A Eu-MOF Probe Material, Its Preparation Method and Application in miRNA Detection
By preparing Eu-MOF probe materials, using their strong adsorption and fluorescence quenching properties of FAM labeled pDNA, combined with smartphone detection of miRNA, the problems of high detection cost, complexity and sensitivity caused by the instability of existing MOF materials in aqueous solutions are solved, and low cost, fast and highly selective miRNA detection is achieved.
Patent Information
- Application Number
- CN202310764221.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-06-27
- Publication Date
- 2025-07-04
- Estimated Expiration
- 2043-06-27
AI Technical Summary
The existing MOF materials are unstable in aqueous solutions, resulting in high cost, complex operation and low sensitivity for detecting miRNAs in biosensing applications, making it difficult to achieve low-cost, fast and highly selective miRNA detection.
An Eu-MOF probe material was developed. By synthesizing 2,2'-difluoro-4,4'-biphenyldicarboxylic acid and Eu(NO3)3·6H2O, Eu-MOF with a crystal structure of trislop P-1 space group was prepared. It used its strong adsorption and fluorescence quenching characteristics of FAM-labeled pDNA and miRNA detection was performed in combination with a smartphone.
It realizes low-cost, fast, sensitive and highly selective miRNA detection, with a detection limit of 0.32 pM, which can distinguish single-base mismatched miRNA family members and accurately analyze the expression level of miRNA in cancer cell samples, with portability and high fluorescence stability.
Smart Images

Figure CN116655936B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a Eu-MOF probe material, a preparation method thereof, and an application in miRNA detection, belonging to the field of metal-organic frameworks. Background Art
[0002] MicroRNAs (miRNAs) are a class of very important biological macromolecules. Due to their important roles in gene expression regulation, physiological and pathological processes, they have been used as ideal biomarkers for diagnosing various diseases including cardiovascular diseases, diabetes, and lung cancer. However, the detection of miRNAs is still challenging because of their low abundance, susceptibility to degradation, and sequence similarity. Currently, many detection methods including quantitative reverse transcription polymerase chain reaction (qRT-PCR), northern blotting, in situ hybridization, real-time quantitative PCR, and microarrays have been used for miRNA detection. However, these techniques are expensive and complex in operation, which limits their further practical applications. Therefore, there is an urgent need for a practical and efficient miRNA detection method.
[0003] As a class of porous hybrid materials composed of metal ions and polydentate organic ligands, metal-organic frameworks (MOFs) have been widely used in fields such as catalysis, gas separation, and drug release due to their special properties such as high specific surface area, specific micropore volume, and structural diversity. In particular, MOFs have been used as luminescent probes for sensing small molecules such as vapors, ions, and organic molecules. It is well known that the organic linkers in MOFs usually include conjugated systems and special functional groups, which can provide a basis for potential π-π stacking, hydrogen bonding, and electrostatic interactions with nucleic acid sequences, resulting in changes in luminescence. Therefore, MOFs can be used as luminescent sensors for detecting nucleic acid sequences. However, only a few well-established MOFs, including UIO-66-NH2, MIL-101, MIL-88B, etc., have been studied for the luminescent detection of nucleic acid sequences because MOFs have poor stability in aqueous solutions, which are essential for their biosensing applications.
[0004] The patent application (application number: 202110977430.9, title: A ratiometric fluorescent probe and its preparation method and application) discloses a novel ratiometric fluorescent probe based on gold nanocluster-loaded metal-organic frameworks. A metal-organic framework material with a large specific surface area and high porosity is used as a carrier, and gold nanoclusters are generated by an in-situ synthesis method, and the designed and synthesized double-stranded probe is assembled on the surface of the carrier. However, the gold nanoparticles in the metal-organic framework in this patent application are relatively expensive, the synthesis of the ligands of MOFs is relatively complex, and the detection limit is high and the detection sensitivity is not high.
[0005] Therefore, the development of low-cost, rapid, sensitive, and highly selective MOF sensors for miRNA detection remains a major challenge. Summary of the Invention
[0006] Object of the Invention: The technical problem to be solved by the present invention is to provide a low-cost, rapid, sensitive, and highly selective MOF probe material, its preparation method, and its application in miRNA detection.
[0007] Technical Solution: To solve the above technical problem, the present invention provides a Eu-MOF probe material, and the crystal structure of the probe material is the triclinic P-1 space group, α = 104.143(4)°, β = 98.718(5)°, γ = 101.196(5)°, Z = 1.
[0008] The present invention also provides a method for preparing the Eu-MOF probe material, including the following steps:
[0009] (1) Synthesize 2,2'-difluoro-4,4'-biphenyldicarboxylic acid:
[0010]
[0011] (2) Synthesize Eu-MOF: Mix Eu(NO3)3·6H2O, the 2,2'-difluoro-4,4'-biphenyldicarboxylic acid described in step (1), N,N'-dimethylformamide, and H2O, heat, and then cool to obtain [Eu2L3(H2O)5]·0.5H2O·1.25DMF, that is, Eu-MOF is obtained.
[0012] Among them, in step (2), the concentration volume ratio of Eu(NO3)3·6H2O, 2,2'-difluoro-4,4'-biphenyldicarboxylic acid, N,N'-dimethylformamide, and H2O is 0.1 mM:0.15 mM:2.5 mL:2.5 mL.
[0013] The present invention also provides a smartphone-based Eu-MOF-derived sensing system, including the Eu-MOF probe material described above.
[0014] Furthermore, the application of the Eu-MOF probe material or the smartphone-based Eu-MOF-derived sensing system in detecting miRNA.
[0015] The present invention also provides a method for detecting miRNA, comprising the following steps: grinding the Eu-MOF probe material and mixing it with polyvinylpyrrolidone in Tris-HCl, adding pDNA, RNase inhibitor, DSN and miRNA, incubating, performing fluorescence spectroscopy analysis, taking a photo of the sample with a smartphone, displaying it in the analysis software, calculating the RGB values and outputting the quantitative analysis result; obtaining the relationship between the fluorescence intensity and the miRNA concentration, and obtaining the miRNA concentration according to the fluorescence intensity.
[0016] Among them, the linear relationship between the fluorescence intensity and the logarithm of the miRNA concentration is Y = 181.780 + 255.615X, and the correlation coefficient R 2 = 0.992, where Y is the fluorescence intensity and X is the logarithm of the miRNA concentration.
[0017] Among them, after incubation, the color intensity is observed. The linear relationship between the color intensity and the logarithm of the miRNA concentration is Y = 109.538 + 21.3469X, and the correlation coefficient R 2 = 0.993; where Y is the color intensity and X is the logarithm of the miRNA concentration.
[0018] Among them, the concentration ratio of the Eu-MOF to polyvinylpyrrolidone is 5:1.
[0019] Among them, the concentration ratio of the pDNA, RNase inhibitor and DSN is 50:2:0.4 nM / (U / mL).
[0020] Among them, the concentration ratio of the Eu-MOF to Tris-HCl is 5:1 (μg / mL) / mM.
[0021] Furthermore, the sequences of the miRNA are as shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 or SEQ ID NO.8.
[0022] Among them, the concentration volume ratio of Eu(NO3)3·6H2O, H2L, N,N'-dimethylformamide and H2O is 0.1 mmol: 0.15 mM: 2.5 mL: 2.5 mL.
[0023] Since MOFs show good affinity for fluorophore-labeled biomolecules, they can be used as fluorescence probes. The present invention explains the function of Eu-MOF as a fluorescence probe from a structural perspective. On the one hand, the biphenyl backbone of the L 2- ligand contains a rich conjugated π-electron system for binding pDNA. On the other hand, L2- The fluorine in the ligand is an electron-withdrawing group, which can be used to construct MOF materials with special structures and properties. These materials can exhibit strong electrostatic interactions with other electron-rich molecules. In the present invention, although the fluorine group does not coordinate with metal ions, due to its electronic and geometric effects, it may affect the assembly process, final structure, and even properties of MOFs.
[0024] Principle of the present invention: As Figure 1 shown, the FAM-labeled pDNA exhibits green fluorescence. Since Eu-MOF shows strong adsorption to the FAM-labeled pDNA, the green fluorescence of FAM can be quenched through the photoinduced electron transfer (PET) process. When miRNA is introduced, miRNA forms a double-stranded structure pDNA-miRNA with pDNA. Since Eu-MOF shows weak adsorption to the double-stranded structure, the pDNA-miRNA double-stranded structure is released from Eu-MOF, resulting in the recovery of the green fluorescence quenched by Eu-MOF. Since the red fluorescence of Eu-MOF remains unchanged, the color of the detection system changes from red to yellow (red + green = yellow). Therefore, the quantitative determination of miRNA can be achieved by measuring the fluorescence change of the detection system.
[0025] Beneficial effects: Compared with the prior art, the present invention has the following remarkable advantages: 1. A novel and water-stable Eu-MOF is synthesized by assembling H2L and self-luminescent Eu(III) ions in the present invention; 2. The preparation time is only 6 h, which is much lower than the MOF preparation time usually reported; 3. Eu-MOF emits a red fluorescence signal and can selectively absorb and quench the fluorescence of FAM-labeled pDNA; 4. The non-emissive pDNA@Eu-MOF hybrid can be used as a sensing platform for miRNA detection with the help of a smartphone; after adding the complementary target miRNA, FAM-DNA dissociates from Eu-MOF, resulting in a change in fluorescence color; 5. The method of the present invention shows high sensitivity to miRNA (miR-892b), with a detection limit (LOD) of 0.32 pM, and has high selectivity for distinguishing miRNA family members with single-base mismatches; 6. The expression level of miRNA in cancer cell samples can be accurately analyzed; 7. The smartphone-based (Eu-MOF) derived sensing system of the present invention has excellent advantages, including portable and visual characteristics, high fluorescence quenching efficiency, short response time, auto-luminescence, and high fluorescence stability; 8. It not only guides the synthesis of new MOFs but also opens up a perspective for the further development of biological applications of MOF materials. Description of the drawings
[0026] Figure 1 It is the sensing principle for miRNA detection based on Eu-MOF;
[0027] Figure 2 is the nuclear magnetic resonance spectrum of H2L;
[0028] Figure 3 A is the energy-dispersive X-ray spectroscopy pattern of Eu-MOF; Figure 3 B is the powder X-ray diffraction patterns of simulated Eu-MOF, Eu-MOF of the present invention, and Eu-MOF for water treatment; Figure 3 C is the infrared spectrum of Eu-MOF;
[0029] Figure 4 is the microstructure of Eu-MOF: Figure 4 A is the asymmetric unit of Eu-MOF; Figure 4 B is the coordination environment of Eu1 and Eu2; Figure 4 C is the ligand L 2- 's coordination mode; Figure 4 D is the 1D [Eu2(CO2)2]n chain along the axis; Figure 4 E is the 2D layer along the ab plane to synthesize a three-dimensional network structure;
[0030] Figure 5 is the emission spectrum of Eu-MOF;
[0031] Figure 6 are the rectangular channels along the axis in Eu-MOF;
[0032] Figure 7 is to study the effects of the concentration of Eu-MOF, the concentration of DSN, reaction time, and reaction temperature on miRNA detection: Figure 7 A is the effect of Eu-MOF concentration on miRNA detection; Figure 7 B is the effect of reaction temperature on miRNA detection; Figure 7 C is the effect of reaction time on miRNA detection; Figure 7 D is the effect of the concentration of DSN on miRNA detection;
[0033] Figure 8 performed quantitative analysis on miRNA: Figure 8 A is the photo of the reaction solution obtained from the smartphone; Figure 8 B is to analyze the relationship between the color intensity of the corresponding solution and the miRNA concentration through the smartphone; Figure 8 C is the linear relationship between the color intensity and the logarithm of the miRNA concentration;
[0034] Figure 9 are the emission spectra of the corresponding solutions with different concentrations of target miRNA;
[0035] Figure 10 are the fluorescence intensities of different target RNAs;
[0036] Figure 11 For the detection of miR-892b expression levels in different cancer cell lysates;
[0037] Figure 12 For the fluorescence quenching efficiency of Eu-MOF on the FAM-DNA probe;
[0038] Figure 13 For the fluorescence quenching time of Eu-MOF on FAM-DNA;
[0039] Figure 14 For the visual fluorescence color change of the Eu-MOF / FAM-DNA complex relative to the MoS2 / FAM-DNA complex after adding different concentrations of the target miRNA;
[0040] Figure 15 For the fluorescence stability of Eu-MOF in aqueous solution. Detailed implementation manners
[0041] The technical solutions of the present invention will be further described below in conjunction with the accompanying drawings.
[0042] Eu(NO3)3·6H2O, polyvinylpyrrolidone (PVP), and N,N'-dimethylformamide (DMF) are all from Sinopharm Chemical Reagent Co., Ltd. in China. HPLC-purified miRNAs and RNase inhibitors are provided by Takara Biotechnology Co., Ltd. (Dalian, China). The FAM-labeled probe is synthesized by Sangon Biotech (Shanghai) Co., Ltd. (China Co., Ltd.). Diethyl pyrocarbonate (DEPC) is provided by Sigma-Aldrich Co., LLC (St. Louis, Missouri, USA). Double-strand specific nuclease (DSN) is purchased from Evrogen Co., Ltd (Moscow, Russia). The miRNeasy mini kit for miRNA extraction is purchased from Qiagen (Hilden, Germany). Monolayer molybdenum disulfide (MoS2) nanosheets are introduced by Nanjing Xianfeng Nano Material Technology Co., Ltd. (Nanjing, China). All cells are from the BeNa Culture Collection Center (Suzhou, China). The sequences of miRNAs and FAM-labeled probes are shown in Table 1. Human breast cancer cells (MCF-7), human breast ductal carcinoma cells (BT-474), human breast duct cancer cells (BT-549), and human breast cancer cells (MDA-MD-435) are all purchased from Takara Biotechnology Co., Ltd. (Dalian, China).
[0043] Table 1 miRNA and DNA sequences in the present invention
[0044]
[0045]
[0046] The IR spectra in the range of 4000 - 400 cm were recorded using KBr pellets on a Bruker Vector 22 FT-IR spectrophotometer. -1 Thermogravimetric analysis (TGA) was carried out on a NETZSCH STA449C thermal analyzer at a heating rate of 10 °C min in a nitrogen atmosphere. -1 The powder X-ray diffraction (PXRD) patterns of the materials were obtained on a Shimadzu X-ray diffractometer XRD-6000. Elemental analysis (C, H, N) was performed using an Elementar Vario EL elemental analyzer. Fluorescence was measured using an LS 55 spectrofluorometer (PerkinElmer, USA). Before analysis, miRNA was diluted to an appropriate concentration with DEPC-treated water. DEPC-treated deionized water was used in all experiments. The cell lines were cultured in a water-jacketed CO2 incubator (Thermo 3111, Billups Rothenberg, Del Mar, CA).
[0047] Example 1 Preparation of Eu-MOF
[0048] 1. Synthesis of 2,2′-difluoro-4,4′-biphenyldicarboxylic acid (H2L):
[0049]
[0050] Specifically as follows:
[0051] (1) Synthesis of 3-fluoro-4-iodobenzoic acid
[0052]
[0053] The experimental procedure is as follows:
[0054] (a) Preparation of 3M H2SO4 solution:
[0055] Measure 32 mL of 1:1 sulfuric acid and 64 mL of distilled water, shake and mix well in a 100 mL ground conical flask to prepare 96 mL of 3M H2SO4 solution, seal and set aside.
[0056] (b) Preparation of NaNO2 solution
[0057] Weigh 2.2078 g (32.0 mmol) of NaNO2 and put it into a 50 mL ground conical flask, dissolve it with 10 mL of distilled water to prepare 10 mL of NaNO2 solution, seal and set aside.
[0058] (c) Preparation of H2SO4 solution of KI
[0059] Weigh 7.2648 g (43.76 mmol) of KI and place it in a 50 mL ground glass conical flask. Dissolve it with 20 mL of 3M H₂SO₄ to prepare a 20 mL H₂SO₄ solution of KI, seal it for later use. Iodide ions are easily oxidized by air in acidic solutions and gradually turn yellow. KI can be weighed first and placed in the bottle, and the solution is prepared immediately before use.
[0060] (d) Diazotization reaction
[0061] Fix a 100 mL beaker on a magnetic stirring platform with a large iron clamp, and then hang a thermometer into the beaker. Place a magnetic stir bar and 4.0332 g (26.0 mmol) of 3-fluoro-4-aminobenzoic acid into the beaker, then measure 24 mL of 3M H₂SO₄ and add it to the beaker. Stir with a glass rod at room temperature to form a homogeneous paste. Immerse the beaker in an ice bath, add 8 mL of ice water and small ice cubes, turn on the magnetic stirrer, cool to 0 - 5 °C, and then quickly add 10 mL of NaNO₂ solution dropwise. At the same time, add small ice cubes in time to strictly control the temperature at 0 - 5 °C. When adding NaNO₂, the lower layer of the liquid will first turn red and finally turn bright yellow. After the addition is complete, add 16 mL of ice water, continue to stir for 40 minutes, and strictly control the temperature at 0 - 5 °C with small ice cubes at any time. Then add an appropriate amount of an aqueous solution prepared from 1.4412 g of urea to remove the remaining nitrous acid (bubbles will be generated). Stir with a glass rod to expel the bubbles until the starch-KI test paper no longer immediately turns dark blue but gradually turns into a light purple that deepens. Keep the prepared bright yellow diazonium salt solution in an ice bath.
[0062] (e) Iodination reaction
[0063] Put the 20 mL H₂SO₄ solution of KI and 40 mL of 3M H₂SO₄ solution into a 500 mL three-necked flask placed in a 60 °C oil bath (or water bath). Plug the side opening of the flask, and connect a tetrafluoro stir paddle and a mechanical stirrer to the upper opening with a tetrafluoro stopper. Add the diazonium salt solution dropwise in batches from the side opening of the flask with a dropper (since there are many suspended solids in the diazonium salt solution and it is easy to clog a constant pressure dropping funnel, it is not used). After adding 1 - 2 droppers of the diazonium salt solution each time, tightly plug the side opening and stir mechanically for 10 minutes to expel the bubbles. Repeat the operation until all the diazonium salt solution is added. Then change to a spherical condenser and reflux at 60 °C until no more bubbles are generated. At this time, the lower layer of the flask is a light solid and the upper layer is a dark red liquid. After the reaction solution cools, add an appropriate amount of an aqueous solution prepared from 1.0 g of Na₂S₂O₃ until the upper clear liquid turns from dark red to light yellow and the starch-KI test paper does not turn blue. Filter by suction - wash with water - wash with Na₂S₂O₃ solution - wash with water to obtain a red filter cake, and obtain the crude product after vacuum drying.
[0064] (f) Recrystallization of the crude product
[0065] Place the crude product in a large eggplant-shaped flask, add chloroform (about 90 mL is needed for 1 g), reflux at 60 °C until completely dissolved, add activated carbon of 1-2% mass for decolorization and then perform hot filtration (using a copper funnel + a triangular funnel, folding the filter paper into a flower shape), place it in the refrigerator for cooling crystallization, filter with a triangular funnel and then perform vacuum drying to obtain yellow crusty crystals. Rotavaporize the mother liquor, recover some products, which are yellow lumpy solids and are used for the next recrystallization.
[0066] Product properties: light yellow needle-shaped crystal crust, melting point 229-230 °C.
[0067] Yield: 6.9162 g.
[0068] (2) Synthesis of methyl 3-fluoro-4-iodobenzoate
[0069]
[0070] The experimental procedure is as follows:
[0071] (a) Methylation reaction
[0072] Prepare a dry 500 mL eggplant-shaped flask and a constant pressure dropping funnel. Wrap the eggplant-shaped flask with aluminum foil, place a large magnetic stir bar in it, add 3.9900 g (15 mmol) of 3-fluoro-4-iodobenzoic acid, 6.4960 g (47 mmol) of K2CO3 and 150 mL of anhydrous acetone, and gently stir until the solid-liquid mixture is uniform. Immerse the eggplant-shaped flask in a cool oil bath, attach the constant pressure dropping funnel, dilute 3.0 mL (32 mmol, not exceeding 5 mL) of dimethyl sulfate with 20 mL of anhydrous acetone and transfer it into the funnel with a dropper (to prevent leakage from the side tube), then drip it into the eggplant-shaped flask. After the dripping is completed, continue stirring at room temperature for 30 minutes. Replace it with a spherical condenser and a newly prepared drying tube / balloon (act quickly, apply vacuum grease at the interface after connection), heat to 80 °C and then cool to 60 °C within a few minutes, and heat under reflux for 12 hours. Do not disassemble the device during the process and do not add additional dimethyl sulfate or acetone. Monitor by TLC using dichloromethane (wear nitrile gloves), R f ≈ 0.85 is the product spot, R f ≈ 0.75 (with trailing on both sides in a crescent shape) is the impurity spot, and the starting material spot is at the origin. After the monitoring result is satisfactory, remove the drying tube, add 150 mL of distilled water, and continue heating and stirring for 2 hours until the solution becomes clear.
[0073] (b) Extraction
[0074] Extract the mother liquor with 1 × 50 mL of chloroform and 3 × 50 mL of dichloromethane (the organic phase is at the bottom layer), combine the extraction solutions, transfer them to a 250 mL eggplant-shaped flask and rotary evaporate to dryness. After rotary evaporating the extracted mother liquor, dissolve it in water, add an appropriate amount of hydrochloric acid for acidification, and a large amount of suspended solid particles can be obtained. Filter by suction and perform vacuum drying to recover the unreacted 3-fluoro-4-iodobenzoic acid.
[0075] (c) Column chromatography separation
[0076] Take 30 g of silica gel for column chromatography, mix it evenly with dichloromethane in a 250 mL beaker, pour it into the chromatography column that has been filled with a small amount of dichloromethane to pack the column, and then use an ear bulb or a hard rubber tube to tap the column body to make it compact. Put 2 spoons of silica gel into the eggplant-shaped flask containing the crude product, wash the inner wall of the flask with dichloromethane by shaking, then spin-dry, scrape clean. When the liquid level in the column is close to the top of the column body, pour the dry sample into the top layer of the column body, and then rinse the eggplant-shaped flask for sample preparation with a small amount of dichloromethane, and transfer it into the column synchronously with the dry sample to prevent the upper column body from cracking. Finally, put a small amount of quartz sand. Use dichloromethane as the mobile phase for column chromatography (do not pressurize to flush the column). Observe the column body through a flashlight transmission, and the front of the yellow band can be seen. Continuously monitor by spotting plates, and transfer the colorless components before the collected yellow band into a 250 mL eggplant-shaped flask and a 100 mL eggplant-shaped flask successively with a dropper, and spin-dry step by step. After venting, pay attention to closing the water pump first and then removing the bottle, and plug a ball of cotton at the safety bottle mouth to prevent solid powder from being sucked into the safety bottle. After spin-drying, white crystalline solid methyl 3-fluoro-4-iodobenzoate is obtained.
[0077] Product properties: White or light yellow needle-like crystals, with a strong anise odor, melting point 65 - 70 °C.
[0078] Yield: 4.2000 g.
[0079] (3) Synthesis of methyl 2,2'-difluoro-4,4'-biphenyldicarboxylate
[0080]
[0081] The experimental steps are as follows:
[0082] (a) Activation of copper powder
[0083] Weigh 8 g (1.58 mmol) of elemental iodine and put it into a 1000 mL ground-glass conical flask. Add 400 mL of acetone to the flask and seal it. Ultrasonically oscillate to dissolve the iodine, and at this time, a 2% iodine-acetone solution is formed. Then use another 1000 mL ground-glass conical flask to prepare 400 mL of 1:1 acetone-concentrated hydrochloric acid solution. Weigh 20.0 g (314.6 mmol) of copper powder and put it into the iodine-acetone solution, seal it and add a magnetic stirrer to stir for 30 minutes to form copper iodide, and the copper powder shows light gray. Filter by suction, transfer the filter cake to the acetone-concentrated hydrochloric acid solution, seal it and add a magnetic stirrer to stir for 30 minutes to dissolve the copper iodide. Filter out the remaining grayish-white and red copper powder, transfer the filter cake to a 1000 mL beaker, wash it with 400 mL of acetone, filter by suction, and vacuum dry for half an hour to obtain activated copper powder. It should be prepared and used immediately.
[0084] (b) Coupling reaction
[0085] 5.6000 g (20 mmol) of powdered methyl 3-fluoro-4-iodobenzoate was thoroughly ground with 16.8160 g (264.6 mmol) of copper powder, wrapped into a chewing gum-like shape with a long strip of aluminum foil, bent with a small test tube and stuffed into a three-necked flask, and an appropriate amount of copper powder was embedded. The ventilation reflux device was set up, and after purging with argon for 20 minutes, the ventilation was stopped, and the temperature was gradually raised to 240 °C (the oil temperature was calibrated with a thermometer). After reacting for 5 hours, the temperature was lowered, and at the same time, the argon purge was resumed.
[0086] (c) Hot extraction
[0087] After cooling, the aluminum foil was taken out with forceps, and the dark red solid inside the aluminum foil and the aluminum foil in direct contact with the solid were transferred into a pre-prepared Soxhlet extractor paper tube. 100 mL of toluene was added to the Soxhlet extractor and the lower receiving flask respectively, and heated to 140 °C for reflux for 8 hours. The extract was transferred to a 250 mL eggplant-shaped flask and evaporated to dryness, and a yellow solid was obtained at the bottom of the flask.
[0088] (d) Column chromatography separation (using dichloromethane as the eluent)
[0089] R f = 0.77 is the starting material point, R f = 0.59 is the product point, R f = 0.30 emits blue fluorescence and is the impurity point.
[0090] Product properties: white powder, melting point 134 - 136 °C.
[0091] Yield: 3.0620 g
[0092] (4) Synthesis of 2,2'-difluoro-4,4'-biphenyldicarboxylic acid (H2L)
[0093]
[0094] The experimental procedure is as follows:
[0095] (a) Ester hydrolysis reaction
[0096] 3.0000 g (9.9 mmol) of methyl 2,2'-difluoro-4,4'-biphenyldicarboxylate, 4.9860 g (88.8 mmol) of KOH and 120 mL of methanol were mixed in a 250 mL eggplant-shaped flask, stirred and refluxed at 65 °C. After reacting for 3 hours, it was a white suspension. A small amount of distilled water was added and stirred until it became clear.
[0097] (b) Washing and acidification
[0098] 6M hydrochloric acid was added to adjust the pH value to 2 - 6, and a large amount of white precipitate appeared. It was filtered under atmospheric pressure, washed with water, and dried in vacuo to obtain 2,2'-difluoro-4,4'-biphenyldicarboxylic acid.
[0099] Product properties: white (needle-shaped) crystals, melting point above 250 °C.
[0100] Among them, the nuclear magnetic resonance spectrum of H2L is as Figure 2 shown.
[0101] Theoretical yield: 2.7240 g.
[0102] 2. Synthesis of Eu-MOF: Eu(NO3)3·6H2O (0.0446 g, 0.1 mmol), H2L (0.0417 g, 0.15 mM), DMF (2.5 mL) and H2O (2.5 mL) were heated in a 25 mL stainless steel reactor lined with polytetrafluoroethylene at 120 °C for 6 hours, then cooled to ambient temperature to obtain [Eu2L3(H2O)5]·0.5H2O·1.25DMF, that is, colorless flaky crystals of Eu-MOF were obtained. Yield: 73.3% (0.0485 g), based on Eu(III). Infrared spectrum (cm -1 -1): 3450 (m), 3075 (s), 1643 (s), 1585 (s), 1545 (m), 1423 (m), 1228 (m), 780 (m). Analyses of C 91.5 H 75.5 Eu 12 N 2.5 O 37.5 calculated values (%) are: C 41.54, H 2.88, N 1.32 Found: C 41.42, H 2.76, N 1.27. It can be seen that Eu-MOF is assembled from 2,2'-difluoro-4,4'-biphenyldicarboxylic acid (H2L) as the ligand and europium ions (Eu 3+ ) as the metal nodes, and the preparation time of Eu-MOF is only 6 h.
[0103] Example 2 Analysis of Eu-MOF
[0104] Determination of the crystal structure of Eu-MOF: The single crystal data of Eu-MOF were collected on a Bruker Smart APEX II CCD instrument at 293(2) K. The data were integrated and restored using SAINT software. The collected diffraction points were empirically corrected for absorption using SADABS software, and the space group was determined by the XPREP program. The crystal structure of Eu-MOF was analyzed using SHELXTL-2014 software. The results show that Eu-MOF crystallizes in the triclinic system, space group P-1 (Table 2).
[0105] Table 2 Crystal data and structure refinement of Eu-MOF
[0106]
[0107] Tables 3 and 4 list the bond lengths and bond angles of Eu-MOF. The crystal data have been deposited in the Cambridge Crystallographic Data Centre (CCDC) with the deposition number 1575661 (293 K).
[0108] Selected bond lengths of Eu-MOF
[0109]
[0110]
[0111] Selected binding angles (°) of LOF1-4
[0112]
[0113] As Figure 4 shown in A, the asymmetric unit of Eu-MOF contains two Eu(III) ions, three L 2- ligands, 1.25 DMF, and 5.5 H2O. The Eu1(III) center is octa-coordinated by six oxygen atoms from six L 2- ligands and two oxygen atoms from two coordinated H2O molecules ( Figure 4 B). The coordination environment of the Eu2(III) center is similar to that of Eu1(III), except that Eu(III) is octa-coordinated by five oxygen atoms from five L 2- ligands and three oxygen atoms from three coordinated H2O molecules. In addition, both the Eu1O8 and Eu2O8 units exhibit a triangular dodecahedron configuration ( Figure 4 B). The Eu1 and Eu2 units are connected by carboxyl groups, generating a one-dimensional (1D) [Eu2(CO2)2]n inorganic chain extending along the a-axis ( Figure 4 D). These 1D chains are connected by one coordination mode of the L 2- ligand, generating a 2D layer along the ab plane, and then connected by another coordination mode of the L 2- ligand, generating a 3D network structure ( Figure 4 C, Figure 4 E). The biphenyl backbone, together with the fluorine groups of L 2- in Eu-MOF, tends to have π-stacking, hydrogen bonding, and electrostatic interactions with pDNA. Notably, Eu-MOF shows rectangular channels along the axis with a window size of 5.3×10.5 ( Figure 6), which is not sufficient to allow pDNA to enter the pores. Therefore, the dye-labeled pDNA probe can be adsorbed on the surface of the substrate of these 3D structures, resulting in a large amount of fluorescence quenching due to the PET process. However, after the pDNA probe hybridizes with its complementary target RNA, the DNA-miRNA heteroduplex will have a relatively weak interaction with Eu-MOF and separate from it, resulting in the recovery of the quenched fluorescence. Therefore, Eu-MOF can be used as a sensing platform for fluorescent detection of target miRNA.
[0114] Energy Dispersive Spectroscopy (EDS) analysis of Eu-MOF: As Figure 3 shown in A, Eu(III) ions exist in Eu-MOF. The Eu-MOF prepared in Example 1 was soaked in deionized water for 30 days to obtain water-treated Eu-MOF, and the water stability of Eu-MOF was detected by PXRD. The experimental powder X-ray diffraction (PXRD) pattern of Eu-MOF is in good agreement with the simulated pattern from the single crystal, indicating that the Eu-MOF was successfully prepared by the method of the present invention ( Figure 3 B and Figure 3 C). Moreover, due to the special structure and strong hydrophobicity of the F group, Eu-MOF was found to have excellent water stability, and even after soaking in water for 30 days, there was no change in PXRD ( Figure 3 B). Among them, Figure 3 the XRD pattern of the simulated Eu-MOF in B was obtained by inputting the crystallographic data file (CIF) (the CIF file was obtained after testing the single crystal with a single crystal diffractometer) into the Diamond software.
[0115] As Figure 5 shown (Insert: Photograph image of Eu-MOF under 252 nm ultraviolet light), when the aqueous dispersion of Eu-MOF was irradiated with a 252 nm ultraviolet lamp, Eu-MOF emitted red fluorescence, which could be easily observed with the naked eye at this time; moreover, Eu-MOF presented three emission peaks at 590 nm, 614 nm, and 698 nm respectively, which was attributed to the characteristic emission of Eu 3+ caused by the intermolecular energy transfer from H2L to Eu 3+ . In addition, the color and brightness of the sample did not change after continuous irradiation for 12 hours, indicating that Eu-MOF has excellent photostability.
[0116] Optimization of reaction parameters in Example 3
[0117] Since the concentration of Eu-MOF, DSN, reaction time, and reaction temperature have significant effects on the detection of miRNA (miR-892b was selected in this example). Therefore, these factors were optimized to achieve the best performance.
[0118] 1. Study the effect of the amount of Eu-MOF on the fluorescence quenching efficiency. Before analysis, grind 50 μg / mL Eu-MOF for 10 minutes first, and then mix it with 10 μg / mL PVP in 10 mM Tris-HCl (pH 8.0). Then add 50 nM probe-labeled FAM-DNA (abbreviated as pDNA), 2 U / mL RNase inhibitor, 0.4 U / mL DSN, and target miRNA with a final concentration of 5000 pM. Then incubate the mixture at 55 °C for 30 minutes, and then perform fluorescence spectroscopy analysis. A smartphone was used to capture photos of the samples, which were then displayed in the analysis software ImageJ. The detection area of the application has been selected in the application. Use the rectangular tool to select a fixed area with a size of 1×1 cm 2 The software calculates the RGB values and outputs the quantitative analysis results. The fluorescence intensity was also recorded using a microplate reader with an excitation wavelength of 485 nm. The results are as Figure 7 shown in A. In the absence of miRNA, when the Eu-MOF concentration is below 50 μg / mL, the fluorescence intensity of the solution decreases sharply with the increase of the Eu-MOF concentration. However, with the addition of the target miRNA, as the Eu-MOF concentration further increases to above 50 μg / mL, the fluorescence intensity slightly recovers. Therefore, to obtain the best sensitivity, 50 μg / mL Eu-MOF was used in the following experiments.
[0119] 2. According to the above method, study the effects of temperatures at 40 °C, 45 °C, 50 °C, 55 °C, 60 °C, and 65 °C on the experimental results (Eu-MOF concentration is 50 μg / mL). The largest difference in fluorescence intensity with or without miRNA was obtained at 50 °C ( Figure 7 B), which is also close to the optimal reaction temperature of DSN. Therefore, 50 °C was used as the optimal reaction temperature.
[0120] 3. According to the above method, study the effect of the reaction time on the detection performance (Eu-MOF concentration is 50 μg / mL, temperature is 50 °C). Figure 7 As shown in C, in the absence of miRNA, the fluorescence intensity increases slowly with the increase of the reaction time. On the contrary, in the presence of miRNA, as the reaction time increases from 0 to 1 h, the fluorescence intensity increases significantly and then becomes stable. Therefore, 1 h is the optimal reaction time.
[0121] 4. According to the above method, study the effect of the DSN concentration (Eu-MOF concentration is 50 μg / mL, temperature is 50 °C, reaction time is 1 h). When DSN is 0.4 U / mL, the highest observed fluorescence intensity is obtained ( Figure 7 D).
[0122] Detection of miRNA in Example 4
[0123] Quantitative analysis of miRNA (miR-892b was selected in this example) was carried out according to the steps of Example 3 (Eu-MOF concentration was 50 μg / mL, temperature was 50 °C, reaction time was 1 h, and DSN concentration was 0.4 U / mL). The optical image of miRNA and the program for creating a concentration color card are as Figure 8 shown in A. The optical image of the miRNA solution was captured and analyzed using a smartphone to obtain a concentration color card. Obviously, the color intensity of the miRNA solution increased steadily as the miRNA concentration increased from 1 pM to 5000 pM ( Figure 8 B), which could be observed by the naked eye. The results showed a good linear relationship between the color intensity and the logarithm of the miRNA concentration: Y = 109.538 + 21.3469X (R 2 = 0.993), and the limit of detection (LOD) was 0.32 pM ( Figure 8 C). Among them, Y is the color intensity and X is the logarithm of the miRNA concentration. To confirm the accuracy of the present invention, the corresponding samples were further detected using a microplate reader. Figure 9 It was shown that as the concentration of the target miRNA increased, the fluorescence intensity at 517 nm increased significantly. Figure 9 The insert (insert: the linear relationship between the fluorescence intensity value at 517 nm and the logarithm of the target miRNA concentration (specificity of miRNA detection: the bar represents the fluorescence intensity of different miRNAs at the same concentration of 10 nM, insert: the sequences of miRNAs; the error was obtained based on the results of three independent experiments) also revealed the relationship between the fluorescence intensity of different miRNA concentrations and the calibration graph. In the range of 1 μm to 1 nM, the fluorescence intensity had a linear relationship with the logarithm of the target miRNA concentration. The calibration equation was Y = 181.780 + 255.615X, and the correlation coefficient R 2 = 0.992, where Y is the fluorescence intensity and X is the logarithm of the target miRNA concentration. Importantly, the limit of detection (LOD) was 0.32 pM, which was lower than some reported fluorescence sensors for miRNA detection (Table 5).
[0124] Table 5 Comparison of detection performance with other methods
[0125]
[0126]
[0127] In addition, Figure 8 B illustrates that the color intensity of the miRNA solution increased steadily as the miRNA concentration increased, ranging from 1 pM to 5000 pM, which could be observed by the naked eye.
[0128] Example 5 Detection of Different Target RNAs
[0129] According to the method described in Example 4, complementary target miRNA (miRNA-892b), single-base mismatched target (T-Mut1), double-base mismatched target (T-Mut2), triple-base mismatched target (T-Mut3), Let-7a, miR-21, and miR-141 with the same concentration (10 nM) were used to test and analyze the selectivity. Samples without target miRNA were also used as blank controls. Figure 10 Low fluorescence intensities were detected with Let-7a, miR-21, and miR-141, which were slightly higher than the blank control. In addition, a significant increase in the fluorescence intensity of the target RNA was observed, while miRNAs with only a few base differences (T-Mut 1, T-Mut2, and T-Mut3) could only induce weak signals. Therefore, the experimental results indicate that our method has strong sequence specificity and can distinguish target miRNA from other miRNAs, even single-base mutations. Among them, the sequence of Target (miR-892b) is SEQ ID NO.1: CACUGGCUCCUUUCUGGGUAGA, the sequence of T-Mut 1 is SEQ ID NO.3: CACUGGCUGCUUUCUGGGUAGA, the sequence of T-Mut2 is SEQ ID NO.4: CACUGGCUGAUUUCUGGGUAGA, the sequence of miR-21 is SEQ ID NO.6: UAGCUUAUCAGACUGAUGUUGA, the sequence of miR-141 is SEQ ID NO.7: UAACACUGUCUGGUAAAGAUGG, and the sequence of Let-7a is SEQ ID NO.8: UGAGGUAGUAGGUUGUAUAGUU.
[0130] Example 6 Determination of miRNA in Samples
[0131] According to the method described in Example 4, our method was tested for its applicability to real samples by testing small RNAs extracted from five cell lines, including normal MCF-10A cells and MCF-7 cells, BT-474 cells, BT-549 cells, and MDA-MD-435 cells. The same samples were also measured by qRT-PCR method. The amounts of miR-892b detected by the two methods were converted into the copy number of miRNA molecules for comparison ( Figure 11)。Among them, the bars represent the copy number of miR-892b per ng cell determined by the Eu-MOF system (red bars) and qRT-PCR (blue bars) using the present invention. Error bars are the standard deviation of three replicate experiments. The results show that miR-892b has different expression levels in different cancer cell lines. Cell lysates from BT-549 have a lower miR-892b concentration than MCF-10A. In addition, different amounts of known concentrations of miR-892b were added to the cell lysates of BT-549 cells and the serum collected from healthy humans to test the accuracy of the proposed method. Figures 12 - 14 Shows a comparison between Eu-MOF and conventional sensing and fluorescence quenching materials such as molybdenum disulfide. By gradually adding equal concentrations of Eu-MOF or MoS2, the fluorescence intensity was recorded at 517 nm ( Figure 12 ), where the concentration of FAM-DNA was 50 nM. 50 μg / mL of MoS2 showed a 30% quenching efficiency for FAM-DNA, while almost 90% of the FAM-DNA fluorescence was quenched after adding 50 μg / mL of Eu-MOF. These results indicate that Eu-MOF has better fluorescence quenching ability. In addition, as Figure 13 shown, when Eu-MOF or MoS2 was mixed with FAM-DNA, the fluorescence intensity of the mixture was recorded at 517 nm. Among them, the concentration of Eu-MOF or MoS2 was fixed at 50 μg / mL, and the concentration of FAM-DNA was 50 nM. The quenching process was completed within 15 minutes. Compared with MoS2, the fluorescence intensity of the Eu-MOF group decreased sharply within 1 minute, indicating that FAM-DNA was rapidly fluorescence quenched by Eu-MOF. Importantly, a significant advantage of Eu-MOF is its self-luminescence property. As Figure 14 shown (from left to right: 0, 1, 2, 5, 10, 20, 50, 100, 200, 500, 1000, and 5000 pM), the non-luminescent MoS2 group showed an increase in the signal intensity of green fluorescence. In contrast, the luminescent Eu-MOF group showed a color change from red to yellow, which was induced by the addition of the target miRNA. The strong contrast between the red signal of Eu-MOF and the yellow signal generated by the pDNA@Eu-MOF hybrid enabled the discrimination of low concentrations of the target miRNA. Finally, the fluorescence stability of Eu-MOF in an aqueous environment for 30 days was studied, and the fluorescence intensity was recorded at 614 nm within 30 days ( Figure 15 ). The fluorescence intensity of Eu-MOF did not show a significant change after 30 days of storage, indicating that Eu-MOF has excellent fluorescence stability. These results show that Eu-MOF has advantages such as high fluorescence quenching efficiency, short response time, self-luminescence, and good fluorescence stability, and is a good alternative material for detecting various biomolecules.
Claims
1. Application of Eu-MOF probe material or smartphone-based Eu-MOF-derived sensing system in detecting miRNA, characterized in that, The Eu-MOF-derived sensing system based on a smartphone includes a Eu-MOF probe material; the crystal structure of the Eu-MOF probe material is triclinic P space group -1, a a = 10.115 (4) Å, b b = 14.482 (6) Å, c c = 17.778(7) Å, α α = 104.143 (4)°, β β = 98.718 (5)°, γ γ = 101.196 (5)°, V V = 2422.4 (17) Å 3 , Z Z = 1; the chemical formula of the Eu-MOF probe material is [Eu2L3(H2O)5]∙0.5H2O∙1.25DMF, and the organic ligand H2L is 2,2′-difluoro-4,4′-biphenyldicarboxylic acid.
2. A method for detecting miRNA, characterized in that, It includes the following steps: grinding the Eu-MOF probe material and mixing it with polyvinylpyrrolidone in Tris-HCl, adding the probe-labeled FAM-DNA, RNase inhibitor, DSN and miRNA, incubating, performing fluorescence spectroscopy analysis, taking a photo of the sample with a smartphone, displaying it in the analysis software, calculating the RGB values and outputting the quantitative analysis results; Obtain the relationship between fluorescence intensity and miRNA concentration, and obtain the miRNA concentration based on the fluorescence intensity; the crystal structure of the Eu-MOF probe material is triclinic P -1 space group, a a = 10.115 (4) Å, b b = 14.482 (6) Å, c c =17.778 (7) Å, α α = 104.143 (4)°, β β = 98.718 (5)°, γ γ = 101.196 (5)°, V V = 2422.4(17) Å 3 , Z Z = 1; the chemical formula of the Eu-MOF probe material is [Eu2L3(H2O)5]∙0.5H2O∙1.25DMF, and the organic ligand H2L is 2,2′-difluoro-4,4′-biphenyldicarboxylic acid.
3. The method according to claim 2, wherein The linear relationship between the fluorescence intensity and the logarithm of the miRNA concentration is Y = 181.780 + 255.615X, and the correlation coefficient R 2 = 0.992, where Y is the fluorescence intensity and X is the logarithm of the miRNA concentration.
4. The method according to claim 2, wherein After incubation, the color intensity was observed, and the linear relationship between the color intensity and the logarithm of miRNA concentration was Y = 109.538 + 21.3469X, with a correlation coefficient R 2 = 0.993; where Y is the color intensity and X is the logarithm of the miRNA concentration.
5. The method according to claim 2, characterized in that, The concentration ratio of the Eu-MOF probe material to polyvinylpyrrolidone is 5:1; the concentration ratio of the probe-labeled FAM-DNA, RNase inhibitor and DSN is 50:2:0.4 nM / (U / mL) / (U / mL); the concentration ratio of the Eu-MOF probe material to Tris-HCl is 5:1 (μg / mL) / mM.
6. The application according to claim 1 or the method according to any one of claims 2 to 5, characterized in that, The sequence of the miRNA is shown as SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.5.
Citation Information
Patent Citations
A ratiometric fluorescent probe and its preparation method and application
CN113637470B