Advanced dumbbell-shaped PCR for isomiR detection

Abstract

The present invention relates to a method for detecting small non-coding RNAs in a sample using a sequence-specific structured adaptor for ligation by a double-stranded RNA ligase and subsequent cDNA production and quantification. The present invention further relates to a kit for carrying out the method.

Description

Technical Field

[0001] The present invention relates to a method for detecting small non-coding RNAs in a sample using sequence-specific structured adaptors for ligation by a double-stranded RNA ligase and subsequent cDNA generation and quantification. The present invention further relates to a kit for carrying out this method. Background Art

[0002] The non-protein-coding regions of the genome are widely transcribed to produce small non-coding RNAs (such as miRNAs), which play key roles in normal biological processes and disease states. Thus, the diversity and expression of these small non-coding RNAs (such as miRNAs) can be used for diagnostic purposes.

[0003] Next-generation sequencing (NGS) methods are capable of detecting a wide range of small non-coding RNAs (such as miRNAs) and are thus mainly used for discovery purposes. However, the use of NGS is associated with increased inter-run and inter-laboratory variability and is not adaptable to most diagnostic laboratories due to its high cost. Nevertheless, NGS is a powerful tool for creating maps of small non-coding RNAs (such as miRNAs) that can be used for disease prediction.

[0004] In view of the above, there is a need to develop orthogonal methods for detecting and quantifying small non-coding RNAs (such as miRNAs) and validating NGS data that can be used in a cost-effective manner in a wide range of laboratories.

[0005] Two main methods for the detection and quantification of miRNAs are currently in use. The first method uses a stem-loop-like probe that hybridizes to the 3' end of the miRNA, followed by reverse transcription (RT) reaction and quantitative polymerase chain reaction (qPCR) detection using a reverse primer that hybridizes to the probe and a forward miRNA-specific primer (such as the classical miRNA TaqMan assay). In the second method, a poly-A tailing reaction is first applied to generate an adenine stretch at the 3' end of the miRNA, followed by RT using an oligo-d(T) primer. Subsequently, a miRNA-specific forward primer is used together with a common reverse primer for the qPCR reaction (such as the miRCury LNA assay, etc.).

[0006] A common problem with the above method is that miRNA-specific forward primers cannot distinguish sequence variations (such as additions, deletions, mutations) at the 5'-end of miRNA and sequence variations (such as additions) at the 3'-end of miRNA. As a result, the final processed RNA sequencing data cannot accurately reflect the underlying biological conditions. Therefore, as discovered by NGS, isomiR-specific information cannot be faithfully verified by currently available qPCR methods. Due to the diversity of miRNA variants at both the 3'-end and 5'-end, by definition, the potential of hybridization-based methods to capture and quantify the precise isomiR of interest is low.

[0007] Therefore, there is a further need to develop methods that allow for the detection and quantification of not only miRNAs but also isomiRs in a rapid, reliable, and precise manner. In addition, the method should allow for the detection and quantification of miRNAs and isomiRs with high specificity and sensitivity, thereby improving the diagnosis and / or prognosis of diseases. In addition, there is a need to develop kits suitable for the above purposes for use in any hospital / clinical center or research center.

[0008] The present inventors have developed a method based on Dumbbell PCR (DB PCR), which utilizes the ability of a double-stranded RNA ligase (especially RNA ligase 2 (Rnl2)) to specifically ligate nicks in a hybrid double-stranded RNA molecule. Only the adapters that hybridize correctly to both the 5'-end and 3'-end of the isomiR enable the formation of a ligated RNA that can serve as a template for cDNA synthesis. This method is capable of specifically and efficiently determining and quantifying the expression of target RNAs (such as miRNAs) and target RNA variants with specific terminal sequences (such as isomiRs). A second layer of specificity is introduced by TaqMan probes, which can be aligned with a user-defined cDNA sequence region. The method based on Dumbbell PCR (DB PCR) developed by the present inventors can be used in any hospital / clinical or research center and allows for the analysis of clinical samples in a simple, rapid, reliable, precise, and cost-effective manner. Due to this method, the specificity and sensitivity of diagnostic tests can be further improved. Kits suitable for the above purposes are also provided. Summary of the Invention

[0009] In a first aspect, the present invention relates to a 5'-adapter, which comprises, in the order from 5' to 3':

[0010] (i) a 5'-terminal nucleotide sequence comprising 6 to 15 deoxynucleotides, wherein the 6 to 15 deoxynucleotides are reverse complementary to the 5'-terminal sequence of the target RNA, and

[0011] (ii) A nucleotide sequence capable of forming a stem-loop structure, the stem-loop structure comprising a loop and a double-stranded stem, wherein at least 2 nucleotides at its 3'-end are ribonucleotides or modified ribonucleotides, and wherein the nucleotide sequence is locked nucleic acid-(LNA-) enhanced.

[0012] In a second aspect, the present invention relates to a 3'-adapter, which comprises, in order from 5' to 3':

[0013] (i) A nucleotide sequence capable of forming a stem-loop structure, the stem-loop structure comprising a loop and a double-stranded stem, wherein the 5'-terminal nucleotide is phosphorylated, and wherein the nucleotide sequence is locked nucleic acid-(LNA-) enhanced, and

[0014] (ii) A 3'-terminal nucleotide sequence comprising 6 to 15 deoxynucleotides, wherein the 6 to 15 deoxynucleotides are reverse complementary to the 3'-terminal sequence of the target RNA, and wherein the deoxynucleotide at the 3'-end is an inverted deoxynucleotide.

[0015] In a third aspect, the present invention relates to a combination, which comprises:

[0016] A 5'-adapter according to the first aspect, and

[0017] A 3'-adapter according to the second aspect.

[0018] In a fourth aspect, the present invention relates to a method for ligating two adapters to a target RNA in a sample, the method comprising the steps of:

[0019] (i) Providing a composition, the composition comprising a denatured target RNA in a sample, a renatured 5'-adapter according to the first aspect, and a renatured 3'-adapter according to the second aspect, wherein the 5'-adapter and the 3'-adapter are annealed to the target RNA, and

[0020] (ii) Using / passing through a double-stranded RNA ligase to ligate the 5'-adapter and the 3'-adapter to the target RNA, thereby producing a ligation product.

[0021] In a fifth aspect, the present invention relates to a method for determining and / or quantifying a target RNA in a sample, the method comprising the steps of:

[0022] (i) Implementing the method according to the fourth aspect,

[0023] (ii) Reverse transcribing the ligation product, thereby obtaining a cDNA product from the target RNA, and

[0024] (iii) Amplifying the cDNA, thereby determining and / or quantifying the target RNA.

[0025] In a sixth aspect, the present invention relates to a method for diagnosing a disease or disorder in a patient, the method comprising the steps of:

[0026] (ia) performing the method according to the third and / or fourth aspect to determine the presence of a target RNA, and

[0027] (iia) diagnosing whether the patient has the disease or disorder based on the presence of the target RNA, or

[0028] (ib) performing the method according to the third and / or fourth aspect to quantify the target RNA,

[0029] (iib) comparing the quantified target RNA with a reference, and

[0030] (iiib) diagnosing whether the patient has the disease or disorder based on the comparison.

[0031] In a seventh aspect, the present invention relates to a kit comprising:

[0032] a 5' adaptor according to the first aspect, and

[0033] a 3' adaptor according to the second aspect, or

[0034] a combination according to the third aspect.

[0035] This summary of the invention does not necessarily describe all features of the invention. Other embodiments will become apparent from a review of the following detailed description. Detailed Description

[0036] Definition

[0037] Before the present invention is described in detail below, it is to be understood that the invention is not limited to the particular methodologies, protocols and reagents described herein as they may vary. It should also be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the invention, which will be limited only by the appended claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0038] Preferably, terms used herein such as "A multilingual glossary of biotechnological terms: (IUPAC Recommendations)", Leuenberger, H.G.W, Nagel, B. and It is defined as described in H. Compendium (1995), Helvetica Chimica Acta, CH-4010 Basel, Switzerland.

[0039] Multiple documents are cited throughout the text of this application. Whether above or below, each document cited herein (including all patents, patent applications, scientific publications, manufacturer specifications, instructions, GenBank accession number sequence submissions, etc.) is hereby incorporated by reference in its entirety. Nothing in this application should be construed as an admission that the present invention has no right to antedate such disclosure by virtue of prior invention. In the event of a conflict between the definitions or teachings of such incorporated references and the definitions or teachings set forth in this application document, the text of this application document shall control.

[0040] As used in the present invention, the term "comprising" or variants such as "including" or "containing" means including the stated integer or group of integers, but not excluding any other integer or group of integers. As used in the present invention, the term "consisting essentially of" means including the stated integer or group of integers, while excluding other integers or modifications that would materially affect or change the stated integer. As used in the present invention, the term "consisting of" or variants such as "composed of" means including the stated integer or group of integers, and excluding any other integer or group of integers.

[0041] Unless otherwise specified herein or clearly contradicted by the context, the terms "a" and "an" and "the" and similar referents used in the context of describing the present invention (especially in the context of the claims) shall be construed to include both the singular and the plural forms.

[0042] As used herein, the term "nucleotide" refers to an organic molecule composed of a nucleoside and a phosphate ester. In particular, a nucleotide consists of three subunit molecules: a nucleobase, a five-carbon sugar (ribose or deoxyribose), and a phosphate group consisting of 1 to 3 phosphate radicals. The four nucleobases in DNA are guanine, adenine, cytosine, and thymine; in RNA, uracil is used in place of thymine. Nucleotides serve as the monomeric units of nucleic acid polymers such as deoxyribonucleotides (DNA) or ribonucleotides (RNA). Thus, nucleotides are the molecular building-blocks of DNA and RNA.

[0043] As used herein, the term "nucleoside" refers to a glycosylamine that can be considered a nucleotide without a phosphate group. A nucleoside consists solely of a nucleobase (also called a nitrogenous base) and a pentose sugar (ribose or 2'-deoxyribose), while a nucleotide consists of a nucleobase, a pentose sugar, and one or more phosphate groups. In a nucleoside, the anomeric carbon is linked to N9 of a purine or N1 of a pyrimidine by a glycosidic bond.

[0044] The terms "nucleotide sequence" or "polynucleotide" are used interchangeably herein and refer to single-stranded and double-stranded polymers of nucleotide monomers, including but not limited to 2'-deoxyribonucleotides (DNA) and ribonucleotides (RNA) linked by internucleotide phosphodiester bonds or nucleotide analogs, and associated counter ions, such as H + , NH 4+ , trialkylammonium, Mg 2+ , Na + , etc. A nucleotide sequence or polynucleotide can consist entirely of deoxyribonucleotides, entirely of ribonucleotides, or a chimeric mixture thereof, and can include nucleotide analogs. Nucleotide monomer units can include any nucleotide described herein, including but not limited to nucleotides and / or nucleotide analogs.

[0045] As used herein, the term "analog" includes synthetic analogs having modified base moieties, modified sugar moieties, and / or modified phosphate moieties. Phosphodiester / salt analogs generally include analogs of phosphodiesters / salts in which the phosphorus atom is in the +5 oxidation state and one or more oxygen atoms are replaced by non-oxygen moieties (such as sulfur). Exemplary phosphodiester / salt analogs include: phosphorothioates, dithiophosphates, selenophosphates, diselenophosphates, phosphorothioanilates, phosphoramidates, borophosphates, including associated counter ions, such as H + , NH 4+ , Na + . Exemplary base analogs include: 2,6-diaminopurine, hypoxanthine, pseudouridine, C-5-propynyl, isocytosine, isoguanine, 2-thiopyrimidine. Exemplary sugar analogs include: 2'-modified or 3'-modified, where the 2'-position or 3'-position is hydrogen, hydroxyl, alkoxy (such as methoxy, ethoxy, allyloxy, isopropoxy, butoxy, isobutoxy, and phenoxy), azido, amino or alkylamino, fluoro, chloro, and bromo.

[0046] In one embodiment, the modified ribonucleotides are present in the adaptors / partial adaptors described herein. In a preferred embodiment, the modified ribonucleotides are 2'-O-methyl ribonucleotides.

[0047] As used herein, the term "target RNA" refers to a ribonucleotide sequence sought to be detected. Target RNA can be obtained from any source and can comprise any number of different components. For example, target RNA is isolated from an organism, tissue, cell, or body fluid (such as blood). For example, target RNA includes non-coding RNA and / or coding RNA. In particular, target RNA is microRNA (miRNA) or miRNA isoform (isomiR), transfer RNA (tRNA), small interfering RNA (siRNA), or other mature small RNAs, and can include variants, analogs, and mimics.

[0048] In addition, it should be understood that the term "target RNA" can refer to the target molecule itself as well as its surrogates, such as amplification products (e.g., cDNA derived therefrom) and native sequences. In certain embodiments, target RNA is a miRNA or miRNA isoform (isomiR) molecule. In certain embodiments, target RNA lacks a poly-A tail. In certain embodiments, target RNA is a mature small RNA molecule, particularly a non-coding small RNA molecule (i.e., having a length <200 ribonucleotides, e.g., between 10 and <200 ribonucleotides). The target RNA described herein can be derived from any number of sources, including but not limited to humans and animals. These sources can include but are not limited to whole blood, tissue biopsy, lymph, bone marrow, amniotic fluid, hair, skin, semen, biological warfare agents, anal secretions, vaginal secretions, sweat, saliva, or oral swabs. However, various environmental samples (e.g., agricultural, water, and soil), general research samples, general purified samples, cultured cells, and lysed cells can also be used as samples. It should be understood that any of the various procedures known in the art can be used to isolate target RNA from a sample, e.g., Applied Biosystems ABI 6100 Nucleic Acid PrepStation (Life Technologies, Foster City, CA) and ABI 6700 Automated Nucleic Acid Workstation (Life Technologies, Foster City, CA), mirVana TM RNA Isolation Kit (Life Technologies, Austin, TX), etc.

[0049] In one embodiment, the target RNA is any single-stranded (non-coding or coding) RNA having a 5'-phosphate moiety and a 3'-hydroxyl moiety. In a preferred embodiment, the target RNA is an RNA having a length <200 ribonucleotides, such as between 10 and <200 ribonucleotides. In a more preferred embodiment, the target RNA is an RNA having a length between 10 and 100 ribonucleotides. In an even more preferred embodiment, the target RNA is an RNA having a length between 10 and 50 ribonucleotides. In particular, the RNA is a non-coding RNA, specifically a miRNA or miRNA isomer (isomiR).

[0050] As used herein, the term "miRNA" (which may also be referred to as "microRNA") refers to a single-stranded RNA molecule. The miRNA can be a molecule having a length of 10 to 50 nucleotides, such as 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides, excluding optional labels and / or extension sequences (such as biotin extensions).

[0051] miRNAs regulate gene expression and are encoded by genes in the DNA that transcribe them, but miRNAs are not translated into proteins (i.e., miRNAs are non-coding RNAs). Genes encoding miRNAs are longer than the processed mature miRNA molecules. miRNAs are initially transcribed as longer precursor molecules (>1000 nucleotides long) called primary miRNA transcripts (pri-miRNAs). Pri-miRNAs have hairpin structures that are processed by the Drosha enzyme (as part of the microprocessor complex). After Drosha processing, the pri-miRNA is only 60 to 100 nucleotides long and is called precursor miRNA (pre-miRNA). At this point, the pre-miRNA is exported to the cytoplasm where it encounters the Dicer enzyme. Dicer cuts the miRNA into two pieces, forming a double-stranded miRNA strand. Traditionally, only one of these miRNA arms was considered important in gene regulation: the arm destined to be loaded into the RNA-induced silencing complex (RISC) and present at a higher concentration in the cell. This is usually called the "guide" strand and is designated as miR. The other arm is called the "minor miRNA" or "passenger miRNA" and is usually designated as miR*. It was thought that passenger miRNAs were completely degraded, but deep sequencing studies have found that some minor miRNAs remain and actually play a functional role in gene regulation. Due to these developments, the naming convention has changed. The miR-5p / miR-3p nomenclature has been adopted to replace the miR / miR* naming scheme. With the new system, the 5' arm of the miRNA is always designated as miR-5p, while the 3' arm is miR-3p. The current nomenclature is as follows: the prefix "miR" is followed by a dash and a number, the latter usually indicating the order of naming. For example, the one named hsa-miR-16 may have been discovered earlier than hsa-miR-342. The capitalized "miR-" refers to the mature form of the miRNA (e.g., hsa-miR-16-5p and hsa-miR-16-3p), while the uncapitalized "mir-" refers to pre-miRNAs and pri-miRNAs (e.g., has-mir-16), and "MIR" refers to the genes encoding them. However, since this is a recent change, the original miR / miR* names will often be mentioned in the literature. After processing, the double-stranded miRNA strand is loaded onto the Argonaute (AGO) protein, forming a precursor of the RISC. The complex causes the duplex to unwind and the passenger RNA strand to be discarded, leaving the mature RISC carrying the mature single-stranded miRNA. The miRNA remains part of the RISC as it silences the expression of its target gene. Although this is the typical pathway of miRNA biogenesis, many other pathways have been discovered.These pathways include Drosha-independent pathways (such as the mirtron pathway, snoRNA-derived pathway, and shRNA-derived pathway) and Dicer-independent pathways (such as the AGO cleavage-dependent pathway and another pathway dependent on tRNaseZ).

[0052] As used herein, the term "miRBase" refers to a well-established repository of experimentally verified miRNAs. miRBase (www.mirbase.org) is a searchable database of published miRNA sequences and annotations. Each entry in the miRBase sequence database represents the predicted hairpin portion of the miRNA transcript (referred to as mir in the database), as well as information on the location and sequence of the mature miRNA sequence (referred to as miR). Both the hairpin sequence and the mature sequence can be searched and browsed, and entries can also be retrieved by name, keyword, citation, and annotation. All sequence and annotation data can also be downloaded. In October 2018, miRbase version 22.1 was released. This is the current version.

[0053] As used herein, the term "isomiR" (or "miRNA isoform") refers to a miRNA with slightly altered sequence, which is caused by changes in the cleavage site during miRNA biogenesis or by processes that affect the mature miRNA after biogenesis (such as oligouridylation). In particular, imprecise cleavage by Drosha and Dicer or the turnover of miRNAs can cause miRNAs to be heterogeneous in length and / or sequence. IsomiRs (miRNA isoforms) can be classified into three major categories: 3'isomiRs (one or more nucleotides are trimmed or added at the 3' position), 5'isomiRs (one or more nucleotides are trimmed or added at the 5' position), and polymorphic isomiRs (some nucleotides in the sequence are different from the wild-type mature miRNA sequence). It is foreseeable that increased expression of individual isomiRs or miRNA variants causes loss or attenuation of the function of the corresponding wild-type mature miRNA, or causes regulation of different transcriptomes. Recent studies have shown that isomiRs may play important roles in a variety of cancers, tissues, and cell types. Therefore, the detection of miRNAs and isomiRs is absolutely necessary for accurately reflecting the underlying biological conditions and making correct diagnostic and treatment decisions.

[0054] As used herein, the term "adapter" refers to a polynucleotide that can be ligated to the 5'-end of a target RNA (i.e., "5'-adapter") or to the 3'-end of a target RNA (i.e., "3'-adapter"). The nucleotides of the 5'-adapter and 3'-adapter can be standard or natural nucleotides (i.e., adenosine, guanosine, cytidine, thymidine, and uridine), or they can be non-standard nucleotides. Non-limiting examples of non-standard nucleotides include inosine, xanthosine, isoguanosine, isocytidine, diaminopyrimidine, and deoxyuridine. The adapter can contain modified or derivatized nucleotides. Non-limiting examples of modifications to the ribose or base moiety include addition or removal of an acetyl group, amino group, carboxyl group, carboxymethyl group, hydroxyl group, methyl group, phosphoryl group, and thiol group. Particularly included are 2'-O-methyl and locked nucleic acid (LNA) nucleotides. Suitable examples of derivatized nucleotides include nucleotides with a covalently attached dye (e.g., a fluorescent dye or quencher dye) or other molecule (e.g., biotin, digoxin, or magnetic particles or microspheres). The adapter can also contain synthetic nucleotide analogs, such as morpholinos or peptide nucleic acids (PNA). Phosphodiester bonds or phosphorothioate bonds can link the nucleotides or nucleotide analogs of the linker.

[0055] For example, the lengths of the 5'- and 3'-adapters can vary depending on, for example, the desired length of the ligation product and the desired characteristics of the adapter. Generally, the length of the 5'-adapter or 3'-adapter can range from 15 to 60 nucleotides, such as 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 nucleotides.

[0056] The 5'-adapter as described herein contains a 5'-terminal nucleotide sequence that includes 6 to 15 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15) (random) deoxynucleotides, wherein the 6 to 15 (random) deoxynucleotides are reverse complementary to the 5'-terminal sequence of the target RNA. In addition, the 3'-adapter as described herein contains a 3'-terminal nucleotide sequence that includes 6 to 15 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15) (random) deoxynucleotides, wherein the 6 to 15 (random) deoxynucleotides are reverse complementary to the 3'-terminal sequence of the target RNA.

[0057] For example, upon / at denaturation, the 5' adaptor and the 3' adaptor may exist as linear polynucleotides. In this form, the 5' adaptor and the 3' adaptor are single-stranded. This primary structure can be converted into a secondary structure. In particular, the 5' adaptor and the 3' adaptor are also capable of forming a stem-loop structure. Thus, the 5' adaptor and the 3' adaptor may also have a stem-loop structure, for example, after / upon renaturation.

[0058] Generally, the term "stem-loop structure" refers to a pattern that may occur in single-stranded RNA. This structure is also referred to as a "hairpin" or "hairpin loop". This occurs when two regions of the same strand (which are typically complementary in the nucleotide sequence when read in opposite directions) base pair to form a double helix and end with an unpaired loop.

[0059] In particular, the 5' adaptor and the 3' adaptor capable of forming a stem-loop structure comprise a first stem sequence located at the 5' end and a second stem sequence located at the 3' end that are reverse complementary to each other. The first stem sequence and the second stem sequence form the "double-stranded region" or "double-stranded stem" of the stem-loop adaptor.

[0060] In one embodiment, the length of the stem is between 5 and 20 nucleotides, such as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides. In a preferred embodiment, the length of the stem is between 5 and 10 nucleotides, such as 5, 6, 7, 8, 9, or 10 nucleotides.

[0061] It should be noted that a portion of the primer may be encoded in the stem. Generally, in those embodiments where a portion of the primer is encoded in the stem, the stem can be longer. In those embodiments where a portion of the primer is not encoded in the stem, the stem can be shorter.

[0062] As used herein, the term "loop" refers to the single-stranded region of a stem-loop structure. In particular, the loop is located between a first stem sequence at the 5' and a second stem sequence at the 3'. In other words, the loop is located between the two antiparallel complementary strands of the stem, and typically the loop contains single-stranded nucleotides, although other moieties (such as modified DNA or RNA molecules) are also possible. In one embodiment, the loop sequence contains between 10 and 40 nucleotides, such as 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 nucleotides. In a preferred embodiment, the loop sequence contains between 12 and 20 nucleotides, such as 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides. The nucleotides of the loop structure are preferably deoxynucleotides, but may also be ribonucleotides.

[0063] It should be noted that a portion of the primer may be encoded in the loop. Generally, in those embodiments where the primer is encoded in the loop, the loop can be longer. In those embodiments where the primer is not encoded in the loop, the loop can be shorter.

[0064] Furthermore, it should be noted that the 5' adaptor described herein contains a 5' terminal sequence that is configured to form a single-stranded 5' overhang after formation of the stem-loop structure. Additionally, it should be noted that the 3' adaptor described herein contains a 3' terminal sequence that is configured to form a single-stranded 3' overhang after formation of the stem-loop structure.

[0065] An adaptor (e.g., a 5' adaptor and / or a 3' adaptor) may contain one or more blocking nucleotides. As used herein, the term "blocking nucleotide" refers to a nucleotide that contains a chemical moiety that prevents or minimizes nucleotide addition by a DNA polymerase. For example, by adding a blocking group to the terminal 3'-OH, the nucleotide can no longer participate in the formation of a phosphodiester bond catalyzed by a DNA polymerase. Some non-limiting examples include alkyl groups, non-nucleotide linkers, phosphorothioates, alkane diol residues, PNA, LNA, nucleotide analogs containing a 3'-amino group that replaces the 3'-OH group, nucleotide analogs containing a 5'-OH group that replaces the 5'-phosphate group, nucleotide derivatives lacking a 3'-OH group, or biotin. These nucleotides are generally non-extendable. Other examples of non-extendable nucleotides that can be used include nucleotides having a modified ribose moiety. In certain embodiments, ribonucleotides can act as non-extendable nucleotides because oligonucleotides terminated with ribonucleotides cannot be extended by certain DNA polymerases. The ribose can be modified to include 3'-deoxy derivatives, including those in which the 3'-hydroxyl group is replaced by a functional group other than hydrogen, for example, as an azide group. In certain embodiments, non-extendable nucleotides include dideoxynucleotides (ddN), such as but not limited to dideoxyadenosine (ddA), dideoxycytidine (ddC), dideoxyguanosine (ddG), dideoxythymidine (ddT), or dideoxyuridine (ddU).

[0066] In particular, an adaptor (e.g., a 5' adaptor and / or a 3' adaptor) may contain locked nucleic acid (LNA). The term "locked nucleic acid (LNA)" as used herein refers to a modified nucleotide, particularly a ribonucleotide, in which the 2'-O and 4'-C atoms of the ribose are joined by a methylene bridge. This additional bridge restricts the flexibility normally associated with the ring, effectively locking the structure into a rigid conformation. These nucleic acid analogs are also referred to in some circles as "inaccessible ribonucleotides". LNA nucleotides can be mixed with DNA or RNA residues in a polynucleotide and hybridize to DNA or RNA in accordance with the Watson-Crick base pairing rules in practice. The immutable nature of these molecules greatly improves hybridization stability. In addition, polynucleotides containing LNA provide great discrimination ability, enabling these molecules to distinguish between perfectly matched and mismatched complementary target sequences with very little difficulty. In one embodiment, the 5' adaptor and / or the 3' adaptor contains locked nucleotides, particularly ribonucleotides. In a preferred embodiment, the first stem sequence located at the 5' of the 5' adaptor and / or the second stem sequence located at the 3' is LNA-enhanced. In another preferred embodiment, the first stem sequence located at the 5' of the 3' adaptor and / or the second stem sequence located at the 3' is LNA-enhanced.

[0067] The 3'-adapter may comprise 3'-inverted deoxynucleotides. As used herein, the term "inverted deoxynucleotide" refers to a deoxynucleotide that creates a 3'-3' linkage and thus, for example, prevents unwanted nucleotide synthesis at the 3'-end of the adapter during reverse transcriptase (RT) PCR. In addition, the 3'-inverted deoxynucleotide protects the sequence from 3'-exonuclease cleavage. In one embodiment, the 3'-adapter comprises 3'-inverted deoxynucleotides. In a preferred embodiment, the 3'-adapter comprises 3'-inverted deoxynucleotides, wherein the deoxynucleotide is inverted dT, dA, dC, or dG.

[0068] The 5'-adapter may also comprise a base-lacking spacer in the loop, particularly at the 5'-end of the loop. As used herein, the term "base-lacking spacer" refers to a moiety that allows termination of reverse transcription in a subsequent step. In particular, the reaction terminates at the nucleotide preceding the base-lacking spacer in the 5'-adapter loop region, which prevents the reaction from proceeding to the end of the 5'-adapter and generating a highly structured cDNA that may impair subsequent PCR steps. In particular, the base-lacking spacer is a 2'-dideoxyribose spacer. More particularly, the base-lacking spacer is a 1',2'-dideoxyribose spacer. In one embodiment, the 5'-adapter comprises a base-lacking spacer in the loop, preferably at the 5'-end of the loop. In a preferred embodiment, the 5'-adapter comprises a 2'-dideoxyribose spacer in the loop, preferably at the 5'-end of the loop.

[0069] In a more preferred embodiment, the 5'-adapter and the 3'-adapter are combined / are part of a combination, wherein the first stem sequence located at the 5'-end and / or the second stem sequence located at the 3'-end of the 5'-adapter is LNA-enhanced; wherein the first stem sequence located at the 5'-end and / or the second stem sequence located at the 3'-end of the 3'-adapter is LNA-enhanced.

[0070] In an even more preferred embodiment, the 5'-adapter and the 3'-adapter are combined / are part of a combination, wherein the first stem sequence located at the 5'-end and / or the second stem sequence located at the 3'-end of the 5'-adapter is LNA-enhanced; wherein the first stem sequence located at the 5'-end and / or the second stem sequence located at the 3'-end of the 3'-adapter is LNA-enhanced, and wherein the 3'-adapter comprises 3'-inverted deoxynucleotides, such as inverted dT, dA, dC, or dG.

[0071] The present disclosure further provides a method for ligating an adapter to target RNA in a sample. The method requires annealing the adapter (particularly the 5'-adapter and the 3'-adapter) to the target RNA. The target RNA is denatured before the adapter (particularly the 5'-adapter and the 3'-adapter) is annealed to the target RNA. In addition, the adapter (particularly the 5'-adapter and the 3'-adapter) is denatured and then renatured.

[0072] As used herein, the term "annealing" refers to the process of heating and cooling two single-stranded polynucleotides having complementary sequences. The heat breaks all hydrogen bonds, and cooling allows new bonds to form between the sequences. In this process, adapters (especially 5'-adapter and 3'-adapter) attach to the target RNA and form their characteristic stem-loop structure. Specifically, the 5'-adapter attaches to the 5'-end of the target RNA, and the 3'-adapter attaches to the 3'-end of the target RNA.

[0073] In this regard, it should be noted that in the method of the present invention, the denaturation / renaturation of the adapters (especially 5'-adapter and 3'-adapter) is carried out separately in the absence of the target RNA.

[0074] Then the adapters (especially 5'-adapter and 3'-adapter) are ligated to the target RNA using / by a double-stranded RNA ligase, thereby generating a ligation product. As used herein, the term "ligation product" refers to a (DNA / RNA) hybrid molecule containing at least one adapter and the target RNA. For example, the ligation product may contain a 5'-adapter and the target RNA (such as miRNA or isomiR). The ligation product may contain a 3'-adapter and the target RNA (such as miRNA or isomiR). In addition, the ligation product may contain a 5'-adapter, a 3'-adapter, and the target RNA (such as miRNA or isomiR).

[0075] Specifically, annealing of the 5'-adapter with the target RNA generates a double-stranded (DNA / RNA) hybrid containing an RNA-OH-3' / 5'-P-RNA nick between the 3'-end of the adapter and the 5'-end of the target RNA. This is an effective substrate for ligation by a double-stranded RNA ligase. In addition, annealing of the 3'-adapter with the target RNA generates a double-stranded (DNA / RNA) hybrid containing an RNA-OH-3' / 5'-P-RNA nick between the 3'-end of the target RNA and the 5'-end of the adapter. This is also an effective substrate for ligation by a double-stranded RNA ligase.

[0076] Generally, any double-stranded RNA ligase capable of ligating double-stranded RNA nicks / RNA structures can be used for this purpose. In a preferred embodiment, the double-stranded RNA ligase is T4 RNA ligase 2 (Rnl2) or Kod1 ligase. In a more preferred embodiment, the double-stranded RNA ligase is T4 RNA ligase 2 (Rnl2).

[0077] The conditions for the ligation reaction are typically adjusted such that the ligase functions under conditions close to its optimal activity level. The pH can be adjusted and maintained at the desired level using a buffer. Representative examples of suitable buffers include, but are not limited to, MOPS, HEPES, TAPS, Bicine, Tricine, TES, PIPES, MES, sodium acetate, and Tris buffers.

[0078] As used herein, the term "extension reaction" refers to a reaction in which a 3' adaptor linked to the 3' end of a target RNA is extended (particularly in the 5' to 3' direction), thereby forming an "extension reaction product" that contains a strand that is reverse complementary to the target RNA. As used herein, the extension reaction is also referred to as "reverse transcription". In some embodiments, the target RNA is a miRNA molecule, and the extension reaction is a reverse transcription reaction that includes a reverse transcriptase, whereby a DNA (particularly cDNA) copy of the ligation product is prepared. In certain embodiments, the extension reaction is a reverse transcription reaction that includes a polymerase (such as a reverse transcriptase).

[0079] As used herein, the term "reverse transcriptase" refers to any enzyme having reverse transcriptase activity. In particular, the term "reverse transcriptase" as used herein refers to an enzyme used to generate DNA (cDNA) from an RNA template in a process called reverse transcription. Reverse transcriptase has RNA-dependent DNA polymerase activity. Through this activity, after a single-stranded RNA appears, a hybrid double-strand of RNA and DNA is first established by linking complementary paired DNA building blocks (deoxyribonucleotides). Thereafter, its RNA portion is largely degraded by the RNase H activity of a special portion of the protein. The remaining single-stranded DNA is finally completed into a DNA double-strand under the catalysis of the additional inherent DNA-dependent DNA polymerase activity of the reverse transcriptase. To initiate reverse transcription, the reverse transcriptase requires a primer that serves as the reverse transcription starting point to synthesize a new strand. This primer is also referred to as the RT primer sequence. The RT primer depends on the 3' adaptor sequence. The RT primer is reverse complementary to the said sequence. In a preferred embodiment, the reverse transcriptase is Maxima H-RT or Tth polymerase. In a more preferred embodiment, the reverse transcriptase is Maxima H-RT.

[0080] Methods for assaying the ligation product to detect the target RNA are further described herein. In particular, methods for assaying the ligation product to detect the target RNA, the ligation product comprising a 3' adaptor and cDNA of the target RNA, are further described herein.

[0081] The assay can be quantitative, such that the amount or copy number of the target RNA in a sample can be determined. Alternatively, the assay can be qualitative, such that the presence or absence of the target RNA in a sample can be determined, but its level may not be measured. Thus, the assay allows for the determination and quantification of the target RNA in a sample.

[0082] This document describes an amplification method for determining a ligation product. In particular, polymerase chain reaction (PCR) is used for amplification. The PCR can be selected from the group consisting of: real-time PCR (quantitative PCR or qPCR, preferably Taq-man qPCR), multiplex PCR, nested PCR, high-fidelity PCR, rapid PCR, hot-start PCR, and high-GC PCR. To amplify a ligation product containing a target RNA, the ligation product is typically converted into a DNA copy.

[0083] As used herein, the terms "amplicon" and "amplification product" generally refer to the product of an amplification reaction. The amplicon can be double-stranded or single-stranded, and can include discrete component strands obtained by denaturing a double-stranded amplification product. In certain embodiments, the amplicon of one amplification cycle can serve as a template in a subsequent amplification cycle.

[0084] As used herein, the term "amplify" refers to any means of replicating at least a portion of a target RNA, target RNA surrogate, or combination thereof, typically in a template-dependent manner, including without limitation a wide range of techniques for amplifying nucleic acid sequences (linear or exponential). Any one of several methods can be used to amplify the target polynucleotide. Any in vitro means for doubling the copy number of a nucleic acid target sequence can be used. These means include linear, logarithmic, or other amplification methods. Exemplary methods include polymerase chain reaction (PCR), isothermal procedures (using one or more RNA polymerases, strand displacement, partial destruction of primer molecules), ligase chain reaction (LCR), Q RNA replicase system, RNA transcription-based systems (e.g., TAS, 3SR), or rolling circle amplification (RCA).

[0085] In the context of the present invention, the cDNA of the target RNA is amplified.

[0086] As used herein, the term "dumbbell-shaped PCR (DB-PCR)" refers to an effective and convenient method for precisely quantifying specific individual small RNAs (such as miRNAs) and specific individual small RNA variants (such as isomiRs). In Db-PCR, a 5'-adapter and a 3'-adapter are specifically hybridized and ligated to the 5'-end and 3'-end of the target RNA, respectively, by a double-stranded RNA ligase (such as T4 RNA ligase 2 (Rnl2)). Subsequently, the resulting ligation product with a "dumbbell-like" structure is quantified, for example, by TaqMan RT-PCR. The inventors have found that the high specificity of the proprietary 5'-adapter and 3'-adapter described herein, along with Rnl2 ligation and TaqMan RT-PCR for the target RNA, ensures the 5'-end and 3'-end sequences of the target RNA with single-nucleotide resolution, enabling Db-PCR to specifically detect the target RNA rather than its corresponding terminal variants. The Db-PCR described herein has broad applicability for the quantification of various small RNAs in different cell types. Thus, Db-PCR provides a much-needed simple method for analyzing RNA terminal heterogeneity.

[0087] Residues in two or more polynucleotides are said to "correspond" to each other if they occupy analogous positions in the polynucleotide structure. It is well known in the art that analogous positions in two or more polynucleotides can be determined by aligning the polynucleotide sequences based on nucleic acid sequence or structural similarity. Such alignment tools are well known to those skilled in the art and are available, for example, on the World Wide Web. For example, Align or ClustalW can be used with standard settings, preferably Align EMBOSS::needle, Matrix:Blosum62, Gap Open 10.0, Gap Extend 0.5.

[0088] As used herein, the term "disease" refers to an abnormal condition that affects an individual's body. A disease is generally interpreted as a medical condition associated with specific symptoms and signs. In humans, the term "disease" is generally used more broadly to refer to any condition that causes pain, dysfunction, distress, social problems, or death to the affected individual, or similar problems to those in contact with the individual. In this broader sense, it sometimes includes injuries, disabilities, disorders, syndromes, infections, abnormal behaviors, and atypical changes in structure and function, which in other cases may be considered distinguishable categories for other purposes. A disease generally affects an individual not only physically but also emotionally, as living with and coping with many diseases can change a person's outlook on life and personality. A disease can be a disease selected from the group consisting of neurodegenerative diseases, autoimmune diseases, infectious diseases, and cancers.

[0089] As used herein, the term "therapeutic treatment / therapy" refers to any treatment / therapy that improves the health condition of a patient and / or prolongs (increases) the lifespan of the patient. The treatment / therapy may eliminate the disease of the patient, prevent, inhibit or slow down the development of the disease of the patient, reduce the frequency or severity of the symptoms of the patient, and / or reduce the recurrence in patients currently suffering from or previously having suffered from a disease.

[0090] As used herein, the term "sample" refers to any sample containing a target RNA, particularly coding and / or non-coding RNA, more particularly small non-coding target RNA. Specifically, the sample is derived from the body of a patient / subject. Specifically, the sample contains a target RNA isolated from an organism, tissue, cell or body fluid (such as blood), particularly small non-coding target RNA. Thus, the sample is particularly a biological sample.

[0091] As used herein, the term "biological sample" refers to any sample having a biological origin and / or containing biological material. A biological sample may be a body fluid sample (such as a blood sample or a urine sample) or a tissue sample (such as a tissue biopsy sample). Biological samples may be mixed or combined. For example, the sample may be a mixture of a blood sample and a urine sample.

[0092] As used herein, the term "body fluid sample" refers to any liquid sample containing a target RNA. Specifically, the sample is derived from the body of a patient / subject. The body fluid sample may be a urine sample, a blood sample, a sputum sample, a milk sample, a cerebrospinal fluid (CSF) sample, a cerumen (earwax) sample, a gastric juice sample, a mucus sample, a lymph sample, an endolymph sample, a perilymph sample, an ascitic fluid sample, a pleural fluid sample, a saliva sample, a sebum (skin oil) sample, a semen sample, a sweat sample, a tear sample, a buccal swab, a vaginal secretion sample, a liquid biopsy or a vomit sample, including its components or fractions. The term "body fluid sample" also includes body fluid fractions, such as a blood fraction, a urine fraction or a sputum fraction. Body fluid samples may be mixed or combined. Thus, the body fluid sample may be a mixture of a blood and a urine sample, or a mixture of a blood and a cerebrospinal fluid sample.

[0093] As used herein, the term "blood sample" includes whole blood or a blood fraction. Preferably, the blood fraction is selected from the group consisting of a blood cell fraction, plasma and serum. Specifically, the blood fraction is selected from the group consisting of a blood cell fraction and plasma or serum. For example, the blood cell fraction includes red blood cells, white blood cells and / or platelets.

[0094] A whole blood sample can be collected by a blood collection tube. For example, collected in a PAXgene Blood RNA tube, a Tempus Blood RNA tube, an EDTA tube, a sodium citrate tube, a heparin tube, or an ACD tube (citrate dextrose).

[0095] Whole blood samples can also be collected by the dried blood spot technique, for example using a Mitra Microsampling Device. This technique requires a smaller sample volume, typically 45 - 60 μL or less for humans. For example, whole blood can be extracted from a patient by finger prick using a needle or lancet. Thus, the whole blood sample can be in the form of a blood drop. The blood drop is then placed on an absorbent probe capable of absorbing whole blood, such as a hydrophilic polymer material, such as cellulose. Once sampling is complete, the dried blood spot is dried in air and then transferred or mailed to a laboratory for processing. Since the blood is dry, it is not considered hazardous. Therefore, no special precautions are required during handling or transportation. Once at the analysis site, the desired component (e.g., miRNA) is extracted from the dried blood spot into a supernatant, which is then further analyzed.

[0096] As used herein, the term "level" refers to the amount (e.g., measured in grams, moles, or ion counts) or concentration (e.g., absolute or relative concentration, such as reads per million (RPM) or NGS counts) of a target RNA. As used herein, the term "level" also includes scaled, normalized, or scaled and normalized amounts or values. In particular, the level of a target RNA is determined by sequencing (preferably next-generation sequencing, such as ABI SOLID, Illumina Genome Analyzer, Roche 454GS FL, BGISEQ), nucleic acid hybridization (e.g., microarray or beads), nucleic acid amplification (e.g., PCR, RT-PCR, qRT-PCR, or high-throughput RT-PCR), polymerase extension, mass spectrometry, flow cytometry (e.g., LUMINEX), or any combination thereof. Specifically, the level of a target RNA is the expression level of the target RNA.

[0097] As used herein, the term "patient" refers to any individual who desires to know whether he or she has a disease or disorder. Specifically, the term "patient" as used herein refers to an individual suspected of being affected by a disease or disorder. A patient may be diagnosed as being affected by a disease or disorder, or may be diagnosed as not being affected by a disease or disorder, i.e., healthy. The term "patient" as used herein also refers to an individual affected by a disease or disorder. For example, after a therapeutic intervention, a patient can be retested for a disease or disorder and may be diagnosed as still being affected by the disease or disorder, or no longer being affected by the disease or disorder, i.e., healthy. A patient can be human or animal. Human individuals are particularly preferred.

[0098] As used herein, the term "(control) subject" refers to a subject known to be affected by a disease or disorder or known not to be affected by a disease or disorder (i.e., healthy). A (control) subject can be human or animal. Human individuals are particularly preferred.

[0099] In the context of the present invention, the term "kit" is understood to mean any combination of at least some of the components described herein, which are spatially coexistent and combined into a functional unit and may contain other components.

[0100] Embodiments of the present invention

[0101] The present invention will now be further described. In the following paragraphs, different aspects of the present invention are defined in more detail. Each aspect so defined may be combined with any other aspect unless there is an express indication to the contrary. In particular, any feature indicated as being preferred or advantageous may be combined with any other feature indicated as being preferred or advantageous unless there is an express indication to the contrary.

[0102] The inventors have developed a method based on dumbbell-shaped PCR (DB PCR) that exploits the ability of a double-stranded RNA ligase, particularly RNA ligase 2 (Rnl2), to specifically ligate nicks in hybrid double-stranded RNA molecules. Only adaptors that are correctly hybridized to both the 5' and 3' ends of the isomiR enable the formation of a ligated RNA that can serve as a template for cDNA synthesis. This method is capable of specifically and efficiently determining and quantifying the expression of target RNAs (such as miRNAs) and target RNA variants with specific terminal sequences (such as isomiRs). A second layer of specificity is introduced by TaqMan probes that can be aligned to user-defined cDNA sequence regions. The method based on dumbbell-shaped PCR (DB PCR) developed by the inventors can be used in any hospital / clinical or research center and allows the analysis of clinical samples in a simple, rapid, reliable, precise, and cost-effective manner. Due to this method, the specificity and sensitivity of diagnostic tests can be further improved. A kit suitable for the above purposes is also provided.

[0103] Thus, in a first aspect, the present invention relates to a 5' adaptor that, in the 5' to 3' direction, comprises:

[0104] (i) a 5' terminal nucleotide sequence comprising 6 to 15 (such as 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15) deoxynucleotides, wherein the 6 to 15 deoxynucleotides are reverse complementary to the 5' terminal sequence of the target RNA, and

[0105] (ii) a nucleotide sequence capable of forming a stem-loop structure that comprises a loop and a double-stranded stem, wherein at least 2 (such as 2, 3, or 4) nucleotides at its 3' end are ribonucleotides or modified ribonucleotides, and wherein the nucleotide sequence is preferably locked nucleic acid-(LNA-)enhanced.

[0106] Preferably, the LNA - enhanced sequence contains from 2 to 10 (such as 2, 3, 4, 5, 6, 7, 8, 9, or 10), more preferably 3 locked nucleic acids, especially ribonucleotides.

[0107] In particular, the nucleotide sequence of the 5'-adapter contains deoxynucleotides and ribonucleotides.

[0108] The length range of the 5'-adapter can be from 15 to 60 nucleotides, such as 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 nucleotides.

[0109] For example, after denaturation / at the time of denaturation, the 5'-adapter can exist as a linear polynucleotide, especially in single - stranded form. The 5'-adapter is a polynucleotide that can be attached / ligated to the 5'-end of the target RNA. When attached / ligated to the 5'-end of the target RNA, the 5'-adapter has a stem - loop structure. Attachment / ligation is possible because the 5'-adapter contains 6 to 15 (such as 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15) deoxynucleotides that are reverse - complementary to the 5'-terminal sequence of the target RNA. The target RNA is preferably a miRNA or isomiR included in miRbase version 22.1 / a part of miRbase version 22.1.

[0110] In one embodiment, the nucleotide sequence capable of forming a stem - loop structure contains a first stem sequence at the 5'-end and a second stem sequence at the 3'-end that are reverse - complementary to each other. Thus, the first stem sequence at the 5'-end and the second stem sequence at the 3'-end can form a double - stranded stem.

[0111] The length of the double - stranded stem can be between 5 and 20 nucleotides, such as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides.

[0112] Preferably, each of the first stem sequence located at the 5' end and the second stem sequence located at the 3' end has a length between 5 and 10 nucleotides, such as 5, 6, 7, 8, 9 or 10 nucleotides. Specifically, the first stem sequence located at the 5' end and the second stem sequence located at the 3' end have the same length, such as a length of 5, 6, 7, 8, 9 or 10 nucleotides.

[0113] More preferably, the first stem sequence located at the 5' end and / or the second stem sequence located at the 3' end is LNA-enhanced. In particular, the LNA-enhanced sequence contains between 2 and 5 (such as 2, 3, 4 or 5), more particularly 3 locked nucleotides, especially ribonucleotides. Examples of locked ribonucleotides are LNA-guanine, LNA-adenosine or LNA-cytosine. Even more preferably, the first stem sequence located at the 5' end is LNA-enhanced. In particular, the LNA-enhanced sequence contains between 2 and 5 (such as 2, 3, 4 or 5), more particularly 3 locked nucleotides, especially ribonucleotides. Examples of locked ribonucleotides are LNA-guanine, LNA-adenosine or LNA-cytosine. Specifically, in the first stem sequence located at the 5' end and / or the second stem sequence located at the 3' end, every one, every two or every three nucleotides may be LNA-enhanced.

[0114] Thus, the first stem sequence located at the 5' end and / or the second stem sequence located at the 3' end may contain a mixture of deoxynucleotides and ribonucleotides (such as LNA-enhanced), or the first stem sequence located at the 5' end and / or the second stem sequence located at the 3' end may contain ribonucleotides. The ribonucleotides include LNA-enhanced ribonucleotides.

[0115] In a further embodiment, the nucleotide sequence capable of forming a stem-loop structure contains a loop sequence located between the first stem sequence located at the 5' end and the second stem sequence located at the 3' end. The loop sequence may contain between 10 and 40 (such as 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40) nucleotides. Preferably, the loop sequence contains between 12 and 20 (such as 12, 13, 14, 15, 16, 17, 18, 19 or 20) nucleotides, such as deoxynucleotides and / or ribonucleotides. More preferably, the loop sequence contains between 12 and 20 (such as 12, 13, 14, 15, 16, 17, 18, 19 or 20) deoxynucleotides.

[0116] In a preferred embodiment, the nucleotide sequence capable of forming a stem-loop structure comprising a loop and a double-stranded stem contains deoxynucleotides, except for at least two nucleotides at its 3'-end, which are ribonucleotides or modified ribonucleotides, preferably 2'-O-methyl ribonucleotides and locked ribonucleotides.

[0117] In another embodiment, the 5'-terminal sequence is configured to form a single-stranded 5'-overhang after the formation of the stem-loop structure.

[0118] In a preferred embodiment, 6 to 15 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15) deoxynucleotides that are reverse complementary to the 5'-terminal sequence of the target RNA contain G and C, but not more than 4 in a row, e.g., 1, 2, 3, or 4.

[0119] In a more preferred embodiment, the 5'-adapter has the following sequence from 5' to 3', or a variant thereof:

[0120] (SEQ ID NO: 1), wherein "r" represents a ribonucleotide, wherein "(6-15x)N" represents a sequence that is reverse complementary to the 5'-terminal sequence of the target RNA, and wherein one or more nucleotides in the underlined portion and / or one or more nucleotides in the double-underlined portion are LNA-enhanced.

[0121] For example, in the underlined portion and / or the double-underlined portion specified above, every one, every two, or every three nucleotides may be LNA-enhanced.

[0122] In an even more preferred embodiment, the 5'-adapter has the following sequence from 5' to 3', or a variant thereof:

[0123] (SEQ ID NO: 1), wherein "r" represents a ribonucleotide, wherein "(6-15x)N" represents a sequence that is reverse complementary to the 5'-terminal sequence of the target RNA, and wherein one or more (e.g., 1, 2, or 3) of the nucleotides in bold are LNA-enhanced.

[0124] Specifically, the LNA-enhanced nucleotides are ribonucleotides.

[0125] The 5' adaptor variant as described above has the following sequence, which has at least 80%, preferably 85%, more preferably 90%, even more preferably 95%, and yet even more preferably 99% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity with the sequence according to SEQ ID NO: 1. Such 5' adaptor variants still contain at least 2 nucleotides at their 3' end, and the at least 2 nucleotides are ribonucleotides or modified ribonucleotides. In addition, such 5' adaptor variants are still LNA-enhanced. In addition, such 5' adaptor variants are still capable of forming a stem-loop structure comprising a loop and a double-stranded stem. A person skilled in the art can easily evaluate whether a 5' adaptor variant is still capable of forming a stem-loop structure comprising a loop and a double-stranded stem. For example, the experimental section provides sufficient information in this regard.

[0126] In a specific embodiment, the 5' adaptor as described above contains a spacer lacking a base (e.g., a 1',2'-dideoxyribose spacer lacking a base) in the loop region. The 5' adaptor having a spacer lacking a base in the loop region preferably has the following sequence from 5' to 3', or a variant of this sequence:

[0127] (SEQ ID NO: 29), wherein "r" represents a ribonucleotide, wherein "(6-15x)N" represents a sequence reverse complementary to the 5'-terminal sequence of the target RNA, wherein, "idSp" represents a spacer lacking a base, and one or more nucleotides in the underlined part and / or one or more nucleotides in the double-underlined part are LNA-enhanced.

[0128] Specifically, the LNA-enhanced nucleotide is a ribonucleotide.

[0129] In a more specific embodiment, the 5' adaptor containing a spacer lacking a base (e.g., a 1',2'-dideoxyribose spacer lacking a base) in the loop region has the following sequence from 5' to 3', or a variant of this sequence:

[0130] (SEQ ID NO: 29), wherein "r" represents a ribonucleotide, wherein "(6-15x)N" represents a sequence reverse complementary to the 5'-terminal sequence of the target RNA, wherein, "idSp" represents a spacer lacking a base, and one or more (e.g., 1, 2 or 3) of the nucleotides in bold are LNA-enhanced.

[0131] The 5' adaptor variant as described above has the following sequence, which has at least 80%, preferably 85%, more preferably 90%, even more preferably 95%, still even more preferably 99% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity with the sequence according to SEQ ID NO: 29. Such 5' adaptor variants still contain at least 2 nucleotides at their 3' end, and the at least 2 nucleotides are ribonucleotides or modified ribonucleotides. In addition, such 5' adaptor variants are still LNA-enhanced. In addition, such 5' adaptors still contain a spacer lacking a base. Additionally, such 5' adaptor variants are still capable of forming a stem-loop structure comprising a loop and a double-stranded stem. A person skilled in the art can easily evaluate whether a 5' adaptor variant is still capable of forming a stem-loop structure comprising a loop and a double-stranded stem. For example, the experimental section provides sufficient information in this regard.

[0132] In another specific embodiment, the 5' adaptor as described above does not contain a spacer lacking a base (e.g., a 1',2'-dideoxyribose spacer lacking a base) in the loop region.

[0133] The 5' adaptor as described above can be bound to any RNA target (especially to the 5' end of any RNA target) by simply exchanging the variable overhang. Specifically, only 6 to 15 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15) deoxynucleotides in the 5'-terminal nucleotide sequence of the 5' adaptor are selected in a manner reverse complementary to the target RNA to be detected (especially the 5' end of the target RNA). The 5' adaptor is particularly used in combination with the 3' adaptor.

[0134] The 5' adaptor as described above can exist in a denatured form or a renatured form.

[0135] In another embodiment, the target RNA is any single-stranded RNA having a 5'-phosphate moiety and a 3'-hydroxyl moiety. Specifically, the target RNA is an RNA having a length <200 ribonucleotides (e.g., between 10 and <200 ribonucleotides). More specifically, the target RNA is an RNA having a length between 10 and 100 nucleotides. Even more specifically, the target RNA is an RNA having a length between 10 and 50 nucleotides. The RNA is specifically miRNA or miRNA isomer (isomiR).

[0136] In a second aspect, the present invention relates to a 3' adaptor, which comprises, in the order from 5' to 3':

[0137] (i) A nucleotide sequence capable of forming a stem-loop structure, said stem-loop structure comprising a loop and a double-stranded stem, wherein the 5'-terminal nucleotide is phosphorylated, and wherein the nucleotide sequence is (preferably) locked nucleic acid-(LNA-)enhanced, and

[0138] (ii) A 3'-terminal nucleotide sequence comprising 6 to 15 (such as 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15) deoxynucleotides, wherein the 6 to 15 deoxynucleotides are reverse complementary to the 3'-terminal sequence of the target RNA, and wherein the deoxynucleotide at the 3'-terminal is an inverted deoxynucleotide.

[0139] Preferably, the LNA-enhanced sequence comprises 2 to 10 (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10), more preferably 3 locked nucleic acids, especially ribonucleotides.

[0140] In particular, the nucleotide sequence of the 3'-adapter comprises deoxynucleotides and ribonucleotides.

[0141] The length range of the 3'-adapter can be about 15 to about 60 nucleotides, such as 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59 or 60 nucleotides.

[0142] For example, after denaturation / at the time of denaturation, the 3'-adapter can exist as a linear polynucleotide, especially in a single-stranded form. The 3'-adapter is a polynucleotide that can be attached / linked to the 3'-end of the target RNA. When attached / linked to the 3'-end of the target RNA, the 3'-adapter has a stem-loop structure. Attachment / linkage is possible because the 3'-adapter comprises 6 to 15 (such as 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15) deoxynucleotides that are reverse complementary to the 3'-terminal sequence of the target RNA. The target RNA is preferably a miRNA or isomiR included in miRbase version 22.1.

[0143] In one embodiment, the nucleotide sequence capable of forming a stem-loop structure includes a first stem sequence at the 5' and a second stem sequence at the 3' that are reverse complementary to each other. Thus, the first stem sequence at the 5' and the second stem sequence at the 3' can form a double-stranded stem.

[0144] The length of the double-stranded stem can be between 5 and 20 nucleotides, such as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides.

[0145] Preferably, each of the first stem sequence located at the 5' and the second stem sequence located at the 3' has a length between 5 and 10 nucleotides, such as 5, 6, 7, 8, 9 or 10 nucleotides. Specifically, the first stem sequence located at the 5' and the second stem sequence located at the 3' have the same length, such as a length of 5, 6, 7, 8, 9 or 10 nucleotides.

[0146] More preferably, the first stem sequence located at the 5' and / or the second stem sequence located at the 3' is LNA-enhanced. Specifically, the LNA-enhanced sequence contains between 2 and 5 (such as 2, 3, 4 or 5), more particularly 3 locked nucleotides, specifically ribonucleotides. Examples of locked ribonucleotides are LNA-guanine, LNA-adenosine or LNA-cytosine. Even more preferably, the second stem sequence located at the 3' is LNA-enhanced. Specifically, the LNA-enhanced sequence contains 2 to 5 (such as 2, 3, 4 or 5), more particularly 3 locked nucleotides, specifically ribonucleotides. Examples of locked ribonucleotides are LNA-guanine, LNA-adenosine or LNA-cytosine. Specifically, each, every two or every three nucleotides in the first stem sequence located at the 5' and / or the second stem sequence located at the 3' can be LNA-enhanced.

[0147] Thus, the first stem sequence located at the 5' and / or the second stem sequence located at the 3' can contain a mixture of deoxynucleotides and ribonucleotides (such as LNA-enhanced), or the first stem sequence located at the 5' and / or the second stem sequence located at the 3' can contain ribonucleotides. The ribonucleotides include LNA-enhanced ribonucleotides.

[0148] In a further embodiment, the nucleotide sequence capable of forming a stem-loop structure comprises a loop sequence positioned between a first stem sequence located at the 5' and a second stem sequence located at the 3'. The loop sequence may comprise between 10 and 40 nucleotides, such as 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 nucleotides. Preferably, the loop sequence comprises between 12 and 20 (such as 12, 13, 14, 15, 16, 17, 18, 19 or 20) nucleotides (such as deoxynucleotides and / or ribonucleotides). More preferably, the loop sequence comprises between 12 and 20 (such as 12, 13, 14, 15, 16, 17, 18, 19 or 20) deoxynucleotides.

[0149] In another embodiment, the 3'-terminal sequence is configured to form a single-stranded 3' overhang after the formation of the stem-loop structure.

[0150] In a preferred embodiment, 6 to 15 (such as 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15) deoxynucleotides that are reverse complementary to the 3'-terminal sequence of the target RNA contain G and C, but not more than 4 in a row (such as 1, 2, 3 or 4).

[0151] In another preferred embodiment, the inverted deoxynucleotides are inverted dT, dA, dC or dG. In this regard, it should be noted that 3'-inverted deoxynucleotides produce 3'-3' linkages and thus, for example during RT-PCR, prevent unwanted nucleotide synthesis from the 3'-end of the adaptor. In addition, the 3'-inverted deoxynucleotide protects the sequence from cleavage by 3'-exonuclease.

[0152] In a more preferred embodiment, the 3'-adaptor has the following sequence from 5' to 3', or a variant thereof:

[0153]

[0154] (SEQ ID NO: 2), wherein " / 5Phos / " indicates that the 5'-terminal nucleotide is phosphorylated, wherein one or more nucleotides in the underlined part and / or one or more nucleotides in the double-underlined part are LNA-enhanced, wherein "(6-15x)N" represents a sequence that is reverse complementary to the 3'-terminal sequence of the target RNA, and wherein " / 3InvdT / " represents a 3'-inverted deoxynucleotide.

[0155] For example, in the underlined and / or double-underlined portions specified above, every one, every two, or every three nucleotides may be LNA-enhanced.

[0156] In an even more preferred embodiment, the 3'-adapter has the following sequence from 5' to 3', or is a variant of this sequence:

[0157]

[0158] (SEQ ID NO: 2), where " / 5Phos / " indicates that the 5'-terminal nucleotide is phosphorylated, where one or more (e.g., 1, 2, or 3) of the bold nucleotides are LNA-enhanced, where "(6-15x)N" represents a sequence that is reverse complementary to the 3'-terminal sequence of the target RNA, and where " / 3InvdT / " represents a 3'-inverted deoxynucleotide.

[0159] Specifically, the LNA-enhanced nucleotides are ribonucleotides.

[0160] The 3'-adapter variants as described above have a sequence that has at least 80%, preferably 85%, more preferably 90%, even more preferably 95%, and yet even more preferably 99% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity with the sequence according to SEQ ID NO: 2. Such 3'-adapter variants are still LNA-enhanced. In addition, in such 3'-adapter variants, the 5'-terminal nucleotide is still phosphorylated. In addition, in such 3'-adapter variants, the 3'-terminal deoxynucleotide is still an inverted deoxynucleotide. In addition, such 3'-adapter variants are still capable of forming a stem-loop structure containing a loop and a double-stranded stem. A person skilled in the art can easily evaluate whether a 3'-adapter variant is still capable of forming a stem-loop structure containing a loop and a double-stranded stem. For example, the experimental section provides sufficient information in this regard.

[0161] The 3'-adapter as described above can be bound to any RNA target (especially to the 3'-end of any RNA target) by simply exchanging the variable overhang. Specifically, it is only necessary to select 6 to 15 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15) deoxynucleotides in the 3'-terminal nucleotide sequence of the 3'-adapter in a way that they are reverse complementary to the target RNA to be detected (especially to the 3'-end of the target RNA). The 3'-adapter is particularly used in combination with the 5'-adapter.

[0162] The 3' adaptor as described above can exist in a denatured form or a renatured form.

[0163] In another embodiment, the target RNA is any single-stranded RNA having a 5' phosphate moiety and a 3' hydroxyl moiety. Specifically, the target RNA is an RNA having a length < 200 ribonucleotides (e.g., between 10 and < 200 ribonucleotides). More specifically, the target RNA is an RNA having a length between 10 and 100 ribonucleotides. Even more specifically, the target RNA is an RNA having a length between 10 and 50 ribonucleotides. The RNA is specifically miRNA or miRNA isomer (isomiR).

[0164] In a third aspect, the present invention relates to a combination, the combination comprising:

[0165] a 5' adaptor according to the first aspect, and

[0166] a 3' adaptor according to the second aspect.

[0167] The 5' adaptor according to the first aspect and the 3' adaptor according to the second aspect can be present in the combination alone or together. For example, the 5' adaptor according to the first aspect can be included in a (first) composition, while the 3' adaptor according to the second aspect can be included in another / different (second) composition. Alternatively, the 5' adaptor according to the first aspect and the 3' adaptor according to the second aspect can be included in a single composition. The composition can be an aqueous solution, such as water or a buffer solution.

[0168] In a preferred embodiment, the total length of the 5'-terminal nucleotide sequence comprising 6 to 15 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15) deoxynucleotides and the 3'-terminal nucleotide sequence comprising 6 to 15 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, and 15) deoxynucleotides is at least 2 (e.g., 2, 3, 4, 5, or 6) nucleotides shorter than the length of the target RNA.

[0169] In a preferred embodiment, the 5' adaptor and the 3' adaptor are combined / are part of a combination, the 5' adaptor having the following sequence from 5' to 3' or a variant of the sequence: (SEQ ID NO: 1), wherein "r" represents a ribonucleotide, wherein "(6-15x)N" represents a sequence reverse complementary to the 5'-terminal sequence of the target RNA, and wherein one or more nucleotides in the underlined part and / or one or more nucleotides in the double-underlined part are LNA-enhanced;

[0170] The 3'-adapter has the following sequence from 5' to 3' or a variant of this sequence: (SEQ ID NO: 2), wherein, " / 5Phos / " indicates that the 5'-terminal nucleotide is phosphorylated, wherein one or more nucleotides in the underlined part and / or one or more nucleotides in the double-underlined part are LNA-enhanced, wherein "(6-15x)N" represents a sequence reverse complementary to the 3'-terminal sequence of the target RNA, and wherein " / 3InvdT / " represents a 3'-inverted deoxynucleotide.

[0171] Specifically, the LNA-enhanced nucleotides are ribonucleotides.

[0172] In a more preferred embodiment, the 5'-adapter and the 3'-adapter are combined / are part of a combination, and the 5'-adapter has the following sequence from 5' to 3' or a variant of this sequence: (SEQ ID NO: 1), wherein "r" represents a ribonucleotide, wherein "(6-15x)N" represents a sequence reverse complementary to the 5'-terminal sequence of the target RNA, and wherein one or more (e.g., 1, 2, or 3) of the nucleotides in bold are LNA-enhanced;

[0173] The 3'-adapter has the following sequence from 5' to 3' or a variant of this sequence:

[0174] (SEQ ID NO: 2), wherein, " / 5Phos / " indicates that the 5'-terminal nucleotide is phosphorylated, wherein one or more (e.g., 1, 2, or 3) of the nucleotides in bold are LNA-enhanced, wherein "(6-15x)N" represents a sequence reverse complementary to the 3'-terminal sequence of the target RNA, and wherein " / 3InvdT / " represents a 3'-inverted deoxynucleotide.

[0175] Specifically, the LNA-enhanced nucleotides are ribonucleotides.

[0176] In a specific embodiment, the 5'-adapter and the 3'-adapter are combined / are part of a combination, and the 5'-adapter has the following sequence from 5' to 3' or a variant of this sequence: (SEQ ID NO: 29), wherein "r" represents a ribonucleotide, wherein "(6-15x)N" represents a sequence reverse complementary to the 5'-terminal sequence of the target RNA, wherein "idSp" represents a spacer lacking a base, and wherein one or more nucleotides in the underlined part and / or one or more nucleotides in the double-underlined part are LNA-enhanced;

[0177] The 3'-adapter has the following sequence from 5' to 3' or a variant of this sequence:

[0178] (SEQ ID NO: 2), wherein, " / 5Phos / " indicates that the 5'-terminal nucleotide is phosphorylated, wherein one or more nucleotides in the underlined part and / or one or more nucleotides in the double-underlined part are LNA-enhanced, wherein "(6-15x)N" represents a sequence that is reverse complementary to the 3'-terminal sequence of the target RNA, and wherein " / 3InvdT / " represents a 3'-inverted deoxynucleotide.

[0179] In a more specific embodiment, the 5'-adapter and the 3'-adapter are combined / are part of a combination, the 5'-adapter having the following sequence from 5' to 3' or a variant of this sequence: (SEQ ID NO: 29), wherein, "r" represents a ribonucleotide, wherein "(6-15x)N" represents a sequence that is reverse complementary to the 5'-terminal sequence of the target RNA, wherein "idSp" represents a spacer lacking a base, and wherein one or more (e.g., 1, 2, or 3) of the nucleotides in bold are LNA-enhanced;

[0180] The 3'-adapter has the following sequence from 5' to 3' or a variant of this sequence: (SEQ ID NO: 2), wherein, " / 5Phos / " indicates that the 5'-terminal nucleotide is phosphorylated, wherein one or more (e.g., 1, 2, or 3) of the nucleotides in bold are LNA-enhanced, wherein "(6-15x)N" represents a sequence that is reverse complementary to the 3'-terminal sequence of the target RNA, and wherein " / 3InvdT / " represents a 3'-inverted deoxynucleotide.

[0181] Specifically, the LNA-enhanced nucleotides are ribonucleotides.

[0182] In a fourth aspect, the present invention relates to a method of ligating two adapters to a target RNA in a sample, the method comprising the following steps:

[0183] (i) providing a composition comprising the denatured target RNA in the sample, the renatured 5'-adapter according to the first aspect, and the renatured 3'-adapter according to the second aspect, wherein the 5'-adapter and the 3'-adapter are annealed to the target RNA, and

[0184] (ii) ligating the 5'-adapter and the 3'-adapter to the target RNA using / by means of a double-stranded RNA ligase, thereby producing a ligation product.

[0185] Annealing the adaptor (especially the 5' adaptor and 3' adaptor) to the target RNA requires the target RNA to be in a denatured form. In one embodiment, the denatured target RNA is generated by heating the target RNA between 65°C and 75°C (e.g., 65°C, 66°C, 67°C, 68°C, 69°C, 70°C, 71°C, 72°C, 73°C, 74°C or 75°C), preferably at 70°C, for between 1 minute and 3 minutes (e.g., 1 minute, 2 minutes or 3 minutes), preferably 2 minutes.

[0186] For example, the denatured target RNA is generated by heating the target RNA at 70°C for 2 minutes.

[0187] Preferably, the target RNA is placed on ice immediately after denaturation.

[0188] For the denaturation step, preferably the target RNA is provided to an aqueous solution (such as water) or to a buffer solution.

[0189] For the adaptor (especially the 5' adaptor and 3' adaptor), a denaturation and renaturation step is required so that it can form a stem-loop structure that allows annealing to the target RNA. Annealing is the process of heating and cooling the adaptor with complementary sequences. Heat breaks all hydrogen bonds, and cooling allows new bonds to form between the sequences. During this process, the adaptor (especially the 5' adaptor and 3' adaptor) attaches to the denatured target RNA and forms its characteristic stem-loop structure. Specifically, the 5' adaptor attaches to the 5' end of the target RNA, while the 3' adaptor attaches to the 3' end of the target RNA. Preferably, the adaptor (especially the 5' adaptor and 3' adaptor) is denatured and renatured together (i.e., in a common reaction vessel). More preferably, the denaturation / renaturation of the adaptor (especially the 5' adaptor and 3' adaptor) is carried out separately in the absence of the target RNA.

[0190] In one embodiment, the renatured 5' adaptor is generated by:

[0191] denaturing the 5' adaptor between 75°C and 85°C (e.g., 75°C, 76°C, 77°C, 78°C, 79°C, 80°C, 81°C, 82°C, 83°C, 84°C or 85°C), preferably at 82°C, for between 1 minute and 3 minutes (e.g., 1 minute, 2 minutes or 3 minutes), preferably 2 minutes, and

[0192] renaturing the 5' adaptor by cooling to 4°C (preferably at a rate of 0.1°C / s).

[0193] For example, the renatured 5' adaptor is generated by denaturing the 5' adaptor at 82°C for 2 minutes and renaturing the 5' adaptor by cooling to 4°C (preferably at a rate of 0.1°C / s).

[0194] In an additional or alternative embodiment, the renatured 3' adaptor is generated by the following:

[0195] Between 75 °C and 85 °C (such as 75 °C, 76 °C, 77 °C, 78 °C, 79 °C, 80 °C, 81 °C, 82 °C, 83 °C, 84 °C or 85 °C), preferably at 82 °C, denature the 3' adaptor for between 1 and 3 minutes (such as 1 minute, 2 minutes or 3 minutes), preferably 2 minutes, and

[0196] Renature the 3' adaptor by cooling to 4 °C (preferably at a rate of 0.1 °C / s).

[0197] For example, generate the renatured 3' adaptor by denaturing the 3' adaptor at 82 °C for 2 minutes and renaturing the 3' adaptor by cooling to 4 °C (preferably at a rate of 0.1 °C / s).

[0198] For the denaturation and renaturation steps, preferably provide the adaptors (especially the 5' adaptor and the 3' adaptor) to an aqueous buffer containing 10 mM TRIS HCl pH 7.5, 50 mM NaCl and 0.1 mM EDTA. In other words, preferably perform the denaturation and renaturation of the adaptors (especially the 5' adaptor and the 3' adaptor) in an aqueous buffer containing 10 mM TRIS HCl pH 7.5, 50 mM NaCl and 0.1 mM EDTA.

[0199] Specifically, produce the composition provided in step (i) of the above method by mixing the denatured target RNA, the renatured 5' adaptor according to the first aspect and the renatured 3' adaptor according to the second aspect with each other, thereby annealing the 5' adaptor and the 3' adaptor to the target RNA. Thus, the adaptors (especially the 5' adaptor and the 3' adaptor) are simultaneously annealed / ligated to the target RNA. In addition, before the annealing / ligation reaction, the denatured target RNA is only mixed with the adaptors (especially the 5' adaptor and the 3' adaptor). In other words, before the annealing / ligation reaction, the adaptors (especially the 5' adaptor and the 3' adaptor) are only mixed with the target RNA. The advantage of this is that a stable adaptor structure is formed in the absence of RNA, and this process can be interfered with by abundant RNA such as ribosomal RNA.

[0200] In particular, annealing of the 5' adaptor to the target RNA generates a double-stranded (DNA / RNA) hybrid that contains an RNA-OH-3' / 5'-P-RNA nick between the 3' end of the adaptor and the 5' end of the target RNA. This is an effective substrate for ligation by a double-stranded RNA ligase.

[0201] In addition, specifically, annealing of the 3'-adapter to the target RNA generates a double-stranded (DNA / RNA) hybrid containing an RNA-OH-3' / 5'-P-RNA nick between the 3'-end of the target RNA and the 5'-end of the adapter. This is the substrate for ligation by a double-stranded RNA ligase.

[0202] Ligation is typically carried out in a ligation buffer. Exemplary ligation buffers are described in the experimental section of this patent application. In a preferred embodiment, the ligation buffer contains polyethylene glycol (PEG, e.g., PEG 8000 (5%)) and / or adenosine triphosphate (ATP, e.g., 1 mM ATP). The inventors have noted that PEG has an effect on the ligation reaction, functioning as a molecular crowder; and / or ATP has an effect on the ligation reaction, such that increasing the concentration favors the ligation reaction.

[0203] In one embodiment, the ligation is carried out between 36 °C and 38 °C (e.g., 36 °C, 37 °C, or 38 °C), preferably 37 °C, for between 30 minutes and 1.5 hours (e.g., 30 minutes, 35 minutes, 40 minutes, 45 minutes, 50 minutes, 55 minutes, 1 hour, 1.25 hours, or 1.5 hours), preferably 1 hour, or

[0204] the ligation is carried out between 15 °C and 20 °C (e.g., 15 °C, 16 °C, 17 °C, 18 °C, 19 °C, or 20 °C), preferably at 16 °C, for between 30 minutes and 2 hours (e.g., 30 minutes, 35 minutes, 40 minutes, 45 minutes, 50 minutes, 55 minutes, 1 hour, 1.25 hours, 1.5 hours, 1.75 hours, or 2 hours), preferably 1 hour or 2 hours, and then overnight at 12 °C. Overnight can mean a time period between 8 hours and 12 hours (e.g., 8 hours, 9 hours, 10 hours, 11 hours, or 12 hours).

[0205] For example, the ligation is carried out at 37 °C for 1 hour, or

[0206] the ligation is carried out at 16 °C for 1 hour or 2 hours and then overnight at 12 °C. Overnight can mean a time period between 8 hours and 12 hours (e.g., 8 hours, 9 hours, 10 hours, 11 hours, or 12 hours).

[0207] The double-stranded RNA ligase can be any ligase capable of ligating double-stranded RNA nicks / RNA structures. Preferably, the double-stranded RNA ligase is T4 RNA ligase 2 (Rnl2) or Kod1 ligase.

[0208] In this regard, it should be noted that only fully hybridized molecules can provide a substrate for double-stranded RNA ligases (especially Rnl2). In addition, in the case of a gap of more than two nucleotides or an overhang on either strand, Rnl2 will ligate the molecules with much lower efficiency. The adaptors described herein (especially the 5' adaptor and the 3' adaptor) provide a dsRNA environment with an overhang of 6 to 15 nucleotides hybridized to the target RNA. Finally, the 5'-phosphate moiety on the target RNA molecule is also required for efficient ligation by Rnl2.

[0209] By using / by ligating an adaptor (especially the 5' adaptor and the 3' adaptor) to the target RNA with a double-stranded RNA ligase, a ligation product is produced. The ligation product can be described as a (DNA / RNA) hybrid molecule comprising at least one adaptor and the target RNA. For example, the ligation product can comprise a 5' adaptor and the target RNA (such as miRNA or isomiR). The ligation product can comprise a 3' adaptor and the target RNA (such as miRNA or isomiR). In addition, the ligation product can comprise a 5' adaptor, a 3' adaptor, and the target RNA (such as miRNA or isomiR).

[0210] In a fifth aspect, the present invention relates to a method for determining and / or quantifying a target RNA in a sample, the method comprising the steps of:

[0211] (i) Performing the method according to the fourth aspect,

[0212] (ii) Reverse transcribing the ligation product, thereby obtaining a cDNA product from the target RNA, and

[0213] (iii) Amplifying the cDNA, thereby determining and / or quantifying the target RNA.

[0214] In one embodiment, reverse transcription of the ligation product is performed by:

[0215] (iia) Annealing a primer for reverse transcription (RT primer) to the ligation product, and

[0216] (iib) Reverse transcribing the ligation product by using a reverse transcriptase (RT).

[0217] In a preferred embodiment, annealing of the primer for reverse transcription (RT primer) to the ligation product in step (iia) is performed as follows:

[0218] Between 60 °C and 80 °C (such as 60 °C, 61 °C, 62 °C, 63 °C, 64 °C, 65 °C, 66 °C, 67 °C, 68 °C, 69 °C, 70 °C, 71 °C, 72 °C, 73 °C, 74 °C, 75 °C, 76 °C, 77 °C, 78 °C, 79 °C or 80 °C), preferably at 65 °C or 75 °C, for between 2 minutes and 7 minutes (such as 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes or 7 minutes), preferably 3 minutes or 5 minutes.

[0219] For example, the annealing is carried out at 65 °C for between 2 minutes and 7 minutes (such as 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes or 7 minutes), preferably 5 minutes. Alternatively, the annealing is carried out at 75 °C for between 2 minutes and 7 minutes (such as 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes or 7 minutes), preferably 3 minutes.

[0220] In one (additional or alternative) preferred embodiment, the reverse transcription of the ligation product carried out using reverse transcriptase (RT) in step (iib) is carried out as follows:

[0221] Between 40 °C and 65 °C (such as 40 °C, 41 °C, 42 °C, 43 °C, 44 °C, 45 °C, 46 °C, 47 °C, 48 °C, 49 °C, 50 °C, 51 °C, 52 °C, 53 °C, 54 °C, 55 °C, 56 °C, 57 °C, 58 °C, 59 °C, 60 °C, 61 °C, 62 °C, 63 °C, 64 °C or 65 °C), preferably at 50 °C, 55 °C, 58 °C or 62 °C, for between 10 minutes and 40 minutes (such as 10 minutes, 11 minutes, 12 minutes, 13 minutes, 14 minutes, 15 minutes, 16 minutes, 17 minutes, 18 minutes, 19 minutes, 20 minutes, 21 minutes, 22 minutes, 23 minutes, 24 minutes, 25 minutes, 26 minutes, 27 minutes, 28 minutes, 29 minutes, 30 minutes, 31 minutes, 32 minutes, 33 minutes, 34 minutes, 35 minutes, 36 minutes, 37 minutes, 38 minutes, 39 minutes, 40 minutes), preferably 15 minutes or 30 minutes, and

[0222] Subsequently between 75 °C and 90 °C (such as 75 °C, 76 °C, 77 °C, 78 °C, 79 °C, 80 °C, 81 °C, 82 °C, 83 °C, 84 °C, 85 °C, 86 °C, 87 °C, 88 °C, 89 °C or 90 °C), preferably 85 °C, for between 2 minutes and 4 minutes (such as 2 minutes, 3 minutes or 4 minutes), preferably 3 minutes; or

[0223] Between 60 °C and 75 °C (such as 60 °C, 61 °C, 62 °C, 63 °C, 64 °C, 65 °C, 66 °C, 67 °C, 68 °C, 69 °C, 70 °C, 71 °C, 72 °C, 73 °C, 74 °C or 75 °C), preferably at 68 °C, for between 10 minutes and 30 minutes (such as 10 minutes, 11 minutes, 12 minutes, 13 minutes, 14 minutes, 15 minutes, 16 minutes, 17 minutes, 18 minutes, 19 minutes, 20 minutes, 21 minutes, 22 minutes, 23 minutes, 24 minutes, 25 minutes, 26 minutes, 27 minutes, 28 minutes, 29 minutes or 30 minutes), preferably 15 minutes.

[0224] In particular, the reverse transcriptase (RT) is Maxima H-RT or Tth polymerase.

[0225] For example, in the case where the reverse transcriptase (RT) is Maxima H-RT, the reverse transcription is carried out at 55 °C for 30 minutes, followed by 3 minutes at 85 °C.

[0226] Alternatively, the reverse transcription is carried out at 50 °C, 58 °C or 62 °C for 15 minutes and then at 85 °C for 3 minutes.

[0227] For example, in the case where the reverse transcriptase (RT) is Tth polymerase, the reverse transcription is carried out at 68 °C for 15 minutes.

[0228] In the reverse transcription reaction, the 3' adaptor linked to the 3' end of the target RNA is extended (especially in the 5' to 3' direction) to form a strand that is reverse complementary to the target RNA. Specifically, a cDNA copy of the ligation product is generated in the reverse transcription reaction. For this process, the reverse transcriptase (RT) requires an RT primer. In particular, the RT primer is reverse complementary to the nucleotide sequence of the 3' adaptor that can form a stem-loop structure containing a loop and a double-stranded stem. Therefore, the RT primer sequence depends on the 3' adaptor sequence.

[0229] In one specific embodiment, the RT primer has the following sequence from 5' to 3' or is a variant of this sequence: (SEQ ID NO: 3). Thus, the RT primer is reverse complementary to at least a portion of the 3' adaptor sequence as described above. Specifically, the RT primer is reverse complementary to the nucleotides in the second stem sequence and the loop sequence located at the 3'. As mentioned above, the 3' adaptor sequence is preferably the following from 5' to 3':

[0230] (SEQ ID NO: 2), wherein, " / 5Phos / " indicates that the 5'-terminal nucleotide is phosphorylated, wherein one or more nucleotides in the underlined part and / or one or more nucleotides in the double-underlined part are LNA-enhanced, wherein (6-15x)N represents a sequence reverse complementary to the 3'-terminal sequence of the target RNA, and wherein " / 3InvdT / " represents a 3'-inverted deoxynucleotide. Specifically, the LNA-enhanced nucleotides are ribonucleotides.

[0231] The RT primer variant has the following sequence, which has at least 80%, preferably 85%, more preferably 90%, even more preferably 95%, and still even more preferably 99% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity with the sequence according to SEQ ID NO: 3. Such RT primer variants are still capable of binding to the 3'-adapter sequence and allowing reverse transcription to be carried out by a reverse transcriptase (RT, such as Maxima H-RT or Tth polymerase). Those skilled in the art can easily evaluate whether the RT primer variant is still capable of binding to the 3'-adapter sequence and allowing reverse transcription. For example, the experimental section provides sufficient information in this regard.

[0232] To determine the target RNA, its cDNA must be amplified (see step (iii) of the method described above). The determination can be quantitative, so that the amount or copy number of the target RNA in the sample can be determined. Alternatively, the determination can be qualitative, so that the presence of the target RNA in the sample can be determined, but its level may not be measured. Therefore, this determination allows the determination and quantification of the target RNA in the sample.

[0233] In a further (additional or alternative) preferred embodiment, the method further includes a step of cDNA pre-amplification between step (ii) and step (iii). The pre-amplification reaction is a "simple" PCR reaction and is usually carried out in a "simple" PCR machine, for example, where no fluorescence signal is detected and no TaqMan probe is used. Usually, a low cycle number is used.

[0234] Pre-amplification requires a DNA polymerase, such as Taq polymerase. The purpose of the cDNA pre-amplification step is to improve the sensitivity of the determination. In a specific embodiment, the cDNA pre-amplification is carried out with a forward primer and a reverse primer, the forward primer having the following sequence from 5' to 3' or a variant having this sequence: (SEQ ID NO: 4); the reverse primer has the following sequence from 5' to 3' or a variant having this sequence: (SEQ ID NO: 5). The forward primer is derived from the 5' adaptor, and the reverse primer is derived from the 3' adaptor. These primers are designed such that pre-amplification depends entirely on the ligation of both the 5' adaptor and the 3' adaptor, thereby specifically pre-amplifying the ligation product.

[0235] In this regard, it should be noted that the reverse primer having the following sequence from 5' to 3' is reverse complementary to at least a portion of the 3' adaptor sequence as described above: (SEQ ID NO: 5). Specifically, the reverse primer is reverse complementary to the nucleotides in the second stem sequence and the loop sequence located at the 3'. As described above, the 3' adaptor sequence is preferably the following from 5' to 3':

[0236] (SEQ ID NO: 2), wherein, " / 5Phos / " indicates that the 5'-terminal nucleotide is phosphorylated, wherein one or more nucleotides in the underlined portion and / or one or more nucleotides in the double-underlined portion are LNA-enhanced, wherein, (6 - 15x)N represents a sequence reverse complementary to the 3'-terminal sequence of the target RNA, and wherein, " / 3InvdT / " represents a 3'-inverted deoxynucleotide. Specifically, the LNA-enhanced nucleotides are ribonucleotides.

[0237] Furthermore, it should be noted that the forward primer having the following sequence from 5' to 3' is alternatively reverse complementary to the DNA product generated by the 5' adaptor in the reverse transcription reaction: (SEQ ID NO: 4). As described above, the 5' adaptor sequence is preferably the following from 5' to 3': (SEQ ID NO: 1), wherein, "r" represents a ribonucleotide, wherein, "(6 - 15x)N" represents a sequence reverse complementary to the 5'-terminal sequence of the target RNA, and wherein one or more nucleotides in the underlined portion and / or one or more nucleotides in the double-underlined portion are LNA-enhanced. Specifically, the LNA-enhanced nucleotides are ribonucleotides. Alternatively, the 5' adaptor sequence from 5' to 3' is the following: (SEQ ID NO: 29), wherein, "r" represents a ribonucleotide, wherein, "(6 - 15x)N" represents a sequence reverse complementary to the 5'-terminal sequence of the target RNA, wherein, "idSp" represents a spacer lacking a base, and wherein one or more nucleotides in the underlined portion and / or one or more nucleotides in the double-underlined portion are LNA-enhanced.

[0238] Any pre-amplification method can be used. In a preferred embodiment, polymerase chain reaction (PCR) is used for pre-amplification. The pre-amplification using PCR can be carried out as follows: 95 °C for 3 minutes, followed by 12 cycles of 95 °C for 15 seconds and 58 °C for 4 minutes. Subsequently, the pre-amplified sample is kept at 4 °C.

[0239] After pre-amplification or instead of pre-amplification, an amplification reaction is carried out. Amplification requires a DNA polymerase, such as Taq polymerase.

[0240] In a specific embodiment, the amplification reaction is carried out with a forward primer and a reverse primer, the forward primer having the following sequence from 5' to 3' or a variant having this sequence: (SEQ ID NO: 4); the reverse primer having the following sequence from 5' to 3' or a variant having this sequence: (SEQ ID NO: 5) (see above).

[0241] Any amplification method can be used.

[0242] Specifically, polymerase chain reaction (PCR) is used for amplification.

[0243] More specifically, the PCR is selected from the group consisting of: real-time PCR (quantitative PCR or qPCR, preferably Taq-man qPCR), multiplex PCR, nested PCR, high-fidelity PCR, fast PCR, hot-start PCR, and high-GC PCR.

[0244] Even more specifically, TaqMan qPCR is carried out with a forward primer and a reverse primer, the forward primer having the following sequence from 5' to 3' or a variant having this sequence: (SEQ IDNO: 4); the reverse primer having the following sequence from 5' to 3' or a variant having this sequence: (SEQ ID NO: 5). The forward primer is derived from the 5' adaptor, and the reverse primer is derived from the 3' adaptor. These primers are designed such that amplification is completely dependent on the ligation of both the 5' adaptor and the 3' adaptor, thereby specifically amplifying the ligation product. The amplification using Taq-man qPCR can be carried out as follows: 95 °C for 20 seconds, followed by 40 cycles of 95 °C for 1 second and 60 °C for 20 seconds. Subsequently, the amplified sample is kept at 4 °C.

[0245] Even more specifically, TaqMan qPCR is performed in the presence of TaqMan probes. The sequence of the TaqMan probe depends on the sequence of the RNA target. TaqMan probes are hydrolysis probes designed to enhance the specificity of quantitative PCR. Generally, the TaqMan probe principle relies on the 5'-3' exonuclease activity of Taq polymerase to cleave a dual-labeled probe during hybridization to a complementary target sequence and fluorophore-based detection. As in other quantitative PCR methods, the resulting fluorescent signal allows for the quantitative measurement of product accumulation during the exponential phase of PCR. However, TaqMan probes significantly enhance the specificity of detection.

[0246] The forward primer variant as described above has the following sequence, which has at least 80%, preferably 85%, more preferably 90%, even more preferably 95%, and yet even more preferably 99% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity with the sequence according to SEQ ID NO: 4. Such forward primer variants are still capable of binding to the DNA product generated by the 5' adaptor in the reverse transcription reaction. In other words, the forward primer variant must have the same sequence as the 5' adaptor at least partially (e.g., over a length of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 nucleotides, or 21 nucleotides). Specifically, in the loop region of the 5' adaptor and in the second stem sequence located 3', the sequence is the same, for example, over a length of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 nucleotides, or 21 nucleotides. A person skilled in the art can easily evaluate whether the forward primer variant is still capable of binding to the DNA product generated by the 5' adaptor in the reverse transcription reaction. For example, the experimental section provides sufficient information in this regard.

[0247] In addition, the reverse primer variant as described above has the following sequence, which has at least 80%, preferably 85%, more preferably 90%, even more preferably 95%, still even more preferably 99% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity with the sequence according to SEQ ID NO: 5. Such reverse primer variants are still capable of binding to the 3' adapter sequence and allowing cDNA pre-amplification / amplification. A person skilled in the art can easily evaluate whether the reverse primer variant is still capable of binding to the 3' adapter sequence and allowing cDNA pre-amplification / amplification. For example, the experimental section provides sufficient information in this regard.

[0248] In the method according to the fourth and / or fifth aspect of the present invention, the sample is preferably a biological sample. A biological sample can be any sample of biological origin. For example, a biological sample can be a body fluid sample (e.g., a blood sample or a urine sample) or a tissue sample (e.g., a tissue biopsy sample). Biological samples can be mixed or combined. For example, the sample can be a mixture of a blood sample and a urine sample.

[0249] The body fluid sample can be a urine sample, a blood sample, a sputum sample, a milk sample, a cerebrospinal fluid (CSF) sample, a cerumen (earwax) sample, a gastric juice sample, a mucus sample, a lymph sample, an endolymph sample, a perilymph sample, an ascitic fluid sample, a pleural fluid sample, a saliva sample, a sebum (skin oil) sample, a semen sample, a sweat sample, a tear sample, a buccal swab, a vaginal secretion sample, a liquid biopsy or a vomit sample, including their components or fractions. The term "body fluid sample" also encompasses body fluid fractions, such as blood fractions, urine fractions or sputum fractions. Body fluid samples can be mixed or combined. Thus, the body fluid sample can be a mixture of a blood and a urine sample or a mixture of a blood and a cerebrospinal fluid sample.

[0250] More preferably, the biological sample is a blood sample. Even more preferably, the blood sample is whole blood or a blood fraction, preferably blood cells (e.g., red blood cells, white blood cells, and / or platelets), serum, or plasma. For example, the blood cell fraction includes red blood cells, white blood cells, and / or platelets. A whole blood sample can be collected in a blood collection tube. For example, it can be collected in a PAXgene Blood RNA tube, a Tempus Blood RNA tube, an EDTA tube, a sodium citrate tube, a heparin tube, or an ACD tube (citrate dextrose). A whole blood sample can also be collected by a blood spot technique, such as using a Mitra Microsampling Device. This technique requires a smaller sample volume, typically 45 - 60 μL or less for humans. For example, whole blood can be extracted from a patient by finger prick using a needle or lancet. Thus, the whole blood sample can be in the form of a blood droplet. Then the blood droplet is placed on an absorbent probe capable of absorbing whole blood, such as a hydrophilic polymer material like cellulose. Once sampling is complete, the blood spot is dried in air and then transferred or mailed to a laboratory for processing. Since the blood is dry, it is not considered hazardous. Therefore, no special precautions are required during handling or transportation. Once at the analysis site, the desired component (e.g., miRNA) is extracted from the dried blood spot into a supernatant, and then the supernatant is further analyzed.

[0251] In the method according to the fourth and / or fifth aspect of the present invention, the sample can also be a sample containing total RNA. Specifically, the total RNA includes RNA with a length < 200 nucleotides, such as miRNA or miRNA isoforms (isomiR). Specifically, the sample used in the method according to the fourth and / or fifth aspect of the present invention contains total cellular RNA. Specifically, the total cellular RNA includes RNA with a length < 200 nucleotides, such as miRNA or miRNA isoforms (isomiR). Total cellular RNA can be obtained from blood cells (e.g., red blood cells, white blood cells, and / or platelets).

[0252] In a sixth aspect, the present invention relates to a method for diagnosing a disease or disorder in a patient, the method comprising the steps of:

[0253] (ia) performing the method according to the fourth and / or fifth aspect to determine the presence or absence of a target RNA, and

[0254] (iia) diagnosing whether the patient has the disease or disorder based on the presence or absence of the target RNA; or

[0255] (ib) performing the method according to the fourth and / or fifth aspect to quantify the target RNA,

[0256] (iib) comparing the quantified target RNA with a reference, and

[0257] (iiib) diagnosing whether the patient has the disease or disorder based on the comparison.

[0258] Accordingly, the present invention relates to a method for diagnosing a disease or disorder in a patient, the method comprising the steps of:

[0259] (i) performing the method according to the fourth and / or fifth aspect to determine the presence or absence of target RNA, and

[0260] (ii) diagnosing whether the patient has the disease or disorder based on the presence or absence of the target RNA.

[0261] Accordingly, the presence or absence of target RNA indicates a disease or disorder. For example, if the target RNA is present or absent, the patient is diagnosed as having the disease or disorder. Alternatively, if the target RNA is present or absent, the patient is diagnosed as not having the disease or disorder.

[0262] Alternatively, the present invention relates to a method for diagnosing a disease or disorder in a patient, the method comprising the steps of:

[0263] (i) performing the method according to the fourth and / or fifth aspect to quantify the target RNA,

[0264] (ii) comparing the quantified target RNA with a reference, and

[0265] (iii) diagnosing whether the patient has the disease or disorder based on the comparison.

[0266] Specifically, the reference is a reference target RNA. More specifically, the reference is obtained from one or more healthy (control) subjects. Even more specifically, the reference is the quantified reference target RNA determined in one or more healthy (control) subjects. If more than two healthy (control) subjects have been tested, the amount of the reference target RNA may be expressed as an average. For example, if the quantified target RNA is higher or lower than the quantified reference target RNA obtained from, for example, one or more healthy (control) subjects, the patient is diagnosed as having the disease or disorder. Alternatively, if the quantified target RNA is higher or lower than the quantified reference target RNA obtained from, for example, one or more healthy (control) subjects, the patient is diagnosed as not having the disease or disorder. The reference may also be a reference obtained from one or more (control) subjects having the disease or disorder.

[0267] In a preferred embodiment, the quantified target RNA is a miRNA or a miRNA isoform (isomiR). In another preferred embodiment, the quantified reference target RNA is a miRNA or a miRNA isoform (isomiR). In particular, the target RNA and the reference target RNA are the same, i.e., from the same RNA type, for example, both RNAs are miRNAs.

[0268] In one (additional or alternative) preferred embodiment, the disease is selected from the group consisting of neurodegenerative diseases, autoimmune diseases, infectious diseases, and cancers. In a more preferred embodiment,

[0269] (i) the neurodegenerative diseases are selected from the group consisting of: Alzheimer's disease (AD) and other dementias, Parkinson's disease (PD) and PD-related diseases, prion diseases, motor neuron diseases (MND), Huntington's disease (HD), spinocerebellar ataxia (SCA), spinal muscular atrophy (SMA), AIDS dementia complex, and atherosclerosis;

[0270] (ii) the autoimmune diseases are selected from the group consisting of: diabetes, rheumatoid arthritis (RA), multiple sclerosis (MS), systemic lupus erythematosus (lupus), Graves' disease, Sjogren's syndrome, Hashimoto's thyroiditis, myasthenia gravis, vasculitis, pernicious anemia, and celiac disease;

[0271] (iii) the infectious diseases are selected from the group consisting of: viral infections, preferably chronic or persistent viral infections, bacterial infections, parasitic infections; or

[0272] (iv) the cancers are selected from the group consisting of: skin cancer, nasopharyngeal cancer, neuroendocrine cancer, lung cancer, colon cancer, urothelial cancer, bladder cancer, liver cancer, ovarian cancer, gastric cancer, esophageal cancer, pancreatic cancer, kidney cancer, gastric cancer, esophageal cancer, breast cancer, kidney cancer, head and neck cancer, brain cancer, lymphoma, blood cancer, squamous cell carcinoma, laryngeal cancer, retinoblastoma, prostate cancer, cervical cancer, uterine cancer, testicular cancer, bone cancer, lymphoma, and leukemia.

[0273] In a seventh aspect, the present invention relates to a kit, the kit comprising:

[0274] a 5' adaptor according to the first aspect, and

[0275] a 3' adaptor according to the second aspect; or

[0276] a combination according to the third aspect.

[0277] In a preferred embodiment, the kit further comprises a double-stranded RNA ligase, preferably T4 RNA ligase 2 (Rnl2) or Kod1 ligase. In this case, the kit preferably further comprises instructions on how to carry out the method according to the fourth aspect. The kit with this composition preferably further allows the implementation of the method according to the fourth aspect.

[0278] In an (additional or alternative) preferred embodiment, the kit further comprises

[0279] reverse transcriptase (RT), preferably Maxima H-RT or Tth polymerase, and RT primers allowing reverse transcription of the target RNA to obtain a cDNA product from the target RNA, and / or

[0280] DNA polymerase, preferably Taq polymerase, and forward and / or reverse primers allowing pre-amplification and / or amplification of the cDNA.

[0281] In this case, the kit preferably further comprises instructions on how to carry out the method according to the fifth aspect. The kit with this composition preferably further allows the implementation of the method according to the fifth aspect.

[0282] Optionally, the kit further comprises a TaqMan probe.

[0283] Regarding the specific RT primers, forward primers and / or reverse primers, see the fifth aspect of the present invention.

[0284] In another (additional or alternative) preferred embodiment, the kit further comprises a reference. In this case, the kit preferably further comprises instructions on how to carry out the method according to the sixth aspect. The kit with this composition preferably further allows the implementation of the method according to the sixth aspect.

[0285] Regarding the reference, see the sixth aspect of the present invention.

[0286] In view of the above, in a more preferred embodiment, the kit comprises the following components:

[0287] (i) a 5' adaptor according to the first aspect and a 3' adaptor according to the second aspect, or a combination according to the third aspect,

[0288] (ii) reverse transcriptase (RT), preferably Maxima H-RT or Tth polymerase, and RT primers allowing reverse transcription of the target RNA to obtain a cDNA product from the target RNA, and / or

[0289] (iii) DNA polymerase, preferably Taq polymerase, and forward and / or reverse primers allowing pre-amplification and / or amplification of the cDNA.

[0290] Optionally, the kit further comprises a TaqMan probe.

[0291] In an even more preferred embodiment, the kit comprises the following components:

[0292] (i) A 5'-adapter and a 3'-adapter, the 5'-adapter having the following sequence from 5' to 3' or a variant of this sequence: (SEQ ID NO: 1), wherein "r" represents a ribonucleotide, wherein "(6 - 15x)N" represents a sequence reverse complementary to the 5'-terminal sequence of the target RNA, and wherein one or more nucleotides in the underlined part and / or one or more nucleotides in the double-underlined part are LNA-enhanced,

[0293] The 3'-adapter has the following sequence from 5' to 3' or a variant of this sequence:

[0294] (SEQ ID NO: 2), wherein " / 5Phos / " indicates that the 5'-terminal nucleotide is phosphorylated, wherein one or more nucleotides in the underlined part and / or one or more nucleotides in the double-underlined part are LNA-enhanced, wherein "(6 - 15x)N" represents a sequence reverse complementary to the 3'-terminal sequence of the target RNA, and wherein " / 3InvdT / " represents a 3'-inverted deoxynucleotide,

[0295] (ii) A reverse transcriptase (RT), preferably Maxima H-RT or Tth polymerase, and an RT primer, the RT primer having the sequence according to SEQ ID NO: 3 or a variant of this sequence, and / or

[0296] (iii) A DNA polymerase, preferably Taq polymerase, and a forward primer and / or a reverse primer, the forward primer having the sequence according to SEQ ID NO: 4 or a variant of this sequence, the reverse primer having the sequence according to SEQ ID NO: 5 or a variant of this sequence.

[0297] Optionally, the kit further comprises a TaqMan probe.

[0298] Alternatively, the above 5'-adapter is replaced with the following 5'-adapter, the 5'-adapter having the following sequence from 5' to 3' or a variant of this sequence: (SEQ ID NO: 29), wherein, "r" represents ribonucleotide, wherein, "(6 - 15x)N" represents a sequence reverse complementary to the 5'-terminal sequence of the target RNA, wherein, "idSp" represents a spacer lacking bases, and wherein one or more nucleotides in the underlined part and / or one or more nucleotides in the double-underlined part are LNA-enhanced.

[0299] In an even more preferred embodiment, the kit comprises the following components:

[0300] (i) A 5'-adapter and a 3'-adapter,

[0301] The 5'-adapter has the following sequence from 5' to 3' or a variant of this sequence: (SEQ ID NO: 1), wherein, "r" represents ribonucleotide, wherein, "(6 - 15x)N" represents a sequence reverse complementary to the 5'-terminal sequence of the target RNA, and one or more (e.g., 1, 2, or 3) of the nucleotides in bold are LNA-enhanced,

[0302] The 3'-adapter has the following sequence from 5' to 3' or a variant of this sequence: (SEQ ID NO: 2), wherein, " / 5Phos / " indicates that the 5'-terminal nucleotide is phosphorylated, one or more (e.g., 1, 2, or 3) of the nucleotides in bold are LNA-enhanced, wherein, "(6 - 15x)N" represents a sequence reverse complementary to the 3'-terminal sequence of the target RNA, and wherein, " / 3InvdT / " represents a 3'-inverted deoxynucleotide,

[0303] (ii) Reverse transcriptase (RT), preferably Maxima H-RT or Tth polymerase, and an RT primer, the RT primer having the sequence according to SEQ ID NO: 3 or a variant of this sequence, and / or

[0304] (iii) DNA polymerase, preferably Taq polymerase, and a forward primer and / or a reverse primer, the forward primer having the sequence according to SEQ ID NO: 4 or a variant of this sequence, the reverse primer having the sequence according to SEQ ID NO: 5 or a variant of this sequence.

[0305] Optionally, the kit further comprises a TaqMan probe.

[0306] Alternatively, the above 5'-adapter is replaced with a 5'-adapter having the following sequence from 5' to 3' or a variant of this sequence: (SEQ ID NO: 29), wherein "r" represents ribonucleotide, wherein "(6 - 15x)N" represents a sequence reverse complementary to the 5'-terminal sequence of the target RNA, wherein "idSp" represents a spacer lacking bases, and wherein one or more (e.g., 1, 2, or 3) of the nucleotides in bold are LNA-enhanced.

[0307] For specific variants as described above, see the first, second, fourth, and fifth aspects of the present invention.

[0308] The kit may further comprise

[0309] (i) one or more containers for different components of the kit, and / or

[0310] (ii) a data carrier.

[0311] The data carrier may be a non-electronic data carrier, such as a graphic data carrier (e.g., an information booklet, an information form, a barcode, or an access code); or an electronic data carrier (e.g., a floppy disk, a compact disc (CD), a digital versatile disc (DVD), a microchip, or another semiconductor-based electronic data carrier). The access code may allow access to a database, such as an Internet database, a centralized or decentralized database. The access code may also allow access to an application software or a mobile application, the application software enabling a computer to perform tasks for a computer user, the mobile application being designed to run on a smart phone and other mobile devices.

[0312] The data carrier may further comprise a reference as described in the context of the sixth aspect.

[0313] In the case where the data carrier contains an access code allowing access to a database, the reference is stored in the database.

[0314] In addition, the data carrier may contain information or instructions on how to implement the methods of the fourth to sixth aspects of the present invention.

[0315] The kit may further comprise materials desirable from a commercial and user perspective, including buffers, reagents, and / or diluents that may be used to implement the methods of the fourth to sixth aspects of the present invention. Specifically, the kit may further comprise components and buffers for annealing and ligating two adaptors to the target RNA, components and buffers for performing reverse transcription of the target RNA, and / or components and buffers for performing pre-amplification and / or amplification of the target RNA.

[0316] Without departing from the scope of the present invention, various modifications and variations of the present invention will be apparent to those skilled in the art. Although the present invention has been described in connection with specific preferred embodiments, it should be understood that the claimed invention should not be unduly limited to such specific embodiments. Indeed, the present invention is intended to cover various modifications of the described modes for carrying out the invention that are apparent to those skilled in the relevant art. BRIEF DESCRIPTION OF THE DRAWINGS

[0317] The following drawings are merely illustrative of the present invention and should not be construed as limiting the scope of the present invention as indicated by the appended claims in any way.

[0318] Figure 1 : An exemplary schematic hybridization structure showing a 5' adaptor, a 3' adaptor, and a target miRNA is shown. In this structure, the 5' adaptor has the following sequence: (SEQ ID NO: 6), where "r" represents a ribonucleotide, where the bolded sequence represents a sequence complementary to the 5'-terminal sequence of the target RNA miR-100-5p, and where one or more nucleotides in the underlined portion and / or one or more nucleotides in the double-underlined portion are LNA-enhanced. In this structure, the 3' adaptor has the following sequence: 5’

[0319]

[0320] (SEQ ID NO: 7), where " / 5Phos / " indicates that the 5'-terminal nucleotide is phosphorylated, where one or more nucleotides in the underlined portion and / or one or more nucleotides in the double-underlined portion are LNA-enhanced, where the bolded sequence represents a sequence reverse complementary to the 3'-terminal sequence of the target RNA miR-100-5p, and where " / 3InvdT / " represents a 3'-inverted deoxynucleotide. The target RNA miR-100-5p has the following sequence: (SEQ ID NO: 8). The sequences reverse complementary to the 5' / 3' adaptors are indicated in bold.

[0321] Figure 2: Commercial assay and DB PCR assay results for a test bench of 8 variants of miR-100-5p. The listed RNA templates used are in the columns, and the corresponding assays are in the rows. The numbers depicted are Ct values provided by the ABI Flex6 qPCR instrument. The lower the Ct value, the more RNA is detected in the sample. Green highlighting indicates the signal is expected only there. A. Commercial assay testing LNA-based primers on 60 amol of RNA template. B. Commercial assay testing stem-loop primers on 60 amol of RNA template. C. Commercial assay testing primer-probe hybridization on 2 pmol of RNA template. D. DB-PCR assay testing without a pre-amplification step on 10 fmol of RNA template.

[0322] Figure 3 : Results of a DB PCR assay experiment, which was conducted similarly to that shown in Figure 2 but on 60 amol of RNA template and with 7 cycles of pre-amplification.

[0323] Figure 4 : For Figure 1 and Figure 2 the sequences of the target RNA miR-100-5p and the target RNA miR-100-5p variants shown in the analysis.

[0324] Figure 5 : Detection of endogenous miR-100-5p wt (A.) and 3'-deletion (B.) in PAXgene RNA samples. The amount of RNA sample added to the reaction and the resulting Ct values of DB PCR with 7 cycles of pre-amplification are shown.

[0325] Figure 6 : Overview of TaqMan probes, 5'-adaptors and 3'-adaptors, reverse transcription (RT) primers, and forward and reverse primers used for different miRNAs in the experimental setup.

[0326] Figure 7 : Specific combinations of miRNA variants, 5'-adaptors, 3'-adaptors, and TaqMan probes.

[0327] Example

[0328] The examples given below are for illustrative purposes only and do not limit the above invention in any way.

[0329] 1. Materials and methods

[0330] First, the adapters are denatured and renatured to form the desired stem-loop structure. The RNA is denatured alone, mixed with the adapters, and used for ligation by Rnl2. Subsequently, an RT primer aligned to the 3' adapter is used for cDNA production. The cDNA is pre-amplified (e.g., using Biorad Pre-amp Mix) and then used with a reverse primer and a forward primer for qPCR, the reverse primer being aligned to the 5' end of the first strand of the cDNA and the forward primer being complementary to the 3' end of the first strand of the cDNA. Finally, a TaqMan probe is used for the detection of specific signals in qPCR.

[0331] Exemplary 5' adapter (SEQ ID NO: 6) and exemplary 3' adapter (SEQ ID NO: 7) are shown in Figure 1 These adapters target miR-100-5p (SEQ ID NO: 8).

[0332] Protocol details:

[0333] The adapters, primers, and probes are designed such that they can recognize miR-100-5p and its variants and are specific thereto (listed in Figure 3 ). Synthetic miR is ordered in 5'-phosphorylated form. The complete list of adapters, probes, and primers is listed in Figure 6 All oligonucleotides are ordered in dry form.

[0334] All oligonucleotides are diluted to a concentration of 100 μM in nuclease-free water and stored at -20 °C in the dark. Then the adapters are prepared as follows:

[0335]

[0336]

[0337] Next, the RNA is prepared by denaturation. The indicated amount of PAXgene total RNA or the indicated amount of synthetic miR-100-5p wt and variants is used in an equimolar pool. The RNA is denatured at 70 °C for 2 minutes and immediately placed on ice.

[0338] Next, the ligation reaction is prepared with the following components. After the reaction is thoroughly mixed, it is incubated at 37 °C for 1 hour.

[0339]

[0340]

[0341] Next, the ligated RNA is used for reverse transcription reaction using an RT primer as shown in the following protocol.

[0342]

[0343] After reverse transcription, the cDNA was used for pre-amplification reaction using a commercial pre-amplification Master mix (BioRad). Then, the pre-amplified cDNA was diluted and stored at -20 °C.

[0344]

[0345]

[0346] Finally, a qPCR assay including Taqman probes was used, and the qPCR assay used the diluted cDNA. The reaction was run in an ABI Flex 6 machine in 384-well format.

[0347]

[0348] 2. Results

[0349] The original DB PCR protocol was improved in terms of ligation. It was then used for comparison with available major commercial assays, as Figure 2 shown. It could be clearly shown that the "improved dumbbell (DB) PCR" protocol had higher specificity compared to other assays. This protocol was further optimized through a pre-amplification step to create "advanced DB PCR". In this way, high sensitivity could be achieved without losing specificity ( Figure 3 ).

[0350] It is important to note that this assay can be used for the biological source of RNA, such as clinical samples, such as PAXgene whole blood RNA samples. The original DB PCR protocol could not detect miR-100-5p in human PAXgene RNA samples (data not shown). The advanced DB PCR protocol can detect miR-100-5p in PAXgene RNA samples ( Figure 5 ), as well as miR-100-5p in its wt or standard form and 3'-deleted variants.

[0351] The sequences of the specific adapters and Taqman probes used for detection are shown in Figure 6 The combination of adapters and probes used for the discrimination assay is shown in Figure 7 ).

[0352] 3. Order of adapters and primers (in the 5' -> 3' direction)

[0353] 5'-adapter from 5' to 3':

[0354] (SEQ ID NO: 1), wherein "r" represents a ribonucleotide, wherein "(6-15x)N" represents a sequence that is reverse complementary to the 5'-terminal sequence of the target RNA, and wherein one or more nucleotides in the underlined portion and / or one or more nucleotides in the double-underlined portion are LNA-enhanced. An exemplary 5'-adapter targeting miR-100-5p has a nucleotide sequence according to SEQ ID NO: 6.

[0355] 3'-adapter from 5' to 3':

[0356] (SEQ ID NO: 2), wherein " / 5Phos / " indicates that the 5'-terminal nucleotide is phosphorylated, wherein one or more nucleotides in the underlined portion and / or one or more nucleotides in the double-underlined portion are LNA-enhanced, wherein (6-15x)N represents a sequence that is reverse complementary to the 3'-terminal sequence of the target RNA, and wherein " / 3InvdT / " represents a 3'-inverted deoxynucleotide. An exemplary 3'-adapter targeting miR-100-5p has a nucleotide sequence according to SEQ ID NO: 7.

[0357] RT primer from 5' to 3': (SEQ ID NO: 3)

[0358] Forward primer from 5' to 3': (SEQ ID NO: 4)

[0359] Reverse primer from 5' to 3': (SEQ ID NO: 5).

Claims

1. A 5' adaptor, which comprises, in the order from 5' to 3': (i) a 5'-terminal nucleotide sequence comprising 6 to 15 deoxynucleotides, wherein, the 6 to 15 deoxynucleotides are reverse complementary to the 5'-terminal sequence of the target RNA, and (ii) a nucleotide sequence capable of forming a stem-loop structure, the stem-loop structure comprising a loop and a double-stranded stem, wherein at least 2 nucleotides at its 3'-end are ribonucleotides or modified ribonucleotides, and wherein the nucleotide sequence capable of forming a stem-loop structure comprises a first stem sequence at the 5'-end and a second stem sequence at the 3'-end, and wherein the first stem sequence at the 5'-end and / or the second stem sequence at the 3'-end comprises 2 to 5 locked nucleic acids.

2. The 5' adaptor according to claim 1, wherein, the first stem sequence at the 5'-end and the second stem sequence at the 3'-end are reverse complementary to each other.

3. The 5' adaptor according to claim 1 or 2, wherein, each of the first stem sequence at the 5'-end and the second stem sequence at the 3'-end has a length between 5 and 10 nucleotides.

4. The 5' adaptor according to claim 3, wherein, the first stem sequence at the 5'-end and the second stem sequence at the 3'-end have the same length.

5. The 5' adaptor according to claim 4, wherein, the nucleotide sequence capable of forming a stem-loop structure comprises a loop sequence located between the first stem sequence at the 5'-end and the second stem sequence at the 3'-end.

6. The 5' adaptor according to claim 5, wherein, the loop sequence comprises 12 to 20 nucleotides.

7. The 5' adaptor according to claim 6, wherein, the nucleotides are deoxynucleotides.

8. The 5' adaptor according to claim 1, wherein, the 5'-terminal sequence is configured to form a single-stranded 5' overhang after the formation of the stem-loop structure.

9. The 5' adaptor according to claim 1, wherein, the 6 to 15 deoxynucleotides reverse complementary to the 5'-terminal sequence of the target RNA contain G and C, but not more than 4 consecutive.

10. The 5' adaptor according to claim 1, wherein, The 5' adaptor has the following sequence from 5' to 3': (SEQ ID NO: 1), where "r" represents a ribonucleotide, where "(6-15x)N" represents a sequence reverse complementary to the 5'-terminal sequence of the target RNA, and where one or more nucleotides in the underlined portion and / or one or more nucleotides in the double-underlined portion are LNA-enhanced.

11. The 5' adaptor according to claim 1, wherein, the target RNA is an RNA with a length < 200 ribonucleotides.

12. The 5' adaptor according to claim 11, wherein, the RNA with a length < 200 ribonucleotides is miRNA or miRNA isoform.

13. A 3' adaptor, which comprises, in the order from 5' to 3': (i) a nucleotide sequence capable of forming a stem-loop structure, the stem-loop structure comprising a loop and a double-stranded stem, wherein, the 5'-terminal nucleotide is phosphorylated, and wherein the nucleotide sequence capable of forming a stem-loop structure comprises a first stem sequence at the 5'-end and a second stem sequence at the 3'-end, and wherein the first stem sequence at the 5'-end and / or the second stem sequence at the 3'-end comprises 2 to 5 locked nucleic acids, and (ii) a 3'-terminal nucleotide sequence comprising 6 to 15 deoxynucleotides, wherein the 6 to 15 deoxynucleotides are reverse complementary to the 3'-terminal sequence of the target RNA, and wherein the deoxynucleotide at the 3'-terminal is an inverted deoxynucleotide.

14. The 3'-adapter according to claim 13, wherein, the first stem sequence located at the 5'-end and the second stem sequence located at the 3'-end are reverse complementary to each other.

15. The 3'-adapter according to claim 13 or 14, wherein, each of the first stem sequence located at the 5'-end and the second stem sequence located at the 3'-end has a length between 5 and 10 nucleotides.

16. The 3'-adapter according to claim 15, wherein, the first stem sequence located at the 5'-end and the second stem sequence located at the 3'-end have the same length.

17. The 3'-adapter according to claim 13, wherein, the nucleotide sequence capable of forming a stem-loop structure comprises a loop sequence, and the loop sequence is located between the first stem sequence located at the 5'-end and the second stem sequence located at the 3'-end.

18. The 3'-adapter according to claim 17, wherein, the loop sequence comprises between 12 and 20 deoxynucleotides.

19. The 3'-adapter according to claim 13, wherein, the 3'-terminal sequence is configured to form a single-stranded 3'-overhang after forming the stem-loop structure.

20. The 3'-adapter according to claim 13, wherein, the 6 to 15 deoxynucleotides reverse complementary to the 3'-terminal sequence of the target RNA contain G and C, but not more than 4 in a row.

21. The 3'-adapter according to claim 13, wherein, the inverted deoxynucleotide is inverted dT, dA, dC or dG.

22. The 3'-adapter according to claim 13, wherein, The 3' adaptor has the following sequence from 5' to 3': (SEQ ID NO: 2), wherein " / 5Phos / " indicates that the 5'-terminal nucleotide is phosphorylated, wherein one or more nucleotides in the underlined part and / or one or more nucleotides in the double-underlined part are LNA-enhanced, wherein (6-15x)N represents a sequence reverse complementary to the 3'-terminal sequence of the target RNA, and wherein " / 3InvdT / " represents a 3'-inverted deoxynucleotide.

23. The 3'-adapter according to claim 13, wherein, the target RNA is an RNA with a length < 200 ribonucleotides.

24. The 3'-adapter according to claim 23, wherein, the RNA with a length < 200 ribonucleotides is miRNA or miRNA isoform.

25. A composition, the composition comprises the 5'-adapter according to any one of claims 1-12, and the 3'-adapter according to any one of claims 13-24.

26. The composition according to claim 25, wherein, the 5'-adapter and the 3'-adapter are included in the composition alone or together.

27. The composition according to claim 25 or 26, wherein, The total length of the 5'-terminal nucleotide sequence containing 6 to 15 deoxynucleotides and the 3'-terminal nucleotide sequence containing 6 to 15 deoxynucleotides is at least 2 nucleotides shorter than the length of the target RNA.

28. A method for ligating two adaptors to a target RNA in a sample, the method comprising the steps of: (i) providing a composition comprising the denatured target RNA in the sample, the renatured 5'-adaptor according to any one of claims 1-12, and the renatured 3'-adaptor according to any one of claims 13-24, wherein the 5'-adaptor and the 3'-adaptor anneal to the target RNA, and (ii) ligating the 5'-adaptor and the 3'-adaptor to the target RNA using / by a double-stranded RNA ligase to produce a ligation product.

29. The method according to claim 28, wherein, the denatured target RNA is produced by heating the target RNA between 65 °C and 75 °C for between 1 minute and 3 minutes.

30. The method according to claim 28 or 29, wherein, the renatured 5'-adaptor is produced by denaturing the 5'-adaptor between 75 °C and 85 °C for between 1 minute and 3 minutes, and renaturing the 5'-adaptor by cooling to 4 °C.

31. The method according to claim 28, wherein, the renatured 3'-adaptor is produced by denaturing the 3'-adaptor between 75 °C and 85 °C for between 1 minute and 3 minutes, and renaturing the 3'-adaptor by cooling to 4 °C.

32. The method according to claim 28, wherein, the renatured 5'-adaptor and 3'-adaptor are produced separately in the absence of the target RNA.

33. The method according to claim 30, wherein, the denaturation and renaturation are carried out in an aqueous buffer comprising 10 mM TRIS HCl pH 7.5, 50 mM NaCl and 0.1 mM EDTA.

34. The method according to claim 28, wherein, the composition is produced by mixing the denatured target RNA, the renatured 5'-adaptor according to any one of claims 1-14, and the renatured 3'-adaptor according to any one of claims 15-28 with each other, thereby annealing the 5'-adaptor and the 3'-adaptor to the target RNA.

35. The method according to claim 28, wherein, the ligation is carried out in a ligation buffer comprising polyethylene glycol.

36. The method according to claim 28, wherein, the ligation is carried out between 36 °C and 38 °C for between 30 minutes and 1.5 hours, or the ligation is carried out between 15 °C and 20 °C for between 30 minutes and 2 hours, and then overnight at 12 °C.

37. The method according to claim 28, wherein, the double-stranded RNA ligase is T4 RNA ligase 2 or Kod1 ligase.

38. A method for determining and / or quantifying a target RNA in a sample, the method comprising the steps of: (i) performing the method according to any one of claims 28-37, (ii) Reverse transcribe the ligation product to obtain a cDNA product from the target RNA, and (iii) Amplify the cDNA to determine and / or quantify the target RNA.

39. The method according to claim 38, wherein, The reverse transcription of the ligation product is carried out as follows: (iia) Anneal a reverse transcription primer to the ligation product, and (iib) Reverse transcribe the ligation product by using a reverse transcriptase.

40. The method according to claim 39, wherein, The annealing is carried out between 60 °C and 80 °C for between 2 minutes and 7 minutes.

41. The method according to claim 39 or 40, wherein, The reverse transcription is carried out as follows: Between 40 °C and 65 °C, for between 10 minutes and 40 minutes, and Subsequently between 75 °C and 90 °C, for between 2 minutes and 4 minutes, or Between 60 °C and 75 °C, for between 10 minutes and 30 minutes.

42. The method according to claim 39, wherein, The reverse transcriptase is Maxima H-RT or Tth polymerase.

43. The method according to claim 39, wherein, The RT primer is reverse complementary to the nucleotide sequence of the 3'-adapter that can form a stem-loop structure containing a loop and a double-stranded stem.

44. The method according to claim 39, wherein, The RT primer has the following sequence from 5' to 3': CTCAGTGCGAATACCTCGGACCCT (SEQ ID NO: 3).

45. The method according to claim 38, wherein, The method further includes a cDNA pre-amplification step between step (ii) and step (iii).

46. The method according to claim 45, wherein, The cDNA pre-amplification is carried out with a forward primer and a reverse primer: The forward primer has the following sequence from 5' to 3': TGGAGTGTGTGCTTTGCCACG (SEQ ID NO: 4), and The reverse primer has the following sequence from 5' to 3': GTGCGAATACCTCGGACC (SEQ ID NO: 5).

47. The method according to claim 38, wherein, The amplification is carried out using polymerase chain reaction.

48. The method according to claim 47, wherein, The PCR is selected from the group consisting of: real-time PCR, multiplex PCR, nested PCR, high-fidelity PCR, rapid PCR, hot-start PCR, and high-GC PCR.

49. The method according to claim 48, wherein, The real-time PCR is TaqMan qPCR, and wherein the TaqMan qPCR is carried out with a forward primer and a reverse primer: The forward primer has the following sequence from 5' to 3': TGGAGTGTGTGCTTTGCCACG (SEQ ID NO: 4), and The reverse primer has the following sequence from 5' to 3': GTGCGAATACCTCGGACC (SEQ ID NO: 5).

50. The method according to claim 48 or 49, wherein, the TaqMan qPCR is carried out in the presence of a TaqMan probe.

51. The method according to claim 28 or 38, wherein, the sample is a biological sample.

52. The method according to claim 51, wherein, the biological sample is a blood sample.

53. The method according to claim 52, wherein, the blood sample is whole blood or a blood fraction.

54. The method according to claim 28 or 38, wherein, the sample contains total RNA.

55. The method according to claim 54, wherein, the sample contains total cellular RNA.

56. The method according to claim 28 or 38, wherein, the target RNA is miRNA or a miRNA isoform.

57. A kit, the kit comprising the 5'-adapter according to any one of claims 1-12, and the 3'-adapter according to any one of claims 13-24; or the composition according to any one of claims 25-27.

58. The kit according to claim 57, wherein, the kit further comprises a double-stranded RNA ligase.

59. The kit according to claim 58, wherein, the kit further comprises instructions on how to carry out the method according to any one of claims 28-37 or 51-56.

60. The kit according to claim 58 or 59, wherein, the kit allows the method according to any one of claims 28-37 or 51-56 to be carried out.

61. The kit according to claim 57, wherein, the kit further comprises a reverse transcriptase and an RT primer.

62. The kit according to claim 57, wherein, the kit further comprises a forward primer and / or a reverse primer for amplifying cDNA and a DNA polymerase.

63. The kit according to claim 61, wherein, the kit further comprises instructions on how to carry out the method according to any one of claims 38-56.

64. The kit according to claim 61, wherein, the kit allows the method according to any one of claims 38-56 to be carried out.

Images