Method for enzymatic repair of split RNA and detection method thereof

Abstract

The present disclosure relates to a method of enzymatic repair of a notched or at least partially cleaved RNA. The method comprises providing a biological sample containing a nicked or at least partially cleaved RNA; purifying the nicks or at least partially cleaved RNA contained in the biological sample under non-denaturing conditions to remove non-RNA components; and treating the purified RNA with at least one of (i) one or more enzymes exhibiting RNA 3 'phosphatase or cyclic phosphatase activity and RNA 5' kinase activity, and an RNA ligase, or (ii) a 3 '-5' RNA ligase, thereby forming a repaired RNA from the nicking or at least partially cleaved RNA. The present disclosure also relates to methods of detecting RNA by enzymatic repair of nicked or at least partially cleaved RNA and detection of the repaired RNA.

Description

[0006] Field of the Invention

[0007] The present invention relates to methods for enzymatically repairing nicked or partially cleaved RNAs and detecting RNAs. Background Art

[0008] Nucleic acid-based disease monitoring (including diagnosis and prognosis) based on minimally invasive liquid biopsy has the potential to impact patient survival by enabling early detection of a patient's disease, recurrence, or treatment tolerance. However, this has mainly been studied in the context of cell-free DNA (cfDNA).

[0009] Extracellular RNA (exRNA) can be more informative than cfDNA because they can also reflect gene expression changes between tissues and cell types. ExRNAs circulating in human body fluids can predict diseases before clinical symptoms appear. For example, exRNAs have recently been successfully used to predict preeclampsia in pregnant women before symptoms occur (Moufarrej et al., 2022).

[0010] However, there has been less research on exRNAs, and there is currently a lack of fundamental understanding of the types of exRNAs and their carriers in body fluids. When studying the exRNA world, a population consisting of non-vesicular ribosomes and full-length tRNAs was discovered (Tosar et al., 2020). Studies have shown that exRNA profiles may also contain tRNA halves to full-length tRNAs (Nechooshtan et al., 2020). In addition, stress can induce the formation of intracellular tRNA halves, potentially upregulating extracellular tRNA halves in EVs (Li et al., 2022; Tosar and Cayota, 2020). When these fragments are encapsulated in extracellular vesicles (EVs), they can be transferred to recipient cells (Gámbaro et al., 2020), where they can trigger pattern recognition receptor-mediated signal transduction (Pawar et al., 2020; Xiao et al., 2020). However, most non-vesicular tRNA halves are generated directly in the extracellular space by endonuclease cleavage of extracellular full-length tRNAs (Nechooshtan et al., 2020; Sanadgol et al., 2022; Tosar et al., 2020). Extracellular ribosomes can induce dendritic cell activation in vitro in an exRNA-dependent manner (Tosar et al., 2020).

[0011] Since biological fluids contain a large number of enzymes that degrade RNA, the study of exRNA has focused more on extracellular vesicles (EVs) that protect exRNA from enzymatic degradation. Nevertheless, it has been known for many years that most exRNAs circulating in human plasma or cell-conditioned media are not associated with EVs (Arroyo et al., 2011; Turchinovich et al., 2011; Tosar et al., 2015). Due to the strong ribonuclease activity in the extracellular space (Sorrentino, 2010), these non-vesicular exRNAs are rapidly degraded unless protected by RNA-binding proteins. Therefore, how these non-vesicular exRNAs resist degradation, spread to recipient cells, and trigger downstream effects, and even how they remain measurable and serve as potential disease biomarkers are unknown. The present invention explains some of these issues, and the inventors have discovered a group of inherently stable non-vesicular extracellular RNAs characterized by the presence of broken phosphodiester bonds in their structures ("nicked exRNAs").

[0012] The problem is that nicked exRNAs cannot be identified by conventional or currently available sequencing and / or amplification methods. When reverse transcriptase is exposed to the broken phosphodiester bonds in these RNAs, they are shed. Therefore, these RNAs either do not appear in sequencing or RT-qPCR assays or appear as RNA fragments, releasing important structural information and the physical association between the 5' and 3' fragments.

[0013] Therefore, there is still a need in the art to develop an effective method to more accurately characterize these exRNAs that cannot be detected in biological samples due to the limitations of currently available RNA detection techniques for detection and / or subsequent applications (e.g., reverse transcription, amplification, analysis, hybridization, sequencing, etc.). The present disclosure meets this need. Summary of the Invention

[0014] One aspect of the present invention relates to a method for enzymatically repairing nicked or at least partially cleaved RNA. The method includes providing a biological sample containing nicked or at least partially cleaved RNA; purifying the nicked or at least partially cleaved RNA contained in the biological sample under non-denaturing conditions to remove non-RNA components; and treating the purified RNA with at least one of the following:

[0015] (i) one or more enzymes that exhibit the activity of RNA 3'-phosphatase or cyclophosphate and the activity of RNA 5'-kinase, and RNA ligase, or (ii) 3'-5' RNA ligase, thereby forming repaired RNA from the nicked or at least partially cleaved RNA.

[0016] Another aspect of the present invention relates to a method for detecting RNA in a biological sample. The method includes providing a biological sample containing nicked or at least partially cleaved RNA; purifying the nicked or at least partially cleaved RNA contained in the biological sample under non-denaturing conditions to remove non-RNA components; treating the purified RNA with at least one of the following: (i) one or more enzymes that exhibit the activities of RNA 3'-phosphatase or cyclophosphate and RNA 5'-kinase, and RNA ligase, or (ii) 3'-5' RNA ligase, thereby repairing at least a portion of the nicked or partially cleaved RNA; and detecting the repaired RNA.

[0017] Other aspects, advantages, and features of the present invention are set forth in this specification and will be partly understood by those skilled in the art after reading the following, or may be learned by practicing the present invention. The invention disclosed in this application is not limited to any specific set or combination of aspects, advantages, and features. It is contemplated that various combinations of the stated aspects, advantages, and features constitute the invention disclosed in this application. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The identification results of stable non-vesicular RNAs are described. After incubating purified RNA from human cells in RPMI + 10% FBS for different time periods, Northern blot analysis was performed on different rRNAs and tRNAs.

[0019] Figure 2 shows that naked tRNA halves are extremely stable in human biological fluids. A - C show Northern blots of several non-coding transcripts after incubating purified RNA from human cells in 10% FBS or with recombinant human ribonuclease 1 (RNase1) (A); incubating in human urine or 10% serum (B); or incubating in undiluted human serum (C). T = 0 corresponds to adding the RNA to the serum and immediately placing it on ice.

[0020] Figure 3 shows the RNA decay results of different concentrations of recombinant human ribonuclease 1. A shows Northern blot analysis using a probe complementary to the 5' end of tRNA after exposing TRIzol-purified total U2-OS RNA (NT) to different concentrations of r-ribonuclease 1 for 60 minutes at 37°C. B shows the cloverleaf structure of human tRNA Gly GCC -1, which shows the modified bases described in the modomics database (http: / / genesilico.pl / modomics / ) and the predicted cleavage sites based on the data present in Example 1. Gly GCC -1, in which the modified bases described in the modomics database (http: / / genesilico.pl / modomics / ) and the predicted cleavage sites based on the data present in Example 1 are shown.

[0021] Figure 4 shows the Northern blot corresponding to the assays shown in Figure 2A (A) and Figure 2B (B), but compares the signals obtained using probes complementary to the 5’ and 3’ halves of tRNA Gly GCC .

[0022] Figure 5 shows that most of the tRNA halves identified by Northern blot are nicked tRNAs. tRNA halves were generated in vitro by incubating purified RNA from human cells with recombinant human ribonuclease 1 for 60 minutes. Panel A shows the results of Northern blot analysis in which ribonuclease 1-treated RNA was incubated with T4 PNK, T4 PNK followed by T4Rnl1, and T4 PNK followed by Rnl2, respectively. Panel B is a schematic diagram showing a summary of the nicked tRNA repair strategy. Panel C depicts the 5’ and 3’ probes used in these assays, as well as a third probe directed against the anticodon loop of tRNA Gly GCC and tRNA Asp GUC (ACL). The assays described in Panel A were then used. Panel D shows the validation of nicked tRNA formation using 5’, 3’, and ACL probes. Additional controls not included in Panel A are also shown. NT: fragmented RNA not treated with the repair enzyme mixture. Δ: heated. (-)PNK: T4 PNK lacking its phosphatase activity.

[0023] Figure 6 Purification of ribonuclease 1-treated RNA (with or without heat denaturation, Δ) by SPE is shown with ethanol added according to the manufacturer's instructions (1 volume of EtOH) or with the volume of ethanol doubled and added to the binding buffer (2 volumes of EtOH).

[0024] Figure 7 shows that nicked tRNA can protect tRNA halves from degradation, is dissociated by phenol, and can be repaired by RtcB. Panels A and B show that RNA purification by miRNeasy Mini Kit (A) or TRIzol (TRI, B) impairs the enzymatic (PNK+Rnl1) repair of nicked tRNA (light gray arrows). The right panel in Panel B shows the results obtained by R fThe size of the repair product estimated by the method. C shows the purification of ribonuclease 1-treated RNA by SPE with or without heating followed by cooling of the RNA and re-exposure to ribonuclease 1. D shows the Northern blot of ribonuclease 1-treated RNA purified by SPE, TRIzol, miRNeasy, or SPE after heating. E shows the one-step enzymatic repair of nicked tRNA with RtCB from E. coli. The right panel shows the repair by R f The size of the repair product estimated by the method. In this and all subsequent figures, SPE was performed with twice the recommended volume of EtOH.

[0025] Figure 8 shows that the non-vesicular tRNA halves circulating in serum and the intracellular tRNA-derived fragments are mainly nicked tRNA. A shows the purification of RNA from arsenite-treated U2-OS cells separated on a Superdex 75 column using an FPLC system. Inset: Northern blot of intracellular RNA shows the presence of tRNA halves in the input. A shows the selected fractions from this separation. B - C show that the selected fractions from (A) were analyzed by Northern blot (B) or stem-loop RT-qPCR (C). Fractions 2, 3, and 4 correspond to the elution volume of full-length tRNA. C q Values were normalized relative to the fraction containing the highest signal. Bottom panels in A - C: RNA was heated at 90 °C and then cooled to room temperature before injection. D shows that cells were transfected with synthetic RNA 9 GG / AA and then lysed with SDS as described (Tosar et al., 2018). The lysate was separated by SEC and the fractions were analyzed by SL-RT-qPCR using primers specific for 9 GG / AA oligonucleotides. E shows the separation by SEC of purified RNA from the ultracentrifugation supernatant treated with proteinase K from human serum. The selected eluted fractions were heated and analyzed by SL-RT-qPCR using primers specific for the 30 nt tRNA Gly GCC 5’ half (solid line) and miR-21-5p (dashed line). tRNA halves corresponding to the elution volume of full-length tRNA were detected in the heated fractions, indicating the presence of nicked tRNA in human serum.

[0026] Figure 9 shows that the enzymatic repair process allows efficient reverse transcription and amplification (and thus sequencing) of nicked tRNA. A shows full-length tRNA GlyEndpoint RT-PCR and quantitative reverse transcription PCR (RT-qPCR) of GCC, which uses the primers depicted in the left figure and is reverse transcribed at 50 °C with a thermostable reverse transcriptase. Input: Total RNA from human cells. NT: Ribonuclease 1-treated total RNA (i.e., nicked tRNA), purified under non-denaturing conditions and not enzymatically repaired. PNK+Rnl1: Ribonuclease 1-treated RNA after enzymatic repair. Δ+PNK+RNl1: Ribonuclease 1-treated RNA heated before enzymatic repair. RT-qPCR results are expressed as fold change relative to the input. The left figure shows that the reverse transcriptase (represented as a truck) cannot read through the discontinuities characteristic of nicked or damaged RNA. B is a schematic diagram of the mechanism of an exemplary enzymatic repair process. Detailed Description

[0027] Studying nicked or at least partially cleaved RNA remains a challenge because standard protocols for RNA extraction, Northern blotting, and RNA sequencing induce its artificial denaturation. In the present disclosure, the inventors have developed a method that enables the reverse transcription, amplification, analysis, and / or sequencing of stable extracellular RNA without missing highly structured, nicked, or partially cleaved exRNA. Nicked or partially cleaved RNA is purified under non-denaturing conditions (e.g., using a phenol-free method; without heating), and then enzymatically repaired to enable subsequent reverse transcription and / or various detections.

[0028] Definitions

[0029] Unless otherwise defined, the technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Allen et al., Remington: The Science and Practice of Pharmacy, 22nd ed., Pharmaceutical Press (Sep. 15, 2012); Hornyak et al., Introduction to Nanoscience and Nanotechnology, CRC Press (2008); Singleton and Sainsbury, Dictionary of Microbiology and Molecular Biology, 3rd ed., rev., J. Wiley & Sons (New York, NY 2006); Smith, March's Advanced Organic Chemistry Reactions, Mechanisms and Structure, 7th ed., J. Wiley & Sons (New York, N.Y. 2013); Singleton, Dictionary of DNA and Genome Technology, 3rd ed., Wiley-Blackwell (Nov. 28, 2012); and Green and Sambrook, Molecular Cloning: A Laboratory Manual, 4th ed., Cold Spring Harbor Laboratory Press (Cold Spring Harbor, N.Y. 2012) provide one of ordinary skill in the art with general guidance regarding many of the terms used in this application.

[0030] One of ordinary skill in the art will recognize many methods and materials similar or equivalent to those described herein, which can be used to implement the present disclosure. Other features and advantages of the present disclosure will be apparent from the following detailed description in conjunction with the accompanying drawings, which illustrate by way of example various features of embodiments of the invention. In fact, the present disclosure is in no way limited to the methods and materials described herein. For the purposes of the present disclosure, certain terms are defined below.

[0031] As used herein in the context of assays, "treating" or "treatment" refers to the application of an effective amount of a substance under conditions that allow the substance to exert its function. For example, as recognized by one of ordinary skill in the art, "treating a sample with an enzyme" refers to applying a sufficient amount of the enzyme under appropriate conditions (buffer, temperature, etc.) to allow an enzymatic reaction.

[0032] "Nicked or partially cleaved RNA" or "nicked or at least partially cleaved RNA" generally refers to an RNA molecule that has discontinuities between adjacent nucleotides and / or has had a portion removed from the parental full-length RNA. For example, nicked or partially cleaved RNA can refer to exRNA, such as a tRNA having a cleaved phosphodiester bond in the anticodon loop. Nicked or partially cleaved RNA can also include cases where the RNA has a region (e.g., a loop or overhang or a portion thereof) removed from the parental full-length RNA. Nicked or partially cleaved RNA will include those artificially generated RNA fragments, i.e., fragments generated by human intervention (such as some experimental and / or treatment methods) that will dissociate or fully cleave the nicked or partially cleaved RNA into fragments. However, if the RNA fragments are not generated by human intervention, i.e., if in the biological sample used as input, different portions of the nicked or partially cleaved RNA have been fragmented and separated before the sample is collected and before any human intervention (such as experimental and / or treatment methods) is performed on the biological sample, then these RNA fragments generally will not be considered nicked or partially cleaved RNA.

[0033] "Repaired RNA" refers to RNA that is regenerated into the full-length or substantially full-length of the parental RNA by ligating at least two portions or fragments (e.g., a 5' fragment and a 3' fragment) of the nicked or partially cleaved RNA generated by cleavage of the parental RNA. For example, for a nicked or partially cleaved tRNA, after enzymatic repair as disclosed herein, the repaired RNA can refer to RNA that is regenerated by ligating the 5' half and the 3' half of the nicked or partially cleaved tRNA generated by cleavage of the parental tRNA (or the nicked or partially cleaved tRNA) and reconstituting it into the full-length or substantially full-length of the parental RNA. The repaired RNA can have the same length as the parental RNA, i.e., it is reconstituted into the full-length of the parental RNA. Alternatively, the length of the repaired RNA can be substantially the same as the parental RNA, i.e., it is reconstituted into the substantially full-length of the parental RNA. "Substantially" full-length means that the length of the repaired RNA can be at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or almost 100% of the full-length of the parental RNA. The repaired RNA can contain the same or substantially the same nucleotide sequence as the parental RNA. "Substantially the same" means that the sequence of the repaired RNA can be at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or almost 100% the same as the sequence of the parental RNA.

[0034] Extracellular RNA

[0035] Extracellular RNAs (exRNAs) circulating in human body fluids can predict diseases before the onset of clinical symptoms. In addition to their translational applications as disease biomarkers in liquid biopsies (Heitzer et al., 2019), exRNAs are also involved in intercellular communication pathways between cells in different tissues (Thomou et al., 2017) and host-pathogen interactions (Buck et al., 2014; Cai et al., 2018; Garcia-Silva et al., 2014).

[0036] A key aspect determining the function of exRNAs and their utility as biomarkers is their stability against ubiquitous extracellular ribonucleases (Tosar et al., 2021). This can be achieved by encapsulating RNAs within extracellular vesicles (EVs) such as exosomes and microvesicles (Skog et al., 2008; Valadi et al., 2007). However, although EV-encapsulated RNAs have functional relevance (Mateescu et al., 2017) and biotechnological applications (O’Brien et al., 2020), most exRNAs in cell cultures (Tosar et al., 2015; Turchinovich et al., 2011; Wei et al., 2017; Zhang et al., 2021) and human plasma (Arroyo et al., 2011; Geekiyanage et al., 2020; Turchinovich et al., 2011; Vickers et al., 2011) are not transported as part of EV cargo and are non-vesicular.

[0037] Non-vesicular RNA

[0038] Cells can release ribosomes and full-length tRNAs into the extracellular space, thereby triggering immune cell activation. However, since non-vesicular exRNAs are vulnerable to extracellular ribonucleases, they are thought to be unlikely to act as mediators of intercellular communication.

[0039] Contrary to common belief, the inventors found that certain extracellular non-vesicular RNAs are inherently stable against enzymatic degradation and exhibit very high half-lives (from minutes to hours) when incubated in human biological fluids under physiological conditions (e.g., 37 °C). These intrinsically stable non-vesicular RNAs circulate in human body fluids and are EV-independent. These intrinsically stable non-vesicular RNAs are very abundant in most cells, but some RNAs may have tissue-specific expression. Cellular injury or death may be the main source of non-vesicular RNAs in extracellular samples. Thus, in situations of non-physiological amounts of cellular injury or death in vivo (e.g., trauma, ischemia-reperfusion, cancer, autoimmunity, etc.), intrinsically stable non-vesicular RNAs can be elevated in biological fluids.

[0040] Without being bound by theory, features common to intrinsically stable non-vesicular RNAs include, but are not limited to: a) they have a tight structure and contain a high percentage of double-stranded forms of nucleobases, even for single-stranded RNAs; b) they carry modified nucleotides; and c) due to partial cleavage of the RNA by extracellular ribonucleases (RNases), they carry broken phosphodiester bonds (i.e., they are "nicked RNAs"). This partial cleavage is not sufficient to disrupt the structure of these molecules, which remain dsRNAs stabilized by several internal base-pairing interactions.

[0041] tRNA

[0042] Transfer RNA (tRNA) is a small RNA molecule that plays a key role in protein synthesis. Transfer RNA acts as a link (or adaptor) between messenger RNA (mRNA) molecules and the growing chain of amino acids that make up a protein. The length of tRNA is typically 70 - 100 (e.g., 76 - 90) nucleotides (in eukaryotes). After stress induction, during a process promoted by the enzyme angiogenin, tRNA can be cleaved at the anticodon loop to produce "tRNA halves" that are 30 - 35 nucleotides in length.

[0043] tRNA fragments can be used to refer to functional short non-coding RNAs generated from tRNA loci. The length of tRNA fragments (tRFs) ranges from 10 to 40 or more nucleotides. The term "tRNA locus" refers to a genomic region that contains a tRNA gene and produces a tRNA transcript.

[0044] Transfer RNA-derived RNA (tDR) is one of the most abundant non-vesicular small RNAs in cell culture (Tosar et al., 2015; Wei et al., 2017). Inside cells, tRNA cleavage and the consequent upregulation of specific tDRs is a conserved response to stress across all kingdoms of life (David et al., 1982; Li et al., 2008; Thompson et al., 2008). In humans, members of the ribonuclease A superfamily, such as ribonuclease 5 (angiogenin), are responsible for stress-induced tRNA cleavage at the anticodon, producing stress-induced tRNA halves or tiRNAs (Fu et al., 2009; Yamasaki et al., 2009). tiRNAs can upregulate gene expression at different levels, including globally inhibiting translation initiation by sequestering eIF4G (Lyons et al., 2021) (Ivanov et al., 2011). Additionally, shorter tDRs can bind to mRNAs and regulate their translation (Kim et al., 2017) or silence genes through an miRNA-like Argonaute-dependent mechanism (Kuscu et al., 2018).

[0045] Extracellular tDRs were first discovered in EVs of murine immune cells (Nolte’THoen et al., 2012), but were later shown to be mainly present outside vesicles in murine serum (Dhahbi et al., 2013; Zhang et al., 2014). In human cancer cell lines, tDRs can be detected in the vesicle fraction, but the amount of tDR is much higher in the ultracentrifugation supernatant depleted of EVs (Tosar et al., 2015). Although heterogeneous populations of tDRs can be detected intracellularly, extracellular non-vesicular tDRs are mainly the 5’ halves of tRNAs that are 30 or 31 nucleotides in length and are derived from tRNA Gly and tRNA Glu . These specific fragments are also prevalent in human biological fluids (Srinivasan et al., 2019). The enrichment of these fragments extracellularly may be due to their enhanced stability to degradation, as the 30-31 nt 5’ halves of tRNAs Gly GCC can form ribonuclease-resistant homodimers in vitro (Tosar et al., 2018). However, the inventors have found that nicked tRNAs may be the form in which tDRs are transported in biological fluids. The high stability of nicked tRNAs to resist degradation thus helps to explain the abundance of extracellular non-vesicular tDRs.

[0046] Method for enzymatically repairing RNA

[0047] One aspect of the present invention relates to a method for enzymatically repairing nicked or at least partially cleaved RNA. The method includes providing a biological sample containing nicked or at least partially cleaved RNA; purifying the nicked or at least partially cleaved RNA contained in the biological sample under non-denaturing conditions to remove non-RNA components; and treating the purified RNA with at least one of the following:

[0048] (i) one or more enzymes that exhibit the activities of RNA 3’ phosphatase or cyclophosphatase and RNA 5’ kinase, and an RNA ligase, or (ii) a 3’-5’ RNA ligase, thereby forming repaired RNA from the nicked or at least partially cleaved RNA.

[0049] The biological sample containing nicked or at least partially cleaved RNA is purified to remove non-RNA components such as proteins, lipids, salts, etc. that may interfere with downstream analysis. The purification is carried out under non-denaturing conditions.

[0050] In some embodiments, non-denaturing conditions include solid-phase extraction (SPE), chromatography (such as size-exclusion chromatography (SEC) or ion-exchange chromatography), RNA precipitation (e.g., precipitation with a polar solvent such as acetone or an alcohol (e.g., ethanol or isopropanol)), or combinations thereof. In one embodiment, non-denaturing conditions include SPE, such as a silica-based solid-phase extraction column.

[0051] The method may also include one or more separation steps prior to the enzymatic treatment to extract one or more specific types of RNA. In one embodiment, the method further includes density gradient separation to separate non-vesicular RNA. In one embodiment, the method further includes chromatography to separate non-vesicular RNA. In one embodiment, the method further includes native electrophoresis to fractionate the RNA according to its size.

[0052] The method may also include one or more enrichment steps prior to the enzymatic treatment. In one embodiment, the method further includes gel purification to enrich one or more RNAs or fragments having 25 - 100 nucleotides.

[0053] In some embodiments, the purification of the biological sample and the enzymatic treatment of the purified RNA are performed in the absence of conditions that cause denaturation of the RNA molecules. Conditions that can cause denaturation of the RNA molecules can include heating, adapter ligation, chemical denaturants, or combinations thereof. In one embodiment, conditions that can cause denaturation of the RNA molecules include the use of a chemical denaturant, such as phenol. In one embodiment, conditions that can cause denaturation of the RNA molecules include heating. The purification used herein avoids denaturing conditions that can create artifacts of missing certain highly structured incisions or partially cleaved exRNAs, but instead detects an increase in the population of degraded / denatured RNA actually caused by the denaturing conditions.

[0054] In some embodiments, the method of enzymatically repairing incised or at least partially cleaved RNA is performed in the absence of conditions that cause denaturation of the RNA molecules. In one embodiment, the method is performed in the absence of conditions including heating, adapter ligation, chemical denaturants, or combinations thereof.

[0055] As described above, incised or partially cleaved RNA can be an RNA molecule having discontinuities between adjacent nucleotides and / or having a portion removed from the parental full-length RNA. In one embodiment, incised or partially cleaved RNA includes tRNA having discontinuities (e.g., cleaved phosphodiester bonds) between adjacent nucleotides in the anticodon loop of the tRNA. In one embodiment, incised or partially cleaved RNA includes RNA having a region (e.g., a loop or overhang or a portion thereof) removed from the parental full-length RNA.

[0056] Biological samples can contain various types of RNA and various types of nicked or partially fragmented RNA. All nicked or partially fragmented RNA can be enzymatically repaired by the method, for example, simultaneously. Thus, by this method, after the enzymatic treatment disclosed herein, the final product will contain all the RNA originally present in the biological sample, including those nicked or partially fragmented RNA that have now been repaired.

[0057] In some embodiments, at least a portion of the nicked or partially fragmented RNA is formed from extracellular RNA. In some embodiments, at least a portion of the nicked or partially fragmented RNA is formed from intracellular RNA.

[0058] In some embodiments, at least a portion of the nicked or partially fragmented RNA is formed from non-vesicular RNA. In some embodiments, at least a portion of the nicked or partially fragmented RNA is formed from vesicular RNA.

[0059] In some embodiments, the nicked or at least partially fragmented RNA includes one or more RNAs selected from the following: tRNA (e.g., nicked and full-length), rRNA, YRNA, 7SL RNA, 7SK RNA, snRNA, snoRNA, vaultRNA, Alu RNA, transposon-derived RNA, pri-microRNA, pre-microRNA, mRNA exons, mRNA introns, 5’ UTR, 3’ UTR, and fragments and combinations thereof. These RNAs can be encoded by the nuclear genome or an organelle (e.g., mitochondrial) genome. These RNAs are examples of intrinsically stable non-vesicular RNAs. These RNAs typically have a length of more than 40 nucleotides, but due to the use of denaturing methods (sRNA-seq and / or Northern blotting) for nicked exRNA, they sometimes appear as relatively short RNA fragments in biological fluids.

[0060] In one embodiment, the nicked or at least partially fragmented RNA includes tRNA, tRNA fragments (tRF), tRNA-derived RNA (tDR), and / or tRNA halves.

[0061] In one embodiment, at least a portion of the nicked or at least partially fragmented RNA includes single-stranded tRNA halves.

[0062] For enzymatic repair treatment, one or more enzymes can be used. Without being bound by theory, the enzymes used will perform the functions of dephosphorylating the 3'-end of the nicked or at least partially cleaved RNA (forming 3'-OH), phosphorylating the 5'-end of the nicked or at least partially cleaved RNA (forming 5'-phosphate), and ligating the 5'-phosphate RNA to the 3'-OH RNA. The enzymatic treatment can be carried out by one enzyme having all these functions, two enzymes whose combination has all these functions, or three enzymes each having different functions and whose combination has all these functions.

[0063] In some embodiments, purified RNA is treated with (i)(a) polynucleotide kinase (PNK) and RNA ligase. In one embodiment, the polynucleotide kinase and RNA ligase are added together. In one embodiment, the polynucleotide kinase is added first and then the RNA ligase. In one embodiment, the polynucleotide kinase used is T4 PNK. In one embodiment, the RNA ligase is T4 RNA ligase 1.

[0064] In some embodiments, purified RNA is treated with (i)(b) RNA 3'-phosphatase or RNA 2',3'-cyclic phosphatase, RNA 5'-kinase, and RNA ligase, which are added together or sequentially. In one embodiment, RNA 3'-phosphatase or RNA 2',3'-cyclic phosphatase, RNA 5'-kinase, and RNA ligase are added together. In one embodiment, RNA 3'-phosphatase or RNA 2',3'-cyclic phosphatase and RNA 5'-kinase are added first, and then RNA ligase. In one embodiment, RNA 3'-phosphatase or RNA 2',3'-cyclic phosphatase is added first, and then RNA 5'-kinase and RNA ligase. In one embodiment, RNA 3'-phosphatase or RNA 2',3'-cyclic phosphatase is added first, then RNA 5'-kinase, and then RNA ligase. In one embodiment, the RNA ligase is T4 RNA ligase 1.

[0065] In some embodiments, purified RNA is treated with (ii) 3'-5' RNA ligase. In one embodiment, the 3'-5' RNA ligase is RtcB ligase.

[0066] In some embodiments, the treatment of purified RNA according to (i) (including (i)(a) and (i)(b)) or (ii) is carried out at least partially in the presence of cofactors. In one embodiment, the cofactor is adenosine triphosphate (ATP) or guanosine-5'-triphosphate (GTP).

[0067] Repair the nicked or at least partially cleaved RNA contained in a biological sample to reconstruct the full-length or substantially full-length parental RNA. Longer reads (and more complete reads of these nicked or at least partially cleaved RNAs) provide more important structural information and confer greater discrimination (especially in the case of tRNAs, which contain a large number of very similar isoacceptors and isodecoders that can have tissue-specific and cancer-specific expression).

[0068] In some embodiments, the repaired RNA comprises a nucleotide sequence that is the same or substantially the same as the parental RNA that formed the nicked or at least partially cleaved RNA over the full-length or substantially full-length.

[0069] In one embodiment, the repaired RNA comprises a nucleotide sequence that is the same or substantially the same as the parental RNA that formed the nicked or at least partially cleaved RNA over the full-length.

[0070] In some embodiments, the repaired RNA comprises a nucleotide sequence that is the same or substantially the same as the parental RNA that formed the nicked or at least partially cleaved RNA over the substantially full-length. For example, the length of the repaired RNA can be at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or almost 100% of the full-length of the parental RNA.

[0071] In one embodiment, the repaired RNA is 1-11 nucleotides shorter than its parental RNA that formed the nicked or at least partially cleaved RNA.

[0072] In one embodiment, the repaired RNA is 3-5 nucleotides shorter than its parental RNA that formed the nicked or at least partially cleaved RNA and has lost the single-stranded overhang.

[0073] In one embodiment, the repaired RNA is 3-7 nucleotides shorter than its parental RNA that formed the nicked or at least partially cleaved RNA and has lost the anticodon loop or a portion thereof.

[0074] The source of the biological sample can be a biological fluid, a cell, a tissue, an organ, or any combination thereof.

[0075] In some embodiments, the biological sample is from a cell. In one embodiment, the biological sample is from a cancer cell. In one embodiment, the nicked or at least partially cleaved RNA is a precursor of a stress-induced tRNA half (tiRNA).

[0076] In some embodiments, the biological sample is from an extracellular biological fluid. For example, the extracellular biological fluid can be blood, serum, plasma, urine, lymph, saliva, synovial fluid, milk, cerebrospinal fluid or a combination thereof.

[0077] In some embodiments, the method includes further purifying the enzyme-treated RNA.

[0078] Method for detecting RNA

[0079] The methods described herein can be used to detect RNA in biological samples, such as extracellular RNA, with a particular focus on providing important information about highly structured RNAs (such as those that are nicked or partially cleaved), which are generally not distinguishable by conventional or currently available sequencing and / or amplification methods. The method can monitor gene expression changes in tissues by sequencing extracellular samples and monitor diseases (diagnosis, prognosis, recurrence, response to treatment, etc.) based on liquid biopsy analysis.

[0080] Accordingly, another aspect of the invention relates to a method for detecting RNA in a biological sample. The method includes providing a biological sample containing nicked or at least partially cleaved RNA; purifying the nicked or at least partially cleaved RNA contained in the biological sample under non-denaturing conditions to remove non-RNA components; treating the purified RNA with at least one of the following: (i) one or more enzymes that exhibit the activity of an RNA 3'-phosphatase or cyclophosphate and the activity of an RNA 5'-kinase, and an RNA ligase, or (ii) a 3'-5' RNA ligase, thereby repairing at least a portion of the nicked or partially cleaved RNA; and detecting the repaired RNA.

[0081] All of the above descriptions and all of the embodiments discussed in the above aspects related to methods for enzymatically repairing nicked or at least partially cleaved RNA, including aspects of the biological sample, nicked or at least partially cleaved RNA, various RNA purification, isolation, and / or enrichment methods, non-denaturing conditions, various enzyme treatment protocols, and the structure and sequence of the repaired RNA, are applicable to this aspect of the invention related to the method for detecting RNA from a biological sample.

[0082] The methods described herein can be applied to vesicle samples, non-vesicle samples, or total extracellular samples. It can be applied to patients with various diseases or conditions or healthy donors. It can be applied to animals in human or veterinary medicine.

[0083] After the nicked or at least partially cleaved RNA in the biological sample is enzymatically repaired, the RNA can be further reverse transcribed with a conventional reverse transcriptase or a thermostable reverse transcriptase. In one embodiment, the RNA can be further reverse transcribed with a thermostable reverse transcriptase. Typical thermostable reverse transcriptases are enzymes that can work at high temperatures to disrupt the internal structure of RNA and have a higher tolerance for modified bases. Exemplary thermostable reverse transcriptases suitable for the applications herein include reverse transcriptases derived from retroelements, such as TGIRT III, and reverse transcriptases derived from retroviruses, such as Superscript IV, etc.

[0084] After the nicked or at least partially cleaved RNA in a biological sample has been enzymatically repaired, the RNA can be detected by various detection methods known in the art.

[0085] In some embodiments, the method for detecting RNA in a biological sample is performed in the absence of conditions that cause denaturation of the RNA molecule. In one embodiment, the method is performed in the absence of conditions including heating, chemical denaturants, or a combination thereof.

[0086] Alternatively, in some embodiments, conditions that cause denaturation of the RNA molecule, such as heating, chemical denaturants, or a combination thereof, can be introduced, but are introduced after the enzymatic repair step (i.e., the enzyme treatment step) described herein.

[0087] In some embodiments, the detection includes sequencing, amplification, nucleic acid hybridization, or a combination thereof.

[0088] In one embodiment, the detection includes quantitative RT-PCR (RT-qPCR).

[0089] In one embodiment, the detection includes a form of high-throughput sequencing, which can be any form of high-throughput sequencing, including but not limited to sequencing by synthesis, nanopore sequencing, or any related technique useful for obtaining a nucleic acid sequence.

[0090] In one embodiment, the biological sample is treated with a ribonuclease inhibitor before or after purifying the nicked or at least partially cleaved RNA contained in the biological sample.

[0091] Examples

[0092] The following examples are for illustrative purposes only and are not intended to limit the scope of the invention in any way. In the case of specific materials being mentioned, they are for illustrative purposes only and are not intended to limit the invention. Those skilled in the art can develop equivalent methods or reactants without exercising creativity and without departing from the scope of the invention.

[0093] Example 1 - Enzymatic Repair of Nicked tRNA in Human Biological Samples

[0094] Materials and Methods

[0095] Cell Culture

[0096] U2-OS cells were cultured in DMEM (Gibco) containing 4.5 g / L D-glucose and 110 mg / L sodium pyruvate, supplemented with 10% fetal bovine serum (FBS) (Gibco) and without antibiotics.

[0097] Biological Fluid Samples

[0098] Blood and urine samples were collected at the Pasteur Institute of Montevideo. Blood samples were collected from healthy donors by venipuncture into serum collection tubes and centrifuged at 2,500 rpm for 15 minutes to separate the serum, which was then stored at -20 °C until use.

[0099] Twenty milliliters of human urine samples were collected from healthy donors into sterile containers within 1 hour. The samples were transferred to 10 mL Falcon tubes and centrifuged at 300 × g and 4 °C for 10 minutes, then at 2,000 × g and 4 °C for 20 minutes. The supernatant was then stored at -20 °C until use.

[0100] RNA was purified by solid-phase extraction (SPE).

[0101] SPE was performed using the Monarch RNA Cleanup Kit (10 μg binding capacity column, New England Biolabs, NEB), except for the purification of stress-induced tRNA-derived fragments in U2-OS cells, where the Total RNA Miniprep Kit (NEB) was used. The purification was carried out according to the manufacturer's instructions, but in several experiments, the volume of ethanol added to the binding buffer was doubled to avoid loss of small RNAs.

[0102] Generation of stress-induced tRNA halves and purification of intracellular RNA

[0103] To generate stress-induced tRNA halves (tiRNAs), freshly prepared 500 μM sodium arsenite (Sigma-Aldrich) was added to U2-OS cells grown to 90% confluence in DMEM + 10% FBS. After incubation at 37 °C for 2 hours, the medium was removed, the cells were washed with warm 1× PBS, and then RNA was extracted using the Total RNA Miniprep Kit (NEB). According to the manufacturer's instructions, with two modifications: i) cell lysis was performed by directly adding 2 mL of lysis buffer to the cell monolayer and then incubating briefly (5 minutes) at room temperature; and ii) after elution from the RNA-binding column, twice the indicated volume of ethanol was added to the RNA sample.

[0104] RNA decay analysis

[0105] To determine the RNA half-life in biological fluids, 1 μg of heat-denatured and refolded (1 minute at 90 °C followed by 30 minutes at room temperature) U2-OS total RNA was added to 50 μL of undiluted human urine, undiluted human serum, diluted human serum, or FBS (all in 10% 1× PBS solution). Additionally, 1 μg of heat-denatured and refolded total RNA was incubated with 0.5 μg / mL recombinant human ribonuclease 1 (r-RNase 1; BonOpusBio) at 37 °C for different times. The reactions were stopped by adding SPE binding buffer and RNA purification solution.

[0106] In vitro RNA digestion

[0107] To generate in vitro nicked tRNA and / or tDR, 1 μg of heat-denatured and refolded U2-OS total RNA was mixed with 40 μL of r-RNase 1 (diluted to 0.0625 μg / mL in PBS) at 37 °C for 15, 30, or 60 minutes.

[0108] RNA ligation assay

[0109] For ligation assays involving T4 RNA ligase, 5 μL of in vitro digested RNA (or RNA purified from CCM) was incubated in a 10 μL reaction at 37 °C for 1 hour, which contained 20 U RI, 1 mM ATP, 1× T4 PNK reaction buffer, and the required enzyme combination. The enzyme mixture included: 10 U T4 RNA ligase 1 (Rnl1, NEB) or T4 RNA ligase 2 (Rnl2, NEB) and / or 10 U T4 PNK (wild type or 3'-phosphatase negative, NEB).

[0110] As a control, the RNA was heat-denatured (1 minute at 90 °C followed by immediate placement on ice) before enzyme treatment.

[0111] For RtcB ligation, the reaction mixture (10 μL; 1 hour at 37 °C) contained 5 μL of in vitro digested RNA (with or without pre-heat denaturation), 20 U RI, 1× RtcB ligase buffer, 1 mM GTP, 1 mM Mn 2+ and 1 μM RtcB ligase from Escherichia coli (NEB). The reactions were terminated by adding 2× RNA loading dye and analyzed by Northern blotting.

[0112] Identification of non-vesicular nicked tRNA in biological fluids

[0113] Thaw 200 μL of healthy donor human serum samples, centrifuge at 2,000×g and 4 °C for 10 minutes, and dilute in 12 mL of PBS. Ultracentrifuge at 256,000×g and 4 °C for 1 hour in an Optima XPN ultracentrifuge (Beckman Coulter) equipped with an SW 40Ti rotor to deplete EVs. Then ultrafilter and concentrate the supernatant to 200 μL using a 10,000 MWCO AmiconUltra-15 centrifugal filter (Merck). Then, add 440 μL of RNA binding buffer included in the RNA Cleanup Kit (NEB) to the concentrated supernatant and treat with 20 μL of Proteinase K (QIAgen) at 37 °C for 30 minutes. Then purify the nucleic acids with SPE and elute in 50 μL of nuclease-free H 2 O (Invitrogen). Analyze the samples by size exclusion chromatography using an FPLC system.

[0114] Size exclusion chromatography (FPLC)

[0115] Dilute the total RNA (with or without heat denaturation and refolding) from non-vesicular samples from human serum or U2-OS cells stressed with sodium arsenite in 1×PBS (500 μL), centrifuge at 10,000×g and 4 °C for 10 minutes, and then inject into a Superdex 75 10 / 300 column (GE).

[0116] Use a Pure FPLC system to perform size exclusion chromatography (SEC) in 0.2 μm-filtered 1×PBS at 0.5 mL / min, and collect 0.2 mL fractions while monitoring the absorbance at 260 and 280 nm. Precipitate the nucleic acids in the selected fractions overnight at -20 °C with ethanol (700 μL of absolute ethanol; 100 μL of 3 M NaAc, pH = 5.2; 0.5 μL of glycogen blue), and centrifuge at 12,000×g and 4 °C for 15 minutes. Wash the pellet with 500 μL of 75% ethanol, centrifuge at 12,000×g and 4 °C for 15 minutes, and then resuspend in 10 μL of nuclease-free water (Invitrogen) and then perform Northern blotting or stem-loop RT-qPCR.

[0117] Northern blotting

[0118] Perform Northern blotting with DIG-labeled DNA probes as described in Tosar (Tosar et al., 2020). Obtain the band intensity by densitometry using GelQuant 2.0 software.

[0119] For denaturing Northern blotting, 5 μL of RNA was mixed with 5 μL of loading buffer containing 95% formamide, 1 mM EDTA, 0.02% SDS, 0.02% bromophenol blue, and 0.01% xylene cyanol, heated to 65 °C for 5 minutes, and then run on a 10 × 10 cm 10% polyacrylamide gel containing 7 M urea in 1× Tris-borate EDTA (TBE, pH 8.4).

[0120] For native Northern blotting, the RNA sample was mixed with 1 μL of 6× native loading buffer and run on a gel containing 1× Tris-borate (pH 8.3) and 10 mM MgCl 2 (TB + Mg 2+ ). The gel was run in 0.5× TBE or 0.5× TB + Mg 2+ running buffer at room temperature for 80 minutes, stained with 1× SYBR Gold (Invitrogen), and then transferred to a positively charged nylon membrane (Roche) in 0.5× TBE at a constant I = 0.3 A for 30 minutes using a semi-dry Trans-Blot Turbo transfer system (Bio-Rad).

[0121] The membrane was UV cross-linked and hybridized with a digoxigenin-labeled DNA probe in DIG Easy Hyb solution (Roche) at 42 °C for 16 hours. After hybridization, the membrane was washed with low-stringency wash buffer (twice, 2× SSC / 0.1% SDS) for 5 minutes at room temperature, with high-stringency wash buffer (1× SSC / 0.1% SDS) for 5 minutes at 42 °C, blocked with 1× blocking solution (Roche) for 30 minutes at room temperature, and probed with an alkaline phosphatase-labeled anti-digoxigenin antibody (Roche) for 30 minutes. The membrane was washed twice with 1× TBS-T for 5 minutes each, and then incubated in detection buffer (Roche). The signal was then visualized using ready-to-use CDP-Star (Roche) and detected using an Amersham ImageQuant 800 imager (GE Healthcare / Cytiva).

[0122] Probe (5' to 3'):

[0123] rRNA 28S 5': CACGTCTGATCTGAGGTCGC (SEQ ID NO:1)

[0124] rRNA 18S 5': ATGCTACTGGCAGGATCAAC (SEQ ID NO:2)

[0125] rRNA 5.8S: CGCACGAGCCGAGTGATCCAC (SEQ ID NO:3)

[0126] rRNA 5S 5': GGTGGTATGGCCGTAGAC (SEQ ID NO:4)

[0127] 7SL: CACTACAGCCCAGAACTCCTGGACT (SEQ ID NO:5)

[0128] tRNA Gly GCC 5': CTACCACTGAACCACCCATGC (SEQ ID NO:6)

[0129] tRNA Lys UUU 5': CTGATGCTCTACCGACTGAGCTATCCGGGC (SEQ ID NO:7)

[0130] tRNA Asp GUC 5': TCACCACTATACTAACGAGGA (SEQ ID NO:8)

[0131] tRNA Glu GUC 5': TAACCACTAGACCACCAG (SEQ ID NO:9)

[0132] tRNA Gly GCC 3': GCCGGGAATCGAACCCGGGCCTCCCGCG (SEQ ID NO:10)

[0133] tRNA Gly GCC / Asp GUC ACL: TCCCGCGTGGCAGGCGAGAA (SEQ ID NO:11)

[0134] tRNA Lys UUU ACL: CCTCAGATTAAAAGTCTGATG (SEQ ID NO:12)

[0135] All oligonucleotides were obtained from Integrated DNA Technologies (IDT, USA) and labeled with the second-generation DIG oligonucleotide tailing kit (Roche) according to the manufacturer's instructions.

[0136] Stem-loop RT-qPCR

[0137] Small RNAs were amplified and quantified using stem-loop RT-qPCR according to the protocol of Tosar et al. (Tosar et al., 2015, 2018). Briefly, tRNA Gly GCC 5’ halves and specific cDNA of miR-21-5p were obtained using SuperScript II (Thermo Scientific). The purified RNA was heated at 90 °C for 1 minute and immediately placed on ice for reverse transcription. qPCR was performed using a QuantStudio 3 real-time PCR system (Thermo Scientific) and FastStart Universal SYBR Green Master (Rox; Roche). Two -Cq values were obtained and normalized relative to the fraction containing the highest signal.

[0138] Primers (5’ to 3’)

[0139] Stem-loop RT primer (“X” represents the 3’ overhang specific for the assay):

[0140] GTCGTATCCA GTGCAGGGTC CGAGGTATTC GCACTGGATA CGACXXXXXX (SEQ ID NO:13)

[0141] tRNA Gly GCC (5’ half, 35 nt, 3’ overhang): GGCAGG

[0142] tRNA Gly GCC (5’ half, 30 nt, 3’ overhang): GCGAGA

[0143] miR-21-5p (3’ overhang): GTCAAC

[0144] tRNA Gly GCC (5’ half, F-primer): CCGCATTGGTTCAGTGGT (SEQ ID NO:14)

[0145] miR-21-5p (F-primer): gccccgTAGCTTATCAGACTGATGT (SEQ ID NO:15)

[0146] 9 GG / AA(F - Primer): gctcgGCATTGGTAATTCAGTGGTA (SEQ ID NO:16)

[0147] Universal reverse primer: GTGCAGGGTCCGAGGT (SEQ ID NO:17)

[0148] All primers were obtained from Integrated DNA Technologies (IDT, USA). The lowercase letters in these primers indicate the presence of added bases to increase the melting temperature.

[0149] RT - PCR of full - length tRNA.

[0150] Mix 2 μL of 10 ng / μL U2 - OS total RNA (input) or ribonuclease 1 - treated RNA (starting from an equal amount of input RNA) with 1 μL of 2 μM gene - specific RT primer and 1 μL of 10 mM (each) dNTP mixture in a reaction volume of 11 μL. Incubate at 65 °C for 5 minutes and cool on ice for at least 1 minute. The annealed RNA is mixed with 4 μL of 5X SuperScript IV (SSIV, Thermo) buffer, 1 μL of 0.1 M DTT, 20 U RI, and 20 U SSIV RT. The reaction is incubated at 65 °C for 10 minutes and then at 80 °C for 10 minutes. Dilute the cDNA 1 / 2 before qPCR or 1 / 10 for endpoint PCR.

[0151] Gene - specific RT primers for tRNAGlyGCC1 - 4:

[0152] GCGTCTCACTTATGCACAGCGAACTTGCATGGGCCGGG (SEQ ID NO:18)

[0153] tRNAGlyGCC - 1 (F - primer): GCATGGGTGGTTCAGTGGTA (SEQ ID NO:19)

[0154] Universal tRNA reverse primer: GTCTCACTTATGCACAGCGAA (SEQ ID NO:20)

[0155] Results

[0156] Identifying naked RNAs stable in the presence of serum

[0157] To search for intrinsically stable RNAs in extracellular samples, a large number of cellular transcripts were screened to determine whether they could resist degradation in serum - containing medium in the absence of their protein counterparts ( Figure 1)。As Figure 1 shown, the naked rRNA degrades within less than a minute, which is manifested as the lack of Northern blot signal without ribonuclease inhibitor (RI). In contrast, the full-length tRNA Lys UUU still exists at the input level after 1.5 hours, indicating that this tRNA cannot be effectively targeted by serum ribonucleases. This was not observed for other tRNAs (such as tRNA Gly GCC ), which, like rRNA, were not detected after one minute.

[0158] The naked full-length tRNA Lys UUU is intrinsically stable in biological fluids

[0159] To accurately measure the tRNA half-life, the previous assay with better time resolution was repeated (Figure 2, A). Surprisingly, the half-life of tRNA Lys UUU (about 750 seconds) is 58 times that of tRNA Gly GCC (about 13 seconds) and more than 125 times that of rRNA or 7SL RNA (<6 seconds). The high stability of tRNA Lys UUU may not be explained by its association with serum-derived proteins, as incubation with recombinant human ribonuclease 1 (r-RNase1, representing the most common ribonuclease in human blood) yields almost the same results (Figure 2, A). These results show that tRNA Lys UUU is intrinsically resistant to the action of ribonuclease A family members.

[0160] Subsequently, these assays were repeated in human biological fluids, including urine, diluted serum, and undiluted serum (Figure 2, B and C). Surprisingly, the stability of the full-length tRNA Lys UUU is consistently higher than that of any other tested RNA, regardless of the sample type. Overall, there are significant differences in intrinsic extracellular stability not only between different RNA biotypes but also within the same RNA biotype.

[0161] The glycine tRNA half-molecules generated in biological fluids are very stable

[0162] The full-length tRNA Gly GCCDegraded almost completely in less than a minute in 10% FBS (Figure 2, A) and human biological fluids (Figure 2, B and C). However, its cleavage results in the formation of the 5’ half, which shows a very long half-life even in undiluted human serum.

[0163] A careful examination of the data in these figures reveals a large difference in the stability of fragments derived from the same parental tRNA but with slightly different lengths. tRNA Gly GCC Is first cleaved at the anticodon loop, generating 5’ halves of 34 - 35 nt, which rapidly disappear. These fragments are then replaced by shorter fragments (about 30 - 31 nt) that are highly stable, and their cleavage sites are at the start of the anticodon loop. Using a lower concentration of ribonuclease 1 can identify and expose another cleavage site in the TΨC loop (position 54) (Figure 3). The cleavage sites at positions 30 and 34 - 35 may be independent, or the cleavage at position 34 - 35 may be a prerequisite for efficient cleavage at position 30.

[0164] Overall, tRNA seems to be more resistant to degradation than other longer non-coding RNAs, but there are also large differences in stability (more than 50-fold) among tRNAs. In addition, the naked 30 - 31 nt tRNA Gly GCC 5’ halves can accumulate at higher ribonuclease concentrations or after incubation in biological fluids for a longer time.

[0165] Nicked tRNA is the source of 5’ and 3’ tRNA

[0166] Subsequently, the relative stabilities of the 5’ and 3’ tRNA Gly GCC Derived fragments were compared, and the results are shown in Figure 4. Surprisingly, 3’ fragments of 30 - 35 nt were observed, and their decay rates were comparable to those of the 5’ counterparts. In some biological fluids, such as FBS (Figure 4, A) and urine (Figure 4, B), 3’ tRNA-derived fragments less than 20 nt were observed at the initial time points (1 - 5 minutes). However, the half-lives of these fragments are very short, in sharp contrast to the 5’ and 3’ halves.

[0167] Without being bound by theory, tRNA Gly GCCThe 5’ and 3’ halves can remain physically associated after ribonuclease cleavage, representing full-length tRNA with a cleaved phosphodiester bond at the anticodon loop (i.e., in the form of “nicked tRNA”). This would explain the similar decay kinetics of the halves in different biological fluids. However, introducing any irreversible denaturation step (such as those used in standard molecular biology methods) would result in the dissociation of nicked tRNA into single-stranded tRNA halves. This can be further tested by the new assay described herein that can probe oligomeric RNA complexes under native conditions.

[0168] Nicked tRNA is a natural substrate for T4 polynucleotide kinase (PNK) and T4 RNA ligase 1 (Rnl1) (Schwer et al., 2004). When Escherichia coli is infected with bacteriophage T4, a bacterial anticodon nuclease named PrrC is activated and cleaves the host's tRNA Lys in an attempt to block the translation of viral proteins (Kaufmann, 2000). This results in nicked tRNA with a 3’ cyclic phosphate (3’cP) and a 5’-OH adjacent to the cleavage site. However, the phage has evolved two enzymes capable of performing end repair (PNK) and tRNA repair (Rnl1). These enzymes can be used to study the native structure of human tRNA halves in extracellular samples.

[0169] Total RNA in purified cells was incubated with ribonuclease 1 for 0, 15, or 60 minutes (Figure 5, A). After 60 minutes, full-length tRNA Gly GCC was completely degraded and converted into a tDR pool (Figure 5, A). The ribonuclease 1 degradation products were purified by a silica-based solid-phase extraction (SPE) column and treated with PNK alone, PNK and Rnl1 sequentially, or PNK and Rnl2 (dsRNA-specific ligase) sequentially. Surprisingly, sequential treatment with PNK and Rnl1 regenerated a single band with a size roughly the same as that of the homologous full-length tRNA (Figure 5, AB), and was more efficient than ligation with Rnl2.

[0170] To demonstrate that the re-ligated product of tRNA size is indeed repaired tRNA, a third probe (named ACL for anticodon loop) was designed to bridge the Gly GCC two sides of the tRNA anticodon (Figure 5, C) such that its Tm for pairing with the 5’ or 3’ halves is lower than the measured hybridization temperature (42 °C). Thus, the ACL probe cannot detect 5’ or 3’ tDR, but should be able to hybridize with full-length or repaired tRNA Gly GCC Since the sequence similarity among tRNAs, ACL will also recognize tRNA AspGUC anticodon loop. However, these tRNAs migrate slightly differently in denaturing urea gels, allowing the assay to be multiplexed.

[0171] Surprisingly, treatment of ribonuclease 1-treated RNA with PNK and Rnl1 regenerated tRNA-sized products that were observable with 5’, 3’, or ACL probes (Figure 5, D). In the case of the ACL, two bands corresponding to tRNA Gly GCC and tRNA Asp GUC size were detected in an otherwise blank Northern blot after treatment with the enzyme mixture. Since the sequence patch recognized by the ACL probe is too short without enzymatic repair, this disfavors the possibility of trans-ligation (artificial ligation products) between the tRNA halves and other RNAs present in the sample. Additionally, heating and subsequent cooling of ribonuclease-treated RNA prior to addition of the enzyme mixture prevented the generation of tRNA-sized bands, indicating that ligation occurs in cis under the assay conditions (true nicked RNA). Rnl1 alone or when incubated with a mutant version of T4 PNK lacking its 3’ phosphatase activity was also unable to reconstruct full-length tRNA.

[0172] In summary, nicked tRNAs were generated in vitro using different tRNAs as substrates. These nicked tRNAs were enzymatically repaired to regenerate nearly full-length tRNAs, likely lacking the 3’ NCCA overhang in the in vitro setting (Akiyama et al., 2022). Additional bases can be trimmed after prolonged exposure to extracellular ribonucleases, but these shorter forms will still be repaired using the assay described herein.

[0173] Common RNA extraction methods irreversibly solubilize nicked tRNAs

[0174] Although heating ribonuclease-treated RNA prior to serial incubation with PNK and Rnl1 prevented the formation of tRNA-sized bands, it also affected the detection of monomeric 5’ and 3’ tRNA halves (Figure 5, D). It was also observed that heating alone was sufficient to reduce the intensity of the Northern blot bands corresponding to the tRNA halves ( Figure 6 ).

[0175] By doubling the amount of ethanol added to the sample, the size exclusion value of the SPE RNA purification column can be reduced. When twice the volume of ethanol is used, the amount of eluted tRNA halves increases, and the effect of heat disappears. This shows that when one volume of ethanol is used, nicked tRNA (>70 nt) can bind to the SPE column, but monomeric 30 - 35 nt tRNA halves are lost during the flow-through. In contrast, doubling the amount of ethanol enables efficient capture of both nicked tRNA and heat-induced monomeric tRNA halves. The enzymatic repair assay was then repeated under conditions suitable for small RNAs (2×EtOH), where monomeric tRNA halves were still detectable in the control (i.e., heated) reaction ( Figure 6 ).

[0176] Given that heating has an irreversible effect on nicked tRNA, the effects of various commonly used RNA extraction methods were investigated, many of which include agents known to disrupt base-pairing interactions (e.g., phenol). A recent study of different RNA purification methods for liquid biopsy found that the miRNeasy kit (Qiagen) recovers a broad spectrum of exRNAs associated with different carrier subclasses (Srinivasan et al., 2019). However, when RNA treated with ribonuclease 1 was purified using this kit according to the manufacturer's instructions, tRNA halves were recovered at an acceptable yield but were no longer suitable for enzymatic repair (Figure 7, A). Similar results were obtained when comparing phenol-free SPE purification with TRIzol (Figure 7, B, left). Interestingly, increasing the second round of SPE-based purification recovered reparable tRNA halves with a yield approaching 100%. Thus, the guanidinium salts contained in the SPE binding buffer do not affect nicked tRNA, while heating and phenol induce its irreversible dissociation. In addition, the length of the repaired tRNA (estimated by the R f method, Figure 7, B, right) was slightly shorter (4 - 5 nt) than the length of the parental full-length tRNA.

[0177] Nicked tRNA Resists Ribonuclease 1 Cleavage In Vitro

[0178] Since it was observed that nicked tRNA could be purified by SPE, nicked tRNA was generated and purified and treated again with r-ribonuclease 1 (Figure 7, C). The nicked tRNA was not degraded by this treatment (up to 30 minutes at 37 °C). However, heating and subsequent cooling of the nicked tRNA before exposure to r-ribonuclease 1 resulted in complete degradation of the tRNA halves when they were in the single-stranded form.

[0179] In summary, nicked tRNA is a stable reservoir of tRNA halves, which are prone to degradation once separated from their 3' counterparts.

[0180] In vitro-generated tRNA halves are mainly nicked tRNA

[0181] Comparison of the intensities of enzymatically repaired (light gray arrows) and untreated (NT) tRNAs in ribonuclease 1-treated samples purified under optimized conditions Gly GCC of the 5’ halves (Figure 7, A–B) indicated that most tDRs are actually nicked tRNAs.

[0182] Northern blot analysis was also performed after running the RNA on native (TBE-Mg 2+ ) polyacrylamide gels to further confirm this conclusion (Figure 7, D). Under native conditions, the electrophoretic behavior of ribonuclease 1-treated tRNA Gly GCC was almost identical to that of untreated full-length tRNA. Less than 10% of the total signal in the treated lanes corresponded to true tDRs. This confirmed that Figure 2A the rapid disappearance of the full-length tRNA band observed in

[0183] was actually an artifact caused by denaturing conditions, and that greater than 90% of the tRNA remained nicked tRNA after 1 h of enzymatic digestion. Interestingly, in native gels, nicked tRNA migrated slightly faster than non-nicked full-length tRNA, consistent with the irreversible loss of the NCCA 3’ overhang inferred from previous assays (Figure 7, B).

[0184] Native Northern blots also confirmed that, unlike phenol-free RNA purification columns (SPE), heating or standard RNA purification methods (such as TRIzol or miRNeasy) resulted in irreversible dissociation of nicked tRNA (Figure 7, D).

[0185] The 3’–5’ RNA ligase RtcB can also ligate nicked tRNA 2+ RtcB is a ligase involved in tRNA splicing and RNA repair in all domains of life (Englert et al., 2011; Popow et al., 2011; Tanaka and Shuman, 2011). Unlike 5’-3’ T4 Rnl1, RtcB seals cleaved RNAs with 2’,3’-cyclic phosphate (2,3-cP) and 5’-OH termini in the presence of GTP and Mn

[0186] Figure 7E(Left) shows that one-step enzymatic repair of nicked tRNA with RtCB from Escherichia coli is sufficient to repair RNase 1-treated RNA without prior end repair with T4 PNK. In fact, RtcB regenerates a tRNA-sized band when incubated with RNase 1-treated RNA, and the production of this ligation product is inhibited by heating (Figure 7, E, left). The repaired tRNA-sized band is 4 or 5 nucleotides shorter than the parental full-length tRNA (Figure 7, E, right).

[0187] Nicked tRNA is the source of stress-induced tRNA halves in cells

[0188] When there is a large amount of full-length tRNA in intracellular samples, enzymatic repair assays may not be very effective in detecting the presence of intracellular nicked tRNA. In this paper, a different strategy was adopted, which is based on intracellular RNA fractionation by size exclusion chromatography (SEC) under non-denaturing conditions (Figure 8, A-C), to separate stress-induced tRNA halves (tiRNA) present in cells (even when complexed with proteins, they are single-stranded fragments) from their parental tRNAs.

[0189] Based on the method described by Yamasaki et al. (Yamasaki et al., 2009), U2-OS cells were exposed to 500 μM sodium arsenite for 2 hours, and the presence of stress-induced tRNA halves was verified by Northern blotting (Figure 8, A). Then, stressed cells were lysed by a phenol-free method, and intracellular RNA was purified by SPE and separated by SEC using an FPLC system. As a control, the RNA was heat-denatured, cooled to room temperature, and injected into a parallel assay.

[0190] In V e A tRNA peak eluted continuously at V = 9.80 mL, which was demonstrated by the recorded absorbance at 260 nm (Figure 8, A) and Northern blotting (Figure 8, B). Surprisingly, Northern blot bands consistent with the 5’ tRNA halves (35 and 30 nt) were observed only in the fractions corresponding to the tRNA peak (Figure 8, B). According to the method described by Tosar et al. (Tosar et al., 2015), a more sensitive stem-loop RT-qPCR assay was used to identify tRNA halves in other fractions. Although miR-21-5p eluted at V e = 11.4 mL, the 30-nt 5’ half of tRNA Gly GCC was hardly detectable, except at V eAt 9.80 mL, most full-length tRNAs elute at this point (Figure 8, C). Heating the RNA before injection reduces the Northern blot signal of the full-length tRNA peak (Figure 8, B), while shifting the major SL-RT-qPCR peak of the 5’ half of the tRNA Gly to a higher elution volume. In the heated samples, most 30-nt tRNA-derived fragments co-elute with miR-21-5p.

[0191] tRNA Gly GCC dimerization of the 5’ half could also account for their elution at V e＝9.80mL in these columns (Tosar et al., 2018). However, transfection of cells with 30-nt tRNA Gly GCC 9 GG / AA mutants (which can dimerize in vitro) (Tosar et al., 2018) showed that the chromatographic elution was consistent with their monomeric form (Figure 8, D). This suggests that either intracellular conditions are not conducive to the formation of homodimers or that the dimers dissociate during cell lysis.

[0192] In summary, dimerization cannot account for the elution of intracellular tRNA halves in chromatographic peaks corresponding to RNAs of twice the expected size. Thus, the results suggest that at least some intracellular tiRNAs exist primarily in the form of nicked tRNAs. Alternatively, intracellular tiRNAs may be degraded upon cell lysis, leaving only the more stable nicked tRNAs.

[0193] Non-vesicular nicked tRNAs circulate in human biofluids

[0194] After validating a method capable of separating nicked tRNAs from single-stranded tRNA halves, this method was used to further address the question of whether nicked tRNAs circulate in human biofluids.

[0195] 200 μL of human serum was diluted in PBS and EVs were precipitated by ultracentrifugation. RNA was then isolated from the protease K-treated supernatant and fractionated by SEC. Surprisingly, the 30-nt tRNA Gly GCC 5’ half could be amplified by SL-RT-qPCR (Figure 8, E), mostly within the size range corresponding to full-length tRNAs, which were not expected to be present in these samples (Figure 2, B). These results suggest that non-vesicular nicked tRNAs are present in human serum.

[0196] Nicked tRNAs have low reverse transcription efficiency without repair.

[0197] The broken phosphodiester bond can be a hindrance, inhibiting the reverse transcription (RT) of nicked tRNA in its native state, thus impeding the analysis of nicked tRNA by RT-PCR or sequencing. This effect was evaluated using a thermostable retroviral reverse transcriptase, which was primed by a gene-specific RT primer aligned with the 3′ end of the tRNA Gly GCC ( Figure 9A ). Forward and reverse PCR primers were placed near the 5′ and 3′ ends of the tRNA Gly GCC respectively. Surprisingly, RNase-1-treated RNA was not amplified unless enzymatic repair (T4PNK + T4 Rnl1) was performed prior to RT. Consistent with the Northern blot results shown in Figure 7A , 7B and 7E, heating the samples prior to the enzymatic treatment step also inhibited RT-PCR amplification (see Figure 9A ). In contrast, in RNase 1-treated samples, the 30 nt 5′ tRNA Gly GCC half increased 200 to 700-fold compared to the input, indicating limitations in the analysis of small RNA expression in samples containing the nicked form of its parental RNA. Figure 9A Shown is that the reverse transcriptase (depicted as a truck) cannot read through the discontinuities characteristic of nicked or damaged RNA, indicating that the enzymatic repair process disclosed herein is necessary for the efficient reverse transcription and amplification (and thus sequencing) of nicked tRNA.

[0198] Discussion

[0199] It is generally recognized that all RNAs are inherently unstable and cannot circulate in extracellular samples unless in the context of RNP, lipoprotein, and / or EV. Although this applies to rRNA-derived fragments( Figure 1 ) and non-vesicular RNU2-derived small RNAs (Tosar et al., 2022), full-length or nicked tRNAs exhibit surprisingly long half-lives in human biological fluids, even when incubated in naked form. Although these RNAs can also be present in RNP complexes in the extracellular space, the results herein suggest that protein complexation is not a prerequisite for significant extracellular stability.

[0200] Importantly, differences in extracellular stability were observed among tRNAs. At one extreme, full-length tRNA Lys UUU was processed more slowly than any other tested RNA, regardless of sample type. This is in contrast to the rapidly processed full-length tRNA Gly GCCIn sharp contrast. One explanation is that post-transcriptionally modified bases are at least partly responsible for these different behaviors. According to the modomics database, tRNA Gly GCC does not contain modified bases in the anticodon loop, except for m5C at position 37. In contrast, at least in yeast, tRNA Lys UUU contains mcm5s2U and t6A at positions 34 and 37, respectively. Although these modifications have been shown to promote the cleavage of bacterial and yeast anticodon ribonucleases (Bacusmo et al., 2018; Lentini et al., 2018), mammalian ribonucleases are generally inhibited by modified bases present in the anticodon (Lyons et al., 2018).

[0201] Considering that nicked tRNA rather than tDR is the stable degradation intermediate that determines the abundance of non-vesicular glycine tRNA halves, the stability differences between tRNAs are less obvious. Although full-length tRNA Gly GCC can be efficiently cleaved at several positions by extracellular ribonucleases in human body fluids, the result of these cleavage events is a molecule that may still resemble tRNA, even if it has some broken phosphodiester bonds. Thus, although tRNA Lys UUU and tRNA Gly GCC exhibit completely different behaviors when analyzed by Northern blotting after exposure to ribonucleases, this difference may be exaggerated because standard Northern blotting forces nicked tRNA to denature. This is also the case when phenol-purified RNA is used and when RNA is heated at any stage of the protocol (e.g., RNA-seq). The important conclusion is that the true, native form of RNA is not always apprehended because most available analytical techniques include a denaturation step at some point.

[0202] The case of tRNA Lys UUU is also interesting. Although it is highly resistant to degradation, once cleaved by RNase 1 or FBS-derived RNase A, it does not exist in the form of nicked tRNA (Figure 2, A). This shows that extracellular ribonucleases are involved in the degradation of tDR (Li et al., 2022). In contrast, tRNA Gly GCCSensitive to initial cleavage events, the resulting cleaved tRNA is intrinsically stable. The differential stability between different tRNA sequences can be regarded as a new instance of the non-canonical "moonlighting" function of tRNA, which is related to the diversity of the tRNA homologous decoder pool (Avcilar-Kucukgoze and Kashina, 2020).

[0203] In the literature, cleaved tRNA is not regarded as a stable degradation intermediate (Chen et al., 2021). Stress-induced tRNA cleavage at the anticodon loop is considered an irreversible process, while the reversibility of stress-induced cleaved tRNA formation in cellulo is an exciting possibility. In a clinical setting, double-stranded RNA usually needs to be encapsulated in lipid nanoparticles or conjugated with GalNAc for efficient uptake, but single-stranded oligonucleotides are endocytosed spontaneously (Levin, 2019). Therefore, the mechanism of the enzymatic repair process disclosed herein is at least feasible, in which non-vesicular cleaved tRNA is a carrier that can transfer information to the tRNA half that can reach the recipient cell ( Figure 9B ).

[0204] This paper discloses a new analytical technique that can be used to analyze stable non-vesicular RNA circulating in biological fluids. Although this example mainly focuses on tRNA, a careful examination of the gel stained with SYBR Gold shows additional bands that can be restored by co-treatment with PNK and Rnl1 and disappear in heated samples (Figure 7, B). This strongly indicates that the non-vesicular RNA population is much more complex than previously thought, consistent with recent research findings (Tosar et al., 2020). Many stable non-vesicular RNAs are single-stranded molecules that are tightly bound to and protected by extracellular RNA-binding proteins (Arroyo et al., 2011; Tosar et al., 2022; Turchinovich et al., 2011). However, other resilient RNAs circulating in biological fluids may belong to a "new" class of intrinsically stable extracellular RNAs (Tosar, 2021). These molecules can be both highly structured and cleaved.

[0205] There are sequencing methods that can effectively handle highly structured RNAs (Behrens et al., 2021; Qin et al., 2016). However, cleaved RNAs are more challenging because they contain obstacles to reverse transcriptase (i.e., broken phosphodiester bonds; Figure 9A ) and cleaved RNAs are dissociated by phenol, heat, or other denaturing agents. Therefore, the enzymatic repair protocol disclosed herein increases the number and types of RNA molecules that can be analyzed and used as disease biomarkers.

[0206] In this example, protein-free RNA was incubated in human body fluids, and its decay kinetics were measured by Northern blotting. Certain specific naked tRNAs were found to be intrinsically stable. The half-lives of several naked RNAs were measured. While rapid clearance was the norm, the decay of specific full-length tRNAs in body fluids was relatively slow. In addition, the 5’ tRNA halves generated by endonuclease cleavage of unstable tRNAs were highly stable. However, these hyperstable tRNA-derived fragments (tDRs) did not exist as authentic fragments in most extracellular samples. Instead, they circulated mainly as full-length tRNAs containing some broken phosphodiester bonds. Equally surprisingly, these hyperstable RNAs were not single-stranded.

[0207] Studying these nicked tRNAs remains a challenge because standard protocols for RNA extraction, Northern blotting, and RNA sequencing induce their artificial denaturation, even when their presence is supported by native gels. Different enzymatic repair strategies and electrophoretic or chromatographic separation strategies under native conditions were developed and employed in this example. After phenol-free RNA purification, a two-step method was adopted based on enzymatic repair with T4 PNK and Rnl1 (or one-step ligation with recombinant RtcB). Heating the sample before enzymatic treatment prevented repair of nicked tRNAs.

[0208] Under native conditions, nicked tRNAs were separated from tDRs by chromatography. These protocols were used to identify nicked tRNAs in stressed cells and vesicle-depleted human biofluids.

[0209] The results also showed that these RNAs naturally existed as full-length tRNAs containing broken phosphodiester bonds. This was surprising and important because commonly used RNA purification methods, sequencing, and Northern blotting could not detect these nicked or partially cleaved forms, forcing them to unwind into single-stranded tRNA halves. In addition, Figure 9 shows that the enzymatic protocols described herein are necessary for efficient reverse transcription and amplification (and thus sequencing) of nicked tRNAs. As Figure 9A shown, if nicked RNAs are purified under native conditions without an enzymatic repair step, they cannot be efficiently reverse transcribed (and thus amplified and sequenced). The same conclusion also applies to nanopore-based direct RNA sequencing.

[0210] The method shown in this example helps to reveal hidden aspects of the extracellular RNAome composed of intrinsically stable, nicked, highly structured RNAs.

[0211] All documents and references, including but not limited to journal articles or abstracts, published or corresponding US or international patent applications, issued US or foreign patents, or any other documents, are hereby incorporated by reference in their entirety, including all data, tables, charts, and text provided in the cited documents and references.

[0212] References

[0213] Akiyama,Y.,Lyons,S.M.,Fay,M.M.,Tomioka,Y.,Abe,T.,Anderson,P.J.,and Ivanov,P.(2022).Selective Cleavage at CCA Ends and Anticodon Loops of tRNAs by Stress-Induced RNases.Front.Mol.Biosci.9.

[0214] Arroyo,J.D.,Chevillet,J.R.,Kroh,E.M.,Ruf,I.K.,Pritchard,C.C.,Gibson,D.F.,Mitchell,P.S.,Bennett,C.F.,Pogosova-Agadjanyan,E.L.,Stirewalt,D.L.,etal.(2011).Argonaute2 complexes carry a population of circulating microRNAs independent of vesicles in human plasma.Proc.Natl.Acad.Sci.U.S.A.108,5003-5008.

[0215] Avcilar-Kucukgoze,I.,and Kashina,A.(2020).Hijacking tRNAs From Translation:Regulatory Functions of tRNAs in Mammalian Cell Physiology.Front.Mol.Biosci.0,388.

[0216] Bacusmo, J.M., Orsini, S.S., Hu, J., DeMott, M., Thiaville, P.C., Elfarash, A., Paulines, M.J., Rojas-Benítez, D., Meineke, B., Deutsch, C., et al. (2018). The t6A modification acts as a positive determinant for the anticodon nuclease PrrC, and is distinctively nonessential in Streptococcus mutans. RNA Biol. 15, 508 - 517.

[0217] Behrens, A., Rodschinka, G., and Nedialkova, D.D. (2021). High-resolution quantitative profiling of tRNA abundance and modification status in eukaryotes by mim-tRNAseq. Mol. Cell 81, 1802 - 1815.e7.

[0218] Buck, A.H., Coakley, G., Simbari, F., McSorley, H.J., Quintana, J.F., Le Bihan, T., Kumar, S., Abreu-Goodger, C., Lear, M., Harcus, Y., et al. (2014). Exosomes secreted by nematode parasites transfer small RNAs to mammalian cells and modulate innate immunity. Nat. Commun. 5, 5488.

[0219] Cai, Q., Qiao, L., Wang, M., He, B., Lin, F.-M., Palmquist, J., Huang, S.-D., and Jin, H. (2018). Plants send small RNAs in extracellular vesicles to fungal pathogen to silence virulence genes. Science 360, 1126 - 1129.

[0220] Chakravarty, A.K., Subbotin, R., Chait, B.T., and Shuman, S. (2012). RNA ligase RtcB splices 3′-phosphate and 5′-OH ends via covalent RtcB-(histidinyl)-GMP and polynucleotide-(3′)pp(5′)G intermediates. Proc. Natl. Acad. Sci. U.S.A. 109.

[0221] Chen, Q., Zhang, X., Shi, J., Yan, M., and Zhou, T. (2021). Origins and evolving functionalities of tRNA-derived small RNAs. Trends Biochem. Sci. 46, 790 - 804. David, M., Borasio, G.D., and Kaufmann, G. (1982). Bacteriophage T4-induced anticodon-loop nuclease detected in a host strain restrictive to RNA ligase mutants. Proc. Natl. Acad. Sci. 79, 7097 - 7101.

[0222] Dhahbi, J.M., Spindler, S.R., Atamna, H., Yamakawa, A., Boffelli, D., Mote, P., and Martin, D.I.K. (2013). 5’tRNA halves are present as abundant complexes in serum, concentrated in blood cells, and modulated by aging and calorie restriction. BMC Genomics 14, 298.

[0223] Englert, M., Sheppard, K., Aslanian, A., Yates, J.R., and D. (2011). Archaeal 3′-phosphate RNA splicing ligase characterization identifies the missing component in tRNA maturation. Proc. Natl. Acad. Sci. U.S.A. 108.

[0224] Fu, H., Feng, J., Liu, Q., Sun, F., Tie, Y., Zhu, J., Xing, R., Sun, Z., and Zheng, X. (2009). Stress induces tRNA cleavage by angiogenin in mammalian cells. FEBS Lett. 583, 437 - 442.

[0225] Gámbaro, F., Li Calzi, M., Fagúndez, P., Costa, B., Greif, G., Mallick, E., Lyons, S., Ivanov, P., Witwer, K., Cayota, A., et al. (2020). Stable tRNA halves can be sorted into extracellular vesicles and delivered to recipient cells in a concentration-dependent manner. RNA Biol. 17, 1168 - 1182.

[0226] Garcia-Silva, M.R., Cura Das Neves, R.F., Cabrera-Cabrera, F., Sanguinetti, J., Medeiros, L.C., Robello, C., Naya, H., Fernandez-Calero, T., Souto-Padron, T., De Souza, W., et al. (2014). Extracellular vesicles shed by Trypanosoma cruzi are linked to small RNA pathways, life cycle regulation, and susceptibility to infection of mammalian cells. Parasitol. Res. 113, 285-304.

[0227] Geekiyanage, H., Rayatpisheh, S., Wohlschlegel, J.A., Brown, R., and Ambros, V. (2020). Extracellular microRNAs in human circulation are associated with miRISC complexes that are accessible to anti-AGO2 antibody and can bind target mimic oligonucleotides. Proc. Natl. Acad. Sci. U.S.A. 117, 24213-24223.

[0228] Heitzer, E., Haque, I. S., Roberts, C. E. S., and Speicher, M. R. (2019). Current and future perspectives of liquid biopsies in genomics-driven oncology. Nat. Rev. Genet. 20, 71-88. Ivanov, P., Emara, M. M., Villen, J., Gygi, S. P., and Anderson, P. (2011). Angiogenin-induced tRNA fragments inhibit translation initiation. Mol. Cell 43, 613-623. Kaufmann, G. (2000). Anticodon nucleases. Trends Biochem. Sci. 25, 70-74.

[0229] Kim, H. K., Fuchs, G., Wang, S., Wei, W., Zhang, Y., Park, H., Roy-Chaudhuri, B., Li, P., Xu, J., Chu, K., et al. (2017). A transfer-RNA-derived small RNA regulates ribosome biogenesis. Nature 552, 57-62.

[0230] Kuscu, C., Kumar, P., Kiran, M., Su, Z., Malik, A., and Dutta, A. (2018). tRNA fragments (tRFs) guide Ago to regulate gene expression post-transcriptionally in a Dicer-independent manner. RNA 24, 1093-1105.

[0231] Lentini, J. M., Ramos, J., and Fu, D. (2018). Monitoring the 5-methoxycarbonylmethyl-2-thiouridine (mcm5s2U) modification in eukaryotic tRNAs via the γ-toxin endonuclease. RNA 24, 749-758.

[0232] Levin, A.A. (2019). Treating Disease at the RNA Level with Oligonucleotides. N. Engl. J. Med. 380, 57 - 70.

[0233] Li, G., Manning, A.C., Bagi, A., Yang, X., Gokulnath, P., Spanos, M., Howard, J., Chan, P.P., Sweeney, T., Kitchen, R., et al. (2022). Distinct Stress - Dependent Signatures of Cellular and Extracellular tRNA - Derived Small RNAs. Adv. Sci. 9.

[0234] Li, Y., Luo, J., Zhou, H., Liao, J.Y., Ma, L.M., Chen, Y.Q., and Qu, L.H. (2008). Stress - induced tRNA - derived RNAs: A novel class of small RNAs in the primitive eukaryote Giardia lamblia. Nucleic Acids Res. 36, 6048 - 6055.

[0235] Lyons, S.M., Fay, M.M., and Ivanov, P. (2018). The role of RNA modifications in the regulation of tRNA cleavage. FEBS Lett. 592, 2828 - 2844.

[0236] Lyons, S.M., Kharel, P., Akiyama, Y., Ojha, S., Dave, D., Tsvetkov, V., Merrick, W., Ivanov, P., and Anderson, P. (2021). eIF4G has intrinsic G - quadruplex binding activity that is required for tiRNA function. Nucleic Acids Res. 48, 6223 - 6233.

[0237] Mateescu, B., Kowal, E. J. K., van Balkom, B. W. M., Bartel, S., Bhattacharyya, S. N., Buzás, E. I., Buck, A. H., de Candia, P., Chow, F. W. N., Das, S., et al. (2017). Obstacles and opportunities in the functional analysis of extracellular vesicle RNA - An ISEV position paper. J. Extracell. Vesicles 6, 1286095.

[0238] Nechooshtan, G., Yunusov, D., Chang, K., and Gingeras, T. R. (2020). Processing by RNase 1 forms tRNA halves and distinct Y RNA fragments in the extracellular environment. Nucleic Acids Res. 48, 8035 - 8049.

[0239] Nolte’T Hoen, E. N. M., Buermans, H. P. J., Waasdorp, M., Stoorvogel, W., Wauben, M. H. M., and’T Hoen, P. A. C. (2012). Deep sequencing of RNA from immune cell - derived vesicles uncovers the selective incorporation of small non - coding RNA biotypes with potential regulatory functions. Nucleic Acids Res. 40, 9272 - 9285.

[0240] O’Brien, K., Breyne, K., Ughetto, S., Laurent, L. C., and Breakefield, X. O. (2020). RNA delivery by extracellular vesicles in mammalian cells and its applications. Nat. Rev. Mol. Cell Biol. 21, 585 - 606.

[0241] Pawar, K., Shigematsu, M., Sharbati, S., and Kirino, Y. (2020). Infection-induced 5’-half molecules of tRNAHisGUG activate Toll-like receptor 7. PLoS Biol. 18, e3000982. Popow, J., Englert, M., Weitzer, S., Schleiffer, A., Mierzwa, B., Mechtler, K., Trowitzsch, S., Will, C. L., Lührmann, R., D., et al. (2011). HSPC117 is the essential subunit of a human tRNA splicing ligase complex. Science (80-.). 331, 760 - 764.

[0242] Qin, Y., Yao, J., Wu, D. C., Nottingham, R. M., Mohr, S., Hunicke-Smith, S., and Lambowitz, A. M. (2016). High-throughput sequencing of human plasma RNA by using thermostable group II intron reverse transcriptases. RNA 22, 111 - 128.

[0243] Sanadgol, N., L., Drino, A., Jovic, M., and Schaefer, M. R. (2022). Experimental paradigms revisited: oxidative stress-induced tRNA fragmentation does not correlate with stress granule formation but is associated with delayed cell death. Nucleic Acids Res. 50, 6919 - 6937.

[0244] Schwer, B., Sawaya, R., Ho, C. K., and Shuman, S. (2004). Portability and fidelity of RNA-repair systems. Proc. Natl. Acad. Sci. U.S.A. 101, 2788 - 2793.

[0245] Skog, J., Wurdinger, T., van Rijn, S., Meijer, D. H., Gainche, L., Sena-Esteves, M., Curry, W. T. J., Carter, B. S., Krichevsky, A. M., and Breakefield, X. O. (2008). Glioblastoma microvesicles transport RNA and proteins that promote tumour growth and provide diagnostic biomarkers. Nat. Cell Biol. 10, 1470 - 1476.

[0246] Sorrentino, S. (2010). The eight human “canonical” ribonucleases: Molecular diversity, catalytic properties, and special biological actions of the enzyme proteins. FEBS Lett. 584, 2194 - 2200.

[0247] Srinivasan, S., Yeri, A., Cheah, P. S., Chung, A., Danielson, K., De Hoff, P., Filant, J., Laurent, C. D., Laurent, L. D., Magee, R., et al. (2019). Small RNA Sequencing across Diverse Biofluids Identifies Optimal Methods for exRNA Isolation. Cell 177, 446 - 462. Tanaka, N., and Shuman, S. (2011). RtcB is the RNA ligase component of an Escherichia coli RNA repair operon. J. Biol. Chem. 286, 7727 - 7731.

[0248] Thomou, T., Mori, M. A., Dreyfuss, J. M., Konishi, M., Sakaguchi, M., Wolfrum, C., Rao, T. N., Winnay, J. N., Garcia - Martin, R., Grinspoon, S. K., et al. (2017). Adipose - derived circulating miRNAs regulate gene expression in other tissues. Nature 542, 450 - 455. Thompson, D. M., Lu, C., Green, P. J., and Parker, R. (2008). tRNA cleavage is a conserved response to oxidative stress in eukaryotes. RNA 14, 2095 - 2103.

[0249] Tosar, J. P. (2021). Die hard: resilient RNAs in the blood. Nat. Rev. Mol. Cell Biol. 22, 373 - 373.

[0250] Tosar, J. P., and Cayota, A. (2020). Extracellular tRNAs and tRNA - derived fragments. RNA Biol. 17, 1149 - 1167.

[0251] Tosar, J.P., Gámbaro, F., Sanguinetti, J., Bonilla, B., Witwer, K.W., and Cayota, A. (2015). Assessment of small RNA sorting into different extracellular fractions revealed by high-throughput sequencing of breast cell lines. Nucleic Acids Res. 43, 5601-5616. Tosar, J.P., Gambaro, F., Darre, L., Pantano, S., Westhof, E., and Cayota, A. (2018). Dimerization confers increased stability to nucleases in 5’halves from glycine and glutamic acid tRNAs. Nucleic Acids Res. 46, 9081-9093.

[0252] Tosar, J.P., Segovia, M., Castellano, M., Gámbaro, F., Akiyama, Y., Fagúndez, P., Olivera, Costa, B., Possi, T., Hill, M., et al. (2020). Fragmentation of extracellular ribosomes and tRNAs shapes the extracellular RNAome. Nucleic Acids Res. 48, 12874-12888. Tosar, J.P., Witwer, K., and Cayota, A. (2021). Revisiting Extracellular RNA Release, Processing, and Function. Trends Biochem. Sci. 46, 438-445.

[0253] Tosar, J.P., Cayota, A., and Witwer, K. (2022). Exomeres and supermeres: Monolithic or diverse?J. Extracell. Biol. 1, e45.

[0254] Turchinovich, A., Weiz, L., Langheinz, A., and Burwinkel, B. (2011). Characterization of extracellular circulating microRNA. Nucleic Acids Res. 39, 7223 - 7233.

[0255] Valadi, H., Ekstrom, K., Bossios, A., Sjostrand, M., Lee, J.J., and Lotvall, J.O. (2007). Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells. Nat. Cell Biol. 9, 654 - 659.

[0256] Vickers, K.C., Palmisano, B.T., Shoucri, B.M., Shamburek, R.D., and Remaley, A.T. (2011). MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins. Nat. Cell Biol. 13, 423 - 435.

[0257] Wei, Z., Batagov, A.O., Schinelli, S., Wang, J., Wang, Y., El Fatimy, R., Rabinovsky, R., Balaj, L., Chen, C.C., Hochberg, F., et al. (2017). Coding and noncoding landscape of extracellular RNA released by human glioma stem cells. Nat. Commun. 8, 1145.

[0258] Xiao, Y., Driedonks, T., Witwer, K. W., Wang, Q., and Yin, H. (2020). How does an RNA selfie work? EV-associated RNA in innate immunity as self or danger. J. Extracell. Vesicles 9, 1793515.

[0259] Yamasaki, S., Ivanov, P., Hu, G.-F., and Anderson, P. (2009). Angiogenic cleaves tRNA and promotes stress-induced translational repression. J. Cell Biol. 185, 35 - 42.

[0260] Zhang, Q., Jeppesen, D. K., Higginbotham, J. N., Graves-Deal, R., Trinh, V. Q., Ramirez, M. A., Sohn, Y., Neininger, A. C., Taneja, N., McKinley, E. T., et al. (2021). Supermeres are functional extracellular nanoparticles replete with disease biomarkers and therapeutic targets. Nat. Cell Biol. 23, 1240 - 1254.

[0261] Zhang, Y., Zhang, Y., Shi, J., Zhang, H., Cao, Z., Gao, X., Ren, W., Ning, Y., Ning, L., Cao, Y., et al. (2014). Identification and characterization of an ancient class of small RNAs enriched in serum associating with active infection. J. Mol. Cell Biol. 6, 172 - 174.

Claims

1. A method for enzymatically repairing nicked or at least partially cleaved RNA, comprising: providing a biological sample containing nicked or at least partially cleaved RNA; purifying the nicked or at least partially cleaved RNA contained in the biological sample under non-denaturing conditions to remove non-RNA components; and treating the purified RNA with at least one of the following: (i) one or more enzymes exhibiting the activities of RNA 3'-phosphatase or cyclophosphate and RNA 5'-kinase, and an RNA ligase, or (ii) a 3'-5' RNA ligase, thereby forming repaired RNA from the nicked or at least partially cleaved RNA.

2. The method according to claim 1, wherein the nicked or at least partially cleaved RNA comprises one or more RNAs selected from the following: tRNA, rRNA, YRNA, 7SL RNA, 7SK RNA, snRNA, snoRNA, vaultRNA, Alu RNA, transposon-derived RNA, pri-microRNA, pre-microRNA, mRNA exons, mRNA introns, 5'UTR, 3'UTR, and fragments and combinations thereof.

3. The method according to claim 2, wherein the nicked or at least partially cleaved RNA comprises tRNA, tRNA fragments (tRF), tRNA-derived RNA (tDR) and / or tRNA halves.

4. The method according to claim 3, wherein at least a portion of the nicked or at least partially cleaved RNA comprises a single-stranded tRNA half.

5. The method according to claim 1, wherein the repaired RNA comprises a nucleotide sequence that is the same or substantially the same as the parental RNA that formed the nicked or at least partially cleaved RNA in full length or substantially full length.

6. The method according to claim 1, wherein the treatment is carried out with (i)(a) polynucleotide kinase (PNK) and an RNA ligase.

7. The method according to claim 6, wherein the polynucleotide kinase is added together with the RNA ligase or added before the RNA ligase.

8. The method according to claim 6 or 7, wherein the polynucleotide kinase is T4 polynucleotide kinase (PNK).

9. The method according to claim 1, wherein the treatment is carried out with (i)(b) RNA 3'-phosphatase or RNA 2',3'-cyclophosphate, RNA 5'-kinase and an RNA ligase.

10. The method according to claim 9, wherein the RNA 3'-phosphatase or RNA 2',3'-cyclophosphate, the RNA 5'-kinase and the RNA ligase are added together or sequentially.

11. The method according to any one of claims 6-10, wherein the RNA ligase is T4 RNA ligase 1.

12. The method according to claim 1, wherein the treatment is carried out with (ii) a 3'-5' RNA ligase.

13. The method according to claim 12, wherein the 3'-5' RNA ligase is an RtcB ligase.

14. The method according to any one of claims 6-10 and 12-13, wherein the treatment is carried out at least in part in the presence of adenosine triphosphate (ATP) or guanosine-5'-triphosphate (GTP).

15. The method according to claim 1, wherein the non-denaturing conditions include silica-based solid-phase extraction, chromatography, RNA precipitation, or a combination thereof.

16. The method according to claim 1, wherein the method is carried out in the absence of conditions that cause denaturation of RNA molecules.

17. The method according to claim 16, wherein the conditions include heating, adaptor ligation, chemical denaturants, or a combination thereof.

18. The method according to claim 16, wherein the conditions include the use of phenol.

19. The method according to claim 1, wherein the source of the biological sample is a biological fluid, a cell, a tissue, an organ, or any combination thereof.

20. The method according to claim 1, wherein the biological sample is from an extracellular biological fluid.

21. The method according to claim 20, wherein the extracellular biological fluid is blood, serum, plasma, urine, lymph fluid, saliva, synovial fluid, milk, cerebrospinal fluid, or a combination thereof.

22. The method according to claim 1, wherein the biological sample is from a cell.

23. The method according to claim 22, wherein the biological sample is from a cancer cell.

24. The method according to claim 22, wherein the nicked or at least partially cleaved RNA is a stress-induced tRNA half.

25. The method according to claim 1, wherein at least a portion of the nicked or partially cleaved RNA is formed by non-vesicular extracellular RNA.

26. The method according to claim 1, wherein at least a portion of the nicked or partially cleaved RNA is formed by extracellular RNA.

27. The method according to claim 5, wherein the repaired RNA comprises a nucleotide sequence that is the same or substantially the same in full length as the parental RNA that formed the nicked or at least partially cleaved RNA.

28. The method according to claim 5, wherein the repaired RNA is 1-11 nucleotides shorter than its parental RNA that formed the nicked or at least partially cleaved RNA.

29. The method according to claim 5, wherein the repaired RNA is 3-5 nucleotides shorter than its parental RNA that formed the nicked or at least partially cleaved RNA and loses a single-stranded overhang.

30. The method according to claim 5, wherein the repaired RNA is 3-7 nucleotides shorter than its parental RNA that formed the nicked or at least partially cleaved RNA and loses an anticodon loop or a portion thereof.

31. A method for detecting RNA in a biological sample, comprising: providing a biological sample containing nicked or at least partially cleaved RNA; Purify the nicked or at least partially cleaved RNA contained in the biological sample under non-denaturing conditions to remove non-RNA components; Treat the purified RNA with at least one of the following: (i) one or more enzymes that exhibit the activity of RNA 3'-phosphatase or cyclic phosphatase and the activity of RNA 5'-kinase, and an RNA ligase, or (ii) a 3'-5' RNA ligase, thereby repairing at least a portion of the nicked or partially cleaved RNA; and Detect the repaired RNA.

32. The method according to claim 31, wherein the detection comprises sequencing, amplification, nucleic acid hybridization, or a combination thereof.

33. The method according to claim 31, wherein the detection comprises quantitative RT-PCR (RT-qPCR).

34. The method according to claim 31, wherein the detection comprises a form of high-throughput sequencing.

35. The method according to claim 31, wherein the biological sample is treated with a ribonuclease inhibitor before or after the step of purifying the nicked or at least partially cleaved RNA contained in the biological sample.

36. The method according to claim 31, wherein the nicked or at least partially cleaved RNA comprises one or more RNAs selected from the group consisting of: tRNA, rRNA, YRNA, 7SL RNA, 7SK RNA, snRNA, snoRNA, vaultRNA, Alu RNA, transposon-derived RNA, pri-microRNA, pre-microRNA, mRNA exons, mRNA introns, 5'UTR, 3'UTR, and fragments and combinations thereof.

37. The method according to claim 36, wherein the nicked or at least partially cleaved RNA comprises tRNA, tRNA fragments (tRF), tRNA-derived RNA (tDR), and / or tRNA halves.

38. The method according to claim 37, wherein at least a portion of the nicked or at least partially cleaved RNA comprises a single-stranded tRNA half.

39. The method according to claim 31, wherein the repaired RNA comprises a nucleotide sequence that is the same or substantially the same as the parental RNA that formed the nicked or at least partially cleaved RNA in full length or substantially full length.

40. The method according to claim 31, wherein the treatment is carried out with (i)(a) polynucleotide kinase (PNK) and an RNA ligase.

41. The method according to claim 40, wherein the polynucleotide kinase is added together with the RNA ligase or before the RNA ligase.

42. The method according to claim 40 or 41, wherein the polynucleotide kinase is T4 polynucleotide kinase (PNK).

43. The method according to claim 31, wherein the treatment is carried out with (i)(b) RNA 3'-phosphatase or RNA 2',3'-cyclic phosphatase, RNA 5'-kinase, and an RNA ligase.

44. The method according to claim 43, wherein the RNA 3'-phosphatase or RNA 2',3'-cyclic phosphatase, the RNA 5'-kinase, and the RNA ligase are added together or sequentially.

45. The method according to any one of claims 40-44, wherein the RNA ligase is T4 RNA ligase 1.

46. The method according to claim 31, wherein the treatment is carried out with (ii) a 3'-5' RNA ligase.

47. The method according to claim 46, wherein the 3'-5' RNA ligase is an RtcB ligase.

48. The method according to any one of claims 40-44 and 46-47, wherein the treatment is carried out at least in part in the presence of adenosine triphosphate (ATP) or guanosine-5'-triphosphate (GTP).

49. The method according to claim 31, wherein the non-denaturing conditions include silica-based solid-phase extraction, chromatography, RNA precipitation, or a combination thereof.

50. The method according to claim 31, wherein the method is carried out in the absence of conditions that cause denaturation of the RNA molecule.

51. The method according to claim 50, wherein the conditions include heating, chemical denaturants, or a combination thereof.

52. The method according to claim 50, wherein the conditions include the use of phenol.

53. The method according to claim 31, wherein the source of the biological sample is a biological fluid, a cell, a tissue, an organ, or any combination thereof.

54. The method according to claim 31, wherein the biological sample is derived from an extracellular biological fluid.

55. The method according to claim 54, wherein the extracellular biological fluid is blood, serum, plasma, urine, lymphatic fluid, saliva, synovial fluid, milk, cerebrospinal fluid, or a combination thereof.

56. The method according to claim 31, wherein the biological sample is derived from a cell.

57. The method according to claim 56, wherein the biological sample is derived from a cancer cell.

58. The method according to claim 56, wherein the nicked or at least partially cleaved RNA is a stress-induced tRNA half.

59. The method according to claim 31, wherein at least a portion of the nicked or partially cleaved RNA is formed by non-vesicular extracellular RNA.

60. The method according to claim 31, wherein at least a portion of the nicked or partially cleaved RNA is formed by extracellular RNA.

61. The method according to claim 39, wherein the repaired RNA comprises a nucleotide sequence that is identical or substantially identical in full length to the parental RNA that formed the nicked or at least partially cleaved RNA.

62. The method according to claim 39, wherein the repaired RNA is 1-11 nucleotides shorter than its parental RNA that formed the nicked or at least partially cleaved RNA.

63. The method according to claim 39, wherein the repaired RNA is 3-5 nucleotides shorter than its parental RNA that forms the nick or the at least partially cleaved RNA, and loses the single-stranded overhang.

64. The method according to claim 39, wherein the repaired RNA is 3-7 nucleotides shorter than its parental RNA that forms the nick or the at least partially cleaved RNA, and loses the anticodon loop or a part thereof.

Images