTTGTCA / iDabcyldT / AGCTAATGATGTTGAGCTGAGGATTAGCTA / i6FAMdT / GACACATCTCTCC-3'.

2. A method for detecting lead ions using the lead contamination detection probe of claim 1, characterized in that: Includes the following steps: (1) Filter the sample to be tested using a filter; (2) The RFP is incubated, slowly cooled, and then placed at room temperature to obtain an RFP with a stable hairpin structure; (3) The EDP is mixed in Tris buffer, heated, and then slowly cooled to form an EDP complex; (4) Add the filtered sample to be tested described in step (1) to step (3), mix thoroughly, then add the RFP with stable hairpin structure, polymerase, nicking endonuclease, dNTPs solution and buffer solution described in step (2), mix evenly, and place in a constant temperature incubator for incubation. Perform fluorescence detection on the obtained solution, and realize the Pb assay based on the obtained fluorescence signal value. 2+ The detection.

3. The lead ion detection method according to claim 2, characterized in that: The sample to be tested is a solution.

4. The lead ion detection method according to claim 2, characterized in that: The Tris buffer solution in step (3) contains Tris-HCl, MgCl2, and NaCl; wherein the concentration of Tris-HCl is 10 mM; the concentration of MgCl2 is 10 mM; and the concentration of NaCl is 100 mM.

5. The lead ion detection method according to claim 2, characterized in that: The buffer solution mentioned in step (4) is rCutSmart TM Buffer and Klenow buffer.

6. The lead ion detection method according to claim 2, characterized in that: The reaction temperature in the constant temperature incubator in step (4) is 30°C to 40°C, and the reaction time is 60 to 150 min.

7. The lead ion detection method according to claim 2, characterized in that: The wavelength for fluorescence detection in step (4) is 518 nm.